Construction of recombinant Escherichia coli and application of recombinant Escherichia coli in heme derivative synthesis

Abstract

The invention provides recombinant Escherichia coli for synthesizing heme and derivatives thereof, and the recombinant Escherichia coli is used for knocking out genes such as pyruvate oxidase poxB, pyruvate formate lyase pflB and porphyrinoperoxidase yfeX and enhancing genes such as phosphoenolpyruvate carboxylase ppc, glycerol transporter glpF and 3-phosphoglycerol dehydrogenase glpD, so that the heme and the derivatives thereof can be synthesized. After genes such as exogenous 5-aminolevulinic acid synthase hemA and ferrous chelating enzyme hemH are introduced, the heme and the derivatives thereof can be synthesized by taking glycerol as a raw material, and the heme has an application prospect in the field of biological manufacturing.

Description

Technical Field

[0001] The present invention relates to the fields of gene editing, gene recombination-edited microbial strains, synthetic biology, and microbial biosynthesis technology, and in particular to a recombinant Escherichia coli strain for synthesizing heme derivatives and a preparation method thereof. Background Art

[0002] In recent years, the artificial meat market has grown rapidly and has become a hot topic in the food technology field. Artificial meat is based on plant protein or cell culture technology and aims to provide a more sustainable, healthy, and ethical meat alternative. As a key component of artificial meat, heme plays a vital role in enhancing its taste, flavor, and texture. By combining with the protein components in artificial meat, heme can give the product a "meaty aroma" and rosy appearance similar to traditional meat, significantly enhancing the consumer's sensory experience. With consumers' increasing attention to environmental protection, healthy diet, and animal welfare, the artificial meat market is expected to continue to expand. However, the industry still faces key challenges such as heme cost control, consumer acceptance, and regulatory approval. In the future, with technological advancements and the advancement of large-scale production, artificial meat and its core ingredient heme are expected to further drive the transformation and upgrading of the food industry, providing the world with more sustainable dietary options.

[0003] Heme, a porphyrin compound containing Fe²⁺, plays an important role in regulating iron homeostasis, transporting oxygen, transferring electrons, and facilitating energy metabolism. It is widely used in the food and healthcare industries. Its derivatives also hold broad application prospects in medicine, healthcare, and food. Currently, heme production relies primarily on chemical synthesis or extraction from plant and animal tissues (such as blood). These methods often suffer from low product purity, numerous byproducts, and severe environmental pollution. Several high-value-added heme derivatives found in nature have extremely low natural abundance and high extraction costs, far from meeting market demand.

[0004] In recent years, the technology for producing high-value-added chemicals through biosynthesis has developed rapidly. Glycerol, as an inexpensive, readily available, green organic feedstock, provides abundant precursors and energy for biosynthesis, making it an ideal biomanufacturing feedstock. Although numerous studies have explored metabolically engineering microorganisms to synthesize heme and its derivatives, the limited technical approaches have resulted in low levels of heme and its derivatives produced by microbial strains (for example, reported heme yields typically do not exceed 300 mg / L [Nature Catalysis 1:720–728; CN106434509A]; and bilirubin yields do not exceed 20 mg / L [CN116555148A]). Establishing microbial synthesis routes using glycerol as a feedstock for the production of heme and its derivatives is crucial for achieving efficient and green manufacturing. Summary of the Invention

[0005] The technical problem to be solved by the present invention is: how to use glycerol as a raw material to provide precursors in Escherichia coli, and then efficiently synthesize hemoglobin and its derivative compounds.

[0006] In order to solve the above technical problems, in a first aspect, the present invention provides a recombinant Escherichia coli, which is a recombinant bacterium obtained by carrying out the following transformations (1) to (27) in Escherichia coli;

[0007] (1) Knockout of the gene encoding pyruvate oxidase (poxB);

[0008] (2) knockout of the gene encoding pyruvate formate lyase (pflB);

[0009] (3) Knockout of the gene encoding the galactose repressor (galR);

[0010] (4) Knockout of the gene encoding the fatty acid degradation transcription factor (fadR);

[0011] (5) Knockout of the gene encoding porphyrinogen peroxidase (yfeX);

[0012] (6) Enhance the expression of phosphoenolpyruvate carboxylase gene (ppc);

[0013] (7) Enhance the expression of the glycerol transporter gene (glpF);

[0014] (8) Enhance the expression of glycerol-3-phosphate dehydrogenase gene (glpD);

[0015] (9) Enhance the expression of phosphoglycerate dehydrogenase gene (serA);

[0016] (10) Enhance the expression of the phospho-L-serine aminotransferase gene (serC);

[0017] (11) Enhance the expression of L-serine hydroxymethyltransferase gene (glyA);

[0018] (11) Enhance the expression of 3-hydroxypropionaldehyde dehydrogenase gene (puuC);

[0019] (13) Enhance the expression of acetyl-CoA carboxylase α subunit gene (accA);

[0020] (14) Enhance the expression of methylmalonyl-CoA mutase gene (scpA);

[0021] (15) Enhance the expression of porphobilinogen synthase gene (hemB);

[0022] (16) Enhance the expression of hydroxymethylcholine synthase gene (hemC);

[0023] (17) Enhance the expression of uroporphyrinogen decarboxylase gene (hemE)

[0024] (18) Enhance the expression of coproporphyrinogen oxidase gene (hemF);

[0025] (19) Enhance the expression of protoporphyrinogen oxidase gene (hemG);

[0026] (20) Introducing the glycerol dehydratase gene cluster (dhaB), including genes encoding glycerol dehydratase α subunit, glycerol dehydratase β subunit, and glycerol dehydratase γ subunit;

[0027] (21) Introducing the glycerol dehydratase activating factor gene cluster (gdrAB), including genes encoding the glycerol dehydratase activating factor α subunit and the glycerol dehydratase activating factor β subunit;

[0028] (22) Introduction of the propionyl-CoA synthetase gene (pcs);

[0029] (23) Introduction of the propionyl-CoA carboxylase β subunit gene (pccB);

[0030] (24) Introduction of carbonic anhydrase gene (CA);

[0031] (25) Introduction of carbon assimilation factor gene (BT);

[0032] (26) introducing the methylmalonyl-CoA epimerase gene (mmcE);

[0033] (27) Introduction of 5-aminolevulinic acid synthase gene (hemA);

[0034] (28) Introducing the ferrochelatase gene (hemH).

[0035] The modifications of (2), (20), and (21) mentioned above can be specifically as follows: the coding region of the gene encoding pyruvate formate lyase (pflB) is replaced with the P119 promoter, the glycerol dehydratase gene cluster (dhaB), and the glycerol dehydratase activating factor gene cluster (gdrAB).

[0036] The modifications of (3), (22), (23), and (26) mentioned above can be specifically as follows: the coding region of the gene encoding the galactose repressor (galR) is replaced by the P119 promoter, the propionyl-CoA synthetase gene (pcs), the propionyl-CoA carboxylase β subunit gene (pccB), and the methylmalonyl-CoA isomerase gene (mmcE).

[0037] The modifications of (4), (24), and (25) above can be specifically as follows: replacing the coding region of the gene encoding the fatty acid degradation transcription factor (fadR) with the P119 promoter and the carbonic anhydrase gene (CA);

[0038] (25) Introducing carbon assimilation factor gene (BT).

[0039] The modifications of (6)-(19) above can be specifically as follows: replacing the promoters of phosphoenolpyruvate carboxylase gene (ppc), glycerol transporter gene (glpF), 3-phosphoglycerate dehydrogenase gene (glpD), phosphoglycerate dehydrogenase gene (serA), phospho-L-serine aminotransferase gene (serC), L-serine hydroxymethyltransferase gene (glyA), 3-hydroxypropionaldehyde dehydrogenase gene (puuC), acetyl-CoA carboxylase α-subunit gene (accA), methylmalonyl-CoA mutase gene (scpA), porphobilinogen synthase gene (hemB, hydroxymethylbilinogen synthase gene (hemC), uroporphyrinogen decarboxylase gene (hemE), coproporphyrinogen oxidase gene (hemF), and protoporphyrinogen oxidase gene (hemG) with the P119 promoter.

[0040] The modification of (27) mentioned above can be specifically as follows: introduction in the form of pS-H plasmid.

[0041] The modification of (28) mentioned above can be specifically as follows: introduction in the form of pY-H plasmid.

[0042] Furthermore, the glycerol dehydratase gene cluster (dhaB) may be derived from Klebsiella pneumoniae.

[0043] Furthermore, the glycerol dehydratase activator gene cluster (gdrAB) may be derived from Klebsiella pneumoniae.

[0044] Furthermore, the propionyl-CoA synthetase gene (pcs) may be derived from Chloroflexus aurantiacus.

[0045] Furthermore, the propionyl-CoA carboxylase β subunit gene (pccB) may be derived from Streptomyces coelicolor.

[0046] Furthermore, the carbonic anhydrase gene (CA) may be derived from Picosynechococcus.

[0047] Furthermore, the carbon assimilation factor gene (BT) may be derived from cyanobacteria (Cyanophyceae).

[0048] Furthermore, the methylmalonyl-CoA epimerase gene (mmcE) may be derived from Propionibacterium freudenreichii.

[0049] Furthermore, the 5-aminolevulinic acid synthase gene (hemA) may be derived from Cereibacter sphaeroides.

[0050] Furthermore, the ferrochelatase gene (hemH) may be derived from Pantoea ananatis.

[0051] In a second aspect, the present invention provides a recombinant Escherichia coli, wherein the transformations (1) to (28) and the following transformations are performed in the Escherichia coli:

[0052] (29) Strengthen the cytochrome c maturation protein A gene (ccmA).

[0053] The modification of the above (29) can be specifically as follows: replacing the promoter of the cytochrome c maturation protein A gene (ccmA) with the P119 promoter.

[0054] In a third aspect, the present invention provides a recombinant Escherichia coli, wherein the transformations (1) to (28) and the following transformations are performed in the Escherichia coli:

[0055] (30) Introduction of the heme oxygenase gene (ho1);

[0056] (31) Introduce the biliverdin reductase gene (bvr).

[0057] The modifications of (28), (30), and (31) mentioned above can be specifically: introduced in the form of pY-HHB plasmid.

[0058] Furthermore, the heme oxygenase gene (ho1) may be derived from Prochlorococcus marinus.

[0059] Furthermore, the biliverdin reductase gene (bvr) may be derived from Mycobacterium paraintracellulare.

[0060] In a fourth aspect, the present invention provides a method for constructing a recombinant Escherichia coli with improved hemoglobin production, comprising the following steps: performing the transformation according to the transformation (1)-(28) in the first aspect and the transformation (29) in the second aspect.

[0061] In a fifth aspect, the present invention provides a method for constructing a recombinant Escherichia coli with improved bilirubin production, comprising the following steps: performing the transformation according to the transformation methods (1)-(28) in the first aspect and (30) and (31) in the third aspect.

[0062] In a sixth aspect, the present invention provides a method for producing or increasing hemoglobin production, comprising the following steps: culturing the recombinant Escherichia coli described in the second aspect with glycerol as a carbon source, collecting the bacteria, and obtaining hemoglobin; and a method for producing or increasing bilirubin production, comprising the following steps: culturing the recombinant Escherichia coli described in the third aspect with glycerol as a carbon source, collecting the bacteria, and obtaining bilirubin.

[0063] In a sixth aspect, the present invention provides the use of the recombinant Escherichia coli described in the second aspect in producing or increasing hemoglobin production; and the use of the recombinant Escherichia coli described in the third aspect in producing or increasing bilirubin production.

[0064] In the seventh aspect, the present invention provides a product for producing or increasing hemoglobin production, the active ingredient of which is the recombinant Escherichia coli described in the second aspect; and a product for producing or increasing bilirubin production, the active ingredient of which is the recombinant Escherichia coli described in the third aspect.

[0065] The above-mentioned product may be a bacterial agent containing the recombinant bacteria and / or a culture of the recombinant bacteria.

[0066] The term "culture" refers to any liquid or solid product (i.e., fermentation product) containing a microbial population after artificial inoculation and cultivation. This refers to a product obtained by growing and / or amplifying microorganisms. It can be a biologically pure culture of the microorganism or contain a certain amount of culture medium, metabolites, or other components produced during the cultivation process.

[0067] In a specific embodiment of the present invention, the glycerol medium composition and final concentrations are as follows: Na2HPO4: 25 mM, KH2PO4: 25 mM, NH4Cl: 50 mM, Na2SO4: 5 mM, MgSO4: 2 mM, glycerol: 2% (g / 100 mL), yeast extract: 0.5% (g / 100 mL). During the transformation process, glycerol may be added to a final concentration of 1% (g / 100 mL).

[0068] In a specific embodiment of the present invention, the starting Escherichia coli can be Escherichia coli MG1655, Escherichia coli BW25113, or Escherichia coli MC02.

[0069] In the present invention, the nucleotide sequence of the P119 promoter is SEQ ID No.3.

[0070] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the pyruvate oxidase (poxB) is CAD6018048.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding the pyruvate oxidase (poxB) is Gene ID: 946132 (2025.6.25).

[0071] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the pyruvate formate lyase (pflB) is NP_415423.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding the pyruvate formate lyase (pflB) is Gene ID: 945514 (2025.6.25).

[0072] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the galactose repressor (galR) is CAD6004914.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding the galactose repressor (galR) is Gene ID: 947314 (2025.6.25).

[0073] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the fatty acid degradation transcription factor (fadR) is NP_415705.1, and the NCBI Reference Sequence (NCBI Reference Sequence) of the gene encoding the fatty acid degradation transcription factor (fadR) is Gene ID: 948652 (2025.6.25).

[0074] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the porphyrinogen peroxidase (yfeX) is NP_416926.4, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding the porphyrinogen peroxidase (yfeX) is Gene ID: 946913 (2023.4.14).

[0075] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the phosphoenolpyruvate carboxylase (ppc) is NP_418391.1, the NCBI Reference Sequence Number (NCBI Reference Sequence) of its encoding gene is Gene ID: 948457 (2025.6.25), and the replaced promoter sequence is NC_000913.3 (4153099-4153200(-)).

[0076] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the glycerol transporter (glpF) is NP_418362.1, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding it is Gene ID: 948422 (2025.6.25), and the replaced promoter sequence is NC_000913.3 (4118091-4118280(-)).

[0077] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the glycerol-3-phosphate dehydrogenase (glpD) is NP_417884.1, the NCBI Reference Sequence Number (NCBI Reference Sequence) of its encoding gene is Gene ID: 947934 (2025.6.25), and the replaced promoter sequence is NC_000913.3 (3561941-3562012(+)).

[0078] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the phosphoglycerate dehydrogenase (serA) is NP_417388.1, the NCBI Reference Sequence Number (NCBI Reference Sequence) of its encoding gene is Gene ID: 945258 (2024.7.6), and the replaced promoter sequence is NC_000913.3 (3058411-3058560(-)).

[0079] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the phospho-serine L-aminotransferase (serC) is NP_415427.1, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding it is Gene ID: 945527 (2024.7.6), and the replaced promoter sequence is NC_000913.3 (957572-957652(+)).

[0080] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the L-serine hydroxymethyltransferase (glyA) is NP_417046.1, the NCBI Reference Sequence Number (NCBI Reference Sequence) of its encoding gene is Gene ID: 947022 (2024.7.6), and the replaced promoter sequence is NC_000913.3 (2685508-2685660(-)).

[0081] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the 3-hydroxypropionaldehyde dehydrogenase (puuC) is NP_415816.1, the NCBI Reference Sequence Number (NCBI Reference Sequence) of its encoding gene is Gene ID: 947003 (2024.7.6), and the replaced promoter sequence is NC_000913.3 (1362541-1362742 (+)).

[0082] In the present invention, the NCBI reference sequence number (NCBI Reference Sequence) of the acetyl-CoA carboxylase α subunit (accA) is NP_414727.1, the NCBI reference sequence number (NCBI Reference Sequence) of its encoding gene is Gene ID: 944895 (2024.7.6), and the replaced promoter sequence is NC_000913.3 (208618-208620 (+)).

[0083] In the present invention, the NCBI reference sequence number (NCBI Reference Sequence) of the methylmalonyl-CoA mutase (scpA) is NP_417392.1, the Genbank number of its encoding gene is Gene ID: 945576 (2024.7.6), and the replaced promoter sequence is NC_000913.3 (3060760-3060849 (+)).

[0084] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the porphobilinogen synthase (hemB) is NP_414903.4, the NCBI Reference Sequence Number (NCBI Reference Sequence) of its encoding gene is Gene ID: 945017 (2023.4.14), and the replaced promoter sequence is NC_000913.3 (389728- 389777 (-)).

[0085] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the hydroxymethylcholine synthase (hemC) is YP_026260.1, the NCBI Reference Sequence Number (NCBI Reference Sequence) of its encoding gene is Gene ID: 947759 (2023.4.14), and the replaced promoter sequence is NC_000913.3 (3990767-3990773 (-)).

[0086] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the uroporphyrinogen decarboxylase (hemE) is NP_418425.1, the NCBI Reference Sequence Number (NCBI Reference Sequence) of its encoding gene is Gene ID: 948497 (2023.4.14), and the replaced promoter sequence is NC_000913.3 (4197691- 4197715 (+)).

[0087] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the coproporphyrinogen oxidase (hemF) is NP_416931.1, the NCBI Reference Sequence Number (NCBI Reference Sequence) of its encoding gene is Gene ID: 946908 (2023.4.14), and the replaced promoter sequence is NC_000913.3 (2553222- 2553224 (+)).

[0088] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the protoporphyrinogen oxidase (hemG) is NP_418292.1, the NCBI Reference Sequence Number (NCBI Reference Sequence) of its encoding gene is Gene ID: 948331 (2023.4.14), and the replaced promoter sequence is NC_000913.3 (4034605-4034607(+)).

[0089] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the cytochrome c mature protein A gene (ccmA) is NP_416705.2, the NCBI Reference Sequence Number (NCBI Reference Sequence) of its encoding gene is Gene ID: 946714 (2025.6.25), and the replaced promoter sequence is NC_000913.3 (2297645-2297656 (-)).

[0090] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the glycerol dehydratase gene cluster is GQ355491.1 (69-2761 (+)) (2009.8.8). The NCBI Reference Sequence Number (NCBI Reference Sequence) of the glycerol dehydratase α subunit is ACU00137.1, encoding the gene GQ355491.1 (69-1736); the NCBI Reference Sequence Number (NCBI Reference Sequence) of the glycerol dehydratase β subunit is ACU00138.1, encoding the gene GQ355491.1 (1749-2333); and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the glycerol dehydratase γ subunit is ACU00139.1, encoding the gene GQ355491.1 (2336-2761).

[0091] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the glycerol dehydratase activating factor gene cluster is CP067831.1 (657637-659460 (+), 652904-652531 (-)) (2022.3.2). The NCBI Reference Sequence Number (NCBI Reference Sequence) of the glycerol dehydratase activating factor α subunit is UMI09744.1, and its encoding gene is CP067831.1 (657637-659460); the NCBI Reference Sequence Number (NCBI Reference Sequence) of the glycerol dehydratase activating factor β subunit is UMI09739.1, and its encoding gene is CP067831.1 (652884-652531 (-)).

[0092] In the present invention, the NCBI Reference Sequence Number of the propionyl-CoA synthetase is AAL47820.2, and the NCBI Reference Sequence Number of the gene encoding the propionyl-CoA synthetase is AF445079.2 (2010.7.8).

[0093] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the propionyl-CoA carboxylase β subunit is CAD30916.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding the propionyl-CoA carboxylase β subunit is AL645882.2 (5359018-5360610 (-)) (2024.10.4).

[0094] In the present invention, the NCBI Reference Sequence Number of the carbonic anhydrase is ACA99983.1, and the NCBI Reference Sequence Number of the gene encoding the carbonic anhydrase is CP000951.1 (2078541-2078939 (-)) (2013.12.11).

[0095] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the carbon assimilation factor is WP_012307968.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding the carbon assimilation factor is NC_010475.1 (2454712-2456130 (+)) (2024.11.7).

[0096] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the methylmalonyl-CoA epimerase is ARO11920.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding the methylmalonyl-CoA epimerase is CP018002.1 (1078786..1079232 (-)) (2017.5.2).

[0097] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the 5-aminolevulinic acid synthase is WP_011337894.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding the 5-aminolevulinic acid synthase is Gene ID: 3720398 (2024.12.19).

[0098] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the ferrochelatase (hemH) is WP_014605551.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding it is Gene ID: 57267780 (2023.9.29).

[0099] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the heme oxygenase (ho1) is WP_011821074.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding it is Gene ID: 60201361 (2023.4.10).

[0100] In the present invention, the NCBI reference sequence number (NCBI Reference Sequence) of the biliverdin reductase (bvr) is WP_008256343.1, and the NCBI reference sequence number (NCBI Reference Sequence) of its encoding gene is AP022584.1 (708882-709289 (-)) (2020.2.6).

[0101] The beneficial technical effects achieved by the present invention are as follows:

[0102] The present invention provides a recombinant Escherichia coli that can synthesize heme and its derivatives at a high level using glycerol as a raw material, thereby providing a new technical route for synthesizing heme and its derivatives, which can be used for the mass production of heme and its derivatives. BRIEF DESCRIPTION OF THE DRAWINGS

[0103] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the specific embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0104] Figure 1 HPLC peak profile of bilirubin (sample). DETAILED DESCRIPTION

[0105] The present disclosure is further described in detail below in conjunction with specific embodiments. The examples provided are intended only to illustrate the present disclosure and are not intended to limit the scope of the present disclosure. The experimental methods in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples are all commercially available unless otherwise specified.

[0106] The liquid LB medium (pH 7.0) in the following examples contained 1 g / 100 mL NaCl, 1 g / 100 mL tryptone, 0.5 g / 100 mL yeast extract, and the balance was water. Solid culture medium is obtained by adding agarose to liquid culture medium.

[0107] The starting E. coli in the following examples can specifically be one of E. coli MG1655, BW25113, and MC02. E. coli MG1655 (CGSC#: 6300), BW25113 (CGSC#: 76376), and plasmid pKD46 (CGSC#: 7739) are products of the Yale University E. coli Genetic Collection (CGSC). E. coli MC02 is deposited with the China General Microorganism Culture Collection (CGMCC) (CGMCC No. 34378). The sequence information of the pSB1s and pYB1k plasmids is disclosed in Patent CN119799606A. pKD46 plasmid: Contains the temperature-sensitive replication origin oriR101, which can replicate normally when cultured at 30°C and will automatically be lost when cultured above 37°C; Escherichia coli carrying the pKD46 plasmid is cultured at 30°C, and Gam, Exo, and Beta are efficiently expressed after induction with arabinose. Once the exogenous dsDNA is electroporated into the cells, homologous recombination with the genomic target sequence can occur; it carries an ampicillin resistance gene as a selection marker. The gene sequence of the pSCre plasmid is shown in SEQ ID NO.9, and the public can obtain it through gene synthesis: Escherichia coli carrying the pSCre plasmid can express the recombinase (Cre) gene when cultured at 30°C, causing the lox66 sequence and lox71 sequence on the chromosome to recombine, thereby eliminating the DNA sequence located between the lox66 sequence and lox71 sequence. In this patent, the kanamycin resistance gene located between the lox66 sequence and lox71 sequence in the sequence of SEQ ID NO.1 can be eliminated; Escherichia coli carrying the pSCre plasmid will automatically lose the pSCre plasmid when cultured at 42°C; and the streptomycin resistance gene is carried as a selection marker.

[0108] Table 1. List of sequence fragments

[0109] Serial number Fragment name Sequence (5’-3’) SEQ ID NO.1 pSCre aatgtgcctgtcaaatggacgaagcagggattctgcaaaccctatgctactccgtcaagccgtcaattgtctgattcgttaccaattatgacaacttgacggctacatcattcactttttcttcacaaccggcacggaactcgctcgggctggccccggtgcattttttaaatacccgcgagaaatagagttgatcgtcaaaaccaacattgcgaccgacggtggcgataggcatccgggtggtgctcaaaagcagcttcgcctggctgatacgttggtcctcgcgccagcttaagacgctaatccctaactgctggcggaaaagatgtgacagacgcgacggcgacaagcaaacatgctgtgcgacgctggcgatatcaaaattgctgtctgccaggtgatcgctgatgtactgacaagcctcgcgtacccgattatccatcggtggatggagcgactcgttaatcgcttccatgcgccgcagtaacaattgctcaagcagatttatcgccagcagctccgaatagcgcccttccccttgcccggcgttaatgatttgcccaaacaggtcgctgaaatgcggctggtgcgcttcatccgggcgaaagaaccccgtattggcaaatattgacggccagttaagccattcatgccagtaggcgcgcggacgaaagtaaacccactggtgataccattcgcgagcctccggatgacgaccgtagtgatgaatctctcctggcgggaacagcaaaatatcacccggtcggcaaacaaattctcgtccctgatttttcaccaccccctgaccgcgaatggtgagattgagaatataacctttcattcccagcggtcggtcgataaaaaaatcgagataaccgttggcctcaatcggcgttaaacccgccaccagatgggcattaaacgagtatcccggcagcaggggatcattttgcgcttcagccatacttttcatactcccgccattcagagaagaaaccaattgtccatattgcatcagacattgccgtcactgcgtcttttactggctcttctcgctaaccaaaccggtaaccccgcttattaaaagcattctgtaacaaagcgggaccaaagccatgacaaaaacgcgtaacaaaagtgtctataatcacggcagaaaagtccacattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccatacccgttttttgggctaacaggaggaattaaccatgggatccaatttactgaccgtacaccaaaatttgcctgcattaccggtcgatgcaacgagtgatgaggttcgcaagaacctgatggacatgttcagggatcgccaggcgttttctgagcatacctggaaaatgcttctgtccgtttgccggtcgtgggcggcatggtgcaagttgaataaccggaaatggtttcccgcagaacctgaagatgttcgcgattatcttctatatcttcaggcgcgcggtctggcagtaaaaactatccagcaacatttgggccagctaaacatgcttcatcgtcggtccgggctgccacgaccaagtgacagcaatgctgtttcactggttatgcggcggatccgaaaagaaaacgttgatgccggtgaacgtgcaaaacaggctctagcgttcgaacgcactgatttcgaccaggttcgttcactcatggaaaatagcgatcgctgccaggatatacgtaatctggcatttctggggattgcttataacaccctgttacgtatagccgaaattgccaggatcagggttaaagatatctcacgtactgacggtgggagaatgttaatccatattggcagaacgaaaacgctggttagcaccgcaggtgtagagaaggcacttagcctgggggtaactaaactggtcgagcgatggatttccgtctctggtgtagctgatgatccgaataactacctgttttgccgggtcagaaaaaatggtgttgccgcgccatctgccaccagccagctatcaactcgcgccctggaagggatttttgaagcaactcatcgattgatttacggcgctaaggatgactctggtcagagatacctggcctggtctggacacagtgcccgtgtcggagccgcgcgagatatggcccgcgctggagtttcaataccggagatcatgcaagctggtggctggaccaatgtaaatattgtcatgaactatatccgtaccctggatagtgaaacaggggcaatggtgcgcctgctggaagatggcgattagctcgagggtagatctggtactagtggtgaattcggtgagctcggtctgcagctggtgccgcgcggcagccaccaccaccaccaccactaatacagattaaatcagaacgcagaagcggtctgataaaacagaatttgcctggcggcagtagcgcggtggtcccacctgaccccatgccgaactcagaagtgaaacgccgtagcgccgatggtagtgtggggtctccccatgcgagagtagggaactgccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgtcgaccagacccgccataaaacgccctgagaagcccgtgacgggcttttcttgtattatgggtagtttccttgcatgaatccataaaaggcgcctgtagtgccatttacccccattcactgccagagccgtgagcgcagcgaactgaatgtcacgaaaaagacagcgactcaggtgcctgatggtcggagacaaaaggaatattcagcgatttgcccgagcttgcgagggtgctacttaagcctttagggttttaaggtctgttttgtagaggagcaaacagcgtttgcgacatccttttgtaatactgcggaactgactaaagtagtgagttatacacagggctgggatctattctttttatctttttttattctttctttattctataaattataaccacttgaatataaacaaaaaaaacacacaaaggtctagcggaatttacagagggtctagcagaatttacaagttttccagcaaaggtctagcagaatttacagatacccacaactcaaaggaaaaggactagtaattatcattgactagcccatctcaattggtatagtgattaaaatcacctagaccaattgagatgtatgtctgaattagttgttttcaaagcaaatgaactagcgattagtcgctatgacttaacggagcatgaaaccaagctaattttatgctgtgtggcactactcaaccccacgattgaaaaccctacaaggaaagaacggacggtatcgttcacttataaccaatacgttcagatgatgaacatcagtagggaaaatgcttatggtgtattagctaaagcaaccagagagctgatgacgagaactgtggaaatcaggaatcctttggttaaaggctttgagattttccagtggacaaactatgccaagttctcaagcgaaaaattagaattagtttttagtgaagagatattgccttatcttttccagttaaaaaaattcataaaatataatctggaacatgttaagtcttttgaaaacaaatactctatgaggatttatgagtggttattaaaagaactaacacaaaagaaaactcacaaggcaaatatagagattagccttgatgaatttaagttcatgttaatgcttgaaaataactaccatgagtttaaaaggcttaaccaatgggttttgaaaccaataagtaaagatttaaacacttacagcaatatgaaattggtggttgataagcgaggccgcccgactgatacgttgattttccaagttgaactagatagacaaatggatctcgtaaccgaacttgagaacaaccagataaaaatgaatggtgacaaaataccaacaaccattacatcagattcctacctacgtaacggactaagaaaaacactacacgatgctttaactgcaaaaattcagctcaccagttttgaggcaaaatttttgagtgacatgcaaagtaagcatgatctcaatggttcgttctcatggctcacgcaaaaacaacgaaccacactagagaacatactggctaaatacggaaggatctgaggttcttatggctcttgtatctatcagtgaagcatcaagactaacaaacaaaagtagaacaactgttcaccgttagatatcaaagggaaaactgtccatatgcacagatgaaaacggtgtaaaaaagatagatacatcagagcttttacgagtttttggtgcatttaaagctgttcaccatgaacagatcgacaatgtaacagatgaacagcatgtaacacctaatagaacaggtgaaaccagtaaaacaaagcaactagaacatgaaattgaacacctgagacaacttgttacagctcaacagtcacacatagacagcctgaaacaggcgatgctgcttatcgaatcaaagctgccgacaacacgggagccagtgacgcctcccgtggggaaaaaatcatggcaattctggaagaaatagcgctttcagccggcaaacctgaagccggatctgcgattctgataacaaactagcaacaccagaacagcccgtttgcgggcagcaaaacccgcggccgcctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagggaagcggtgatcgccgaagtatcgactcaactatcagaggtagttggcgtcatcgagcgccatctcgaaccgacgttgctggccgtacatttgtacggctccgcagtggatggcggcctgaagccacacagtgatattgatttgctggttacggtgaccgtaaggcttgatgaaacaacgcggcgagctttgatcaacgaccttttggaaacttcggcttcccctggagagagcgagattctccgcgctgtagaagtcaccattgttgtgcacgacgacatcattccgtggcgttatccagctaagcgcgaactgcaatttggagaatggcagcgcaatgacattcttgcaggtatcttcgagccagccacgatcgacattgatctggctatcttgctgacaaaagcaagagaacatagcgttgccttggtaggtccagcggcggaggaactctttgatccggttcctgaacaggatctatttgaggcgctaaatgaaaccttaacgctatggaactcgccgcccgactgggctggcgatgagcgaaatgtagtgcttacgttgtcccgcatttggtacagcgcagtaaccggcaaaatcgcgccgaaggatgtcgctgccgactgggcaatggagcgcctgccggcccagtatcagcccgtcatacttgaagctagacaggcttatcttggacaagaagaagatcgcttggcctcgcgcgcagatcagttggaagaatttgtccactacgtgaaaggcgagatcaccaaggtagtcggcaaataatgtctaacaattcgttcaagccgaggggccgcaagatccggccacgatgacccggtcgtcggttcagggcagggtcgttaaatagccgcttatgtctattgctggtttaccggtttattgactaccggaagcagtgtgaccgtgtgcttctcaaatgcctgaggtttcaggcatgc SEQ ID NO.2 LKL aaaaatgatttgtcgttagtgttatacctagccctaccgttcgtataatgtatgctatacgaagttatagagcgcttttgaagctcacgctgccgcaagcactcagggcgcaagggctgctaaaggaagcggaacacgtagaaagccagtccgcagaaacggtgctgaccccggatgaatgtcagctactgggctatctggacaagggaaaacgcaagcgcaaagagaaagcaggtagcttgcagtgggcttacatggcgatagctagactgggcggttttatggacagcaagcgaaccggaattgccagctggggcgccctctggtaaggttgggaagccctgcaaagtaaactggatggctttcttgccgccaaggatctgatggcgcaggggatcaagatctgatcaagagacaggatgaggatcgtttcgcatgattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaggacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgcgcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctaataaggggatcttataacttcgtataatgtatgctatacgaacggtaaaatgggaaatttactgagccaatccc SEQ ID NO.3 P119 atggcttgtcatgcttaattgacagctagctcagtcctaggtataatgctagcagggagaccacaacggtttccctctacaaataattttgtttaactttcgcgcgcgtaacaggaggaattaacc SEQ ID NO.4 RBS aggaggaattaacc SEQ ID NO.5 TrrnB tgcctggcggcagtagcgcggtggtcccacctgaccccatgccgaactcagaagtgaaacgccgtagcgccgatggtagtgtggggtctccccatgcgagagtagggaactgccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctt SEQ ID NO.6 linker gagggaaaaggcggcagtggctctggtagtgagggcggcgcgaaaggtggaggctct SEQ ID NO.7 poxBup tcccatcccttccccctccgtcagatgaactaaacttgttaccgttatcacattcaggagatggagaacc SEQ ID NO.8 poxBdown aaagggtggcatttcccgtcataataaggacatgccatgattgatttacgcagtgataccgttacccgac SEQ ID NO.9 pflBup aaacgaccaccattaatggttgtcgaagtacgcagtaaataaaaaatccacttaagaaggtaggtgttac SEQ ID NO.10 pflBdown ttagatttgactgaaatcgtacagtaaaaagcgtacaataaaggctccacgaaagtggggccttttttag SEQ ID NO.11 galRup accccttgaaccaacgggcgttttccgtaacactgaaagaatgtaagcgtttacccactaaggtattttc SEQ ID NO.12 galRdown ccgcagttaaagcaattccagcgccagtaattcttcgatggtctggcgacggcgaatcaaccgcgcctga SEQ ID NO.13 fadRup gctatcagcgtagttagccctctggtatgatgagtccaactttgttttgctgtgttatggaaatctcact SEQ ID NO.14 fadRdown tcccttccgtttaaagagcaaacccctcaaacgaggggttttttgttgtttttacagatttcccattctt SEQ ID NO.15 ppcup cgtaaattcctgctatttattcgtttgctgaagcgatttcgcagcatttgacgtcaccgcttttacgtgg SEQ ID NO.16 ppcdown atgaacgaacaatattccgcattgcgtagtaatgtcagtatgctcggcaaagtgctgggagaaaccatca SEQ ID NO.17 glpFup ccttctcctggtgacataatccacatcaatcgaaaatgttaataaatttgttgcgcgaatgatctaacaa SEQ ID NO.18 glpFdown atgagtcaaacatcaaccttgaaaggccagtgcattgctgaattcctcggtaccgggttgttgattttct SEQ ID NO.19 glpDup tacgtcgaagcggcagataaacgccataatgttatacatatcactctaaaatgttttttcaatgttacct SEQ ID NO.20 glpDdown atggaaaccaaagatctgattgtgatagggggcggcatcaatggtgctggtatcgcggcagacgccgctg SEQ ID NO.21 serAup cttcattaaatttggtgacatgtgtcacgcttttaccaggcaattgtcgattgctctaaataaatcctct SEQ ID NO.22 serAdown atggcaaaggtatcgctggagaaagacaagattaagtttctgctggtagaaggcgtgcaccaaaaggcgc SEQ ID NO.23 serCup gtgatgcaagccacatttttgccctcaacggttttactcattgcgatgtgtgtcactgaatgataaaacc SEQ ID NO.24 serCdown atggctcaaatcttcaattttagttctggtccggcaatgctaccggcagaggtgcttaaacaggctcaac SEQ ID NO.25 glyAup gatgaagtgaaaaatttgcatcacaaacctgaaaagaaatccgtttccggttgcaagctctttattctcc SEQ ID NO.26 glyAdown atgttaaagcgtgaaatgaacattgccgattatgatgccgaactgtggcaggctatggagcaggaaaaag SEQ ID NO.27 pooCup ttttgttctgtaagccgggtaagcgcaatgcgcccggcaatctatacaaaatcattcaagttgcatc SEQ ID NO.28 puuCdown atgaatttcatcatctggcttactggcaggataaagcgttaagtctcgccattgaaaccgcttattta SEQ ID NO.29 accAup attaaacgatctccgtggcctcattggttcggagcaggtggaactggagtttgactaatacaggaat SEQ ID NO.30 accAdown atgagtctgaatttccttgatttgaacagccgattgcagagctggaagcgaaaatcgattctctgactg SEQ ID NO.31 scpAup acttctttttgtattccttgaatcacatcacaaatagacaaatctcaggcggcaaaaacgacgtctga SEQ ID NO.32 scpAdown atgtctaacgtgcaggagtggcaacagcttgccaacaaggaattgagccgtcgggagaaactgtcgact SEQ ID NO.33 yfeXup cgaaaaaacgtaaatagcgctcaacaatgccacggattgcgtggcattattattttcaggaggaaca SEQ ID NO.34 yfeXdown gcgtttctgattcattgattaaggccaggcagtaacattactgactggcctcagattgttgaccaagtg SEQ ID NO.35 hemBup aaagatgtcctggcctctcttccattctcttcttgtcaacatcgcgacaactttcgtaaaacatccctac SEQ ID NO.36 hemBdown atgacagacttaatccaacgccctcgtcgcctgcgcaaatctcctgcgctgcgcgctatgtttgaagaga SEQ ID NO.37 hemCup tacgtttcaccacaacactgacatcactctggcaaggatgttaggatggaccacggatgataatgacggt SEQ ID NO.38 hemCdown atgttagacaatgttttaagaattgccacacgccaaagcccacttgcactctggcaggcacactatgtca SEQ ID NO.39 hemEup tagcgcgccgtctgatagaagatacggtggcgatgtgtcgggcagagtatgagtgatgatacactgaccg SEQ ID NO.40 hemEdown atgaccgaacttaaaaacgatcgttatctgcgggcgctgctgcgccagcccgttgatgtcactccagtat SEQ ID NO.41 hemFup tgctgaaggcgtgatcagttatttccactggttcgacaaccagaaagcacattcgaaaaagcgataa SEQ ID NO.42 hemFdown atgaaacccgacgcacaccaggttaaacagtttctgctcaaccttcaggatacgatttgtcagcagctga SEQ ID NO.43 hemGup gtcgtctcgaggtctttacattgctggtgctctttaccccgactttctggcgtgaatgatggagtaa SEQ ID NO.44 hemGdown atgaaaacattaattcttttctcaacaagggacggacaaacgcgcgagattgcctcctacctggcttcgg SEQ ID NO.45 ccmAup ctgtattgattgccataaagggatagcgcacaagctgcccgatatgcgtgaagtcgagccaggtttttaa SEQ ID NO.46 ccmAdown atgggtatgcttgaagccagagagttactttgtgagcgggatgaacgaaccttatttagtggcttgtcat dhaB Genebank: GQ355491.1(69-2761(+))(2009.8.8). gdrAB Genebank: CP067831.1(657637-659460(+),652904-652531(-))(2022.3.2) pcs Genebank: AF445079.2(2010.7.8). pccB Genebank: AL645882.2(5359018-5360610(-))(2024.10.4). mmcE Genebank: CP018002.1(1078786..1079232(-))(2017.5.2) CA Genebank: CP******.1(******-******(-))(2013.12.11) BT Genebank: NC_010475.1(2454712-2456130(+))(2024.11.7) hemA Genebank ID: 3720398(2024.12.19) hemH Gene ID: 57267780(2023.9.29) ho1 Gene ID: 60201361(2023.4.10) bvr Gene ID: 66745074(2024.6.6)

[0110] Table 2 Primer sequences

[0111] Primer or sequence name Nucleotide sequence (5' to 3') kan-R tcgtcaagaaggcgatagaa poxB-1 tcccatcccttccccctccgtcagatgaac poxB-2 gtcgggtaacggtatcactgcgtaaatcaa poxB-3 ggctatttaaccgttagtgcctcctttctc pflB-1 aaacgaccaccattaatggttgtcgaag pflB-2 ctaaaaaaggccccactttcgtggagc pflB-3 ccggaaaatttttctcacctgacc galR-1 accccttgaaccaacggg galR-2 tcaggcgcggttgattcg galR-3 tggctcacattcccacgatg fadR-1 gctatcagcgtagttagccctctggtatga fadR-2 aagaatgggaaatctgtaaaaacaacaaaa fadR-3 agccttgatccctttttcttctttttgtct Note: In the translation of line , the specific content of the Genebank ID has been replaced with ****** as the original number seems to be incorrect or incomplete in the provided text. If there are any further clarifications or corrections regarding this, the translation can be adjusted accordingly. yfeX-1 cgaaaaaacgtaaatagcgctcaacaa yfeX-2 cacttggtcaacaatctgaggccagtcagt yfeX-3 gttaatttgcgtctgaacaaaccgccgccg ppc-1 cgtaaattcctgctatttattcgtttgctg ppc-2 tgatggttctcccagcactttgccgagca ppc-3 cgcttatttaaagcgtcgtgaatttaatga glpF-1 ccttctcctggtgacataatccacatcaat glpF-2 agaaaatcaaacccggtaccgaggaatt glpF-3 ttgcagattacggtttgccacactttcat glpD-1 tacgtcgaagcggcagataaacgccataat glpD-2 cagcggcgtctgccgcgataccagcaccat glpD-3 caaacaagtgggcaaatttaccgcacagtt serA-1 cttcattaaatttggtgacatgtgtcacgc serA-2 gcgccttttgtgcacgccttctaccagca serA-3 cgggggaacctccccgttaaaaaaattct serC-1 gtgatgcaagccacatttttgccctcaacg serC-2 gttgagcctgttaagcaccctgcggta serC-3 ttttgctaataatccgagagattctttgt glyA-1 gatgaagtgaaaaatttgcatcacaaacct glyA-2 cttttcctgctccatagcctgccacagtt glyA-3 tggttctttggtgttttcagaaagaatgt poolC-1 ttttgttctgtaagccgggtaagcgcaat partC-2 taaataagcggttttcaatggcgagactta sectionC-3 cagcgcccatacgcccaccacgttttaatc accA-1 attaaacgatctccgtggcctcattggttc accA-2 cagtcagagaatcgatttcgcttccagct accA-3 gacgtggcgtgtctctccgagcgatcgttt scpA-1 actttttttgtattccttgaatcacatca scpA-2 agtcgacagttttctccgacggctcaatt scpA-3 gcctgatagcacatatcaggcgttgtcctc hemB-1 aaagatgtcctggcctctct hemB-2 tctcttcaaacatagcgcgc hemB-3 ccaaaaaataataaccaacagc hemC-1 tacgtttcaccacaacactgac hemC-2 tgacatagtgtgcctgccag hemC-3 acctcattttacggtttgcg hemE-1 tagcgcgccgtctgatagaa hemE-2 atactggagtgacatcaacggg hemE-3 gctatgacgatttgccgttac hemF-1 tgctgaaggcgtgatcagtt hemF-2 tcagctgctgacaaatcgtatc hemF-3 ggcgtttcgtcagaaaatcg hemG-1 gtcgtctcgaggtctttacattg hemG-2 ccgaagccaggtaggagg hemG-3 aatggatcctgattgccaacat ccmA-1 ctgtattgattgccataaagggatagcgca ccmA-2 atgacaagccactaataaaaggttcgttcat ccmA-3 gcatgaccaggcggtgaaagatgggcaaac pSY-F ggttaattcctcctgttagcccaaaaaacg pSY-R tgcctggcggcagtagcgcggtggtcccac hemA-1 gctaacaggaggaattaaccatggactacaatctggcactcgatacc hemA-2 cgcgctactgccgccaggcatcaggcaacgacctcggcgcgattcag hemH-1 gctaacaggaggaattaaccatgacgaataaacagggtgttttaatt hemH-2 cgcgctactgccgccaggcactatttcgcgccctctgccagctgtc HHB-2 cgcgctactgccgccaggcattacgcgccccggtccaaaagatccga ara-F ctactgtttctccatacccgttttttgggc rrn-R gttccctactctcgcatggggagaccccac

[0112] Example 1. Construction of Escherichia coli strain HGB01-19

[0113] The preparation method of the relevant strains is obtained according to the following steps (1)-(2):

[0114] (1) Starting from Escherichia coli MC02, the gene poxB encoding pyruvate oxidase was knocked out in the strain to obtain the HGB01 strain.

[0115] The specific steps are as follows:

[0116] (1-a) Preparation of targeting fragment HGB-1

[0117] The following DNA fragments were synthesized (GenScript): from 5' to 3', they consisted of: poxBup, LBL (from 5' to 3', they consisted of lox66, the Kan resistance gene, and lox71), and poxBdown. PCR amplification was performed using poxB-1 / poxB-2 primers and the synthesized DNA fragments as templates to generate the targeting fragment HGB-1.

[0118] (1-b) Preparation of host bacteria containing the pKD46 plasmid

[0119] The pKD46 plasmid was transformed into the starting E. coli MC02 using the calcium chloride method. After overnight culture at 30°C on LB plates containing ampicillin, clones were selected to obtain recombinant E. coli MC02 / pKD46 containing the plasmid pKD46. After induction with arabinose, MC02 / pKD46 expressed the three recombinant proteins of phage λ, conferring homologous recombination capability to the host bacteria. MC02 / pKD46 competent cells were then prepared by washing with 10% glycerol.

[0120] (1-c) Homologous recombination

[0121] The targeting fragment HGB-1 prepared in (1-a) was electroporated into the MC02 / pKD46 competent cells prepared in (1-b) and incubated overnight at 37°C on LB plates containing kanamycin (50µg / ml). A clone was selected and genomic DNA extracted. PCR amplification using primers poxB-3 / Kan-R was performed to identify the clone. A positive clone was identified by amplifying a target band of approximately 1000bp. Sequencing analysis confirmed that the target sequence on the MC011-kan genome was correct, and the coding region of the lpxM gene was deleted. HGB01-kan was cultured overnight at 42°C to eliminate the temperature-sensitive plasmid pKD46.

[0122] (1-d) Elimination of resistance

[0123] The pSCre plasmid was transformed into the HGB01-kan strain, which had been depleted of pKD46, using the calcium chloride method. The strain was cultured overnight at 30°C on LB plates containing 50 mg / L streptomycin and 0.2% L-arabinose. The kanamycin resistance fragment was eliminated using the Cre recombinase on the pSCre plasmid. The temperature-sensitive pSCre plasmid was eliminated by culturing overnight at 42°C. The resulting strain was named HGB01.

[0124] (2) Obtaining strains HGB02, HGB03, HGB04, HGB05, HGB06, HGB07, HGB08, HGB09, HGB10, HGB11, HGB12, HGB13, HGB14, HGB15, HGB16, HGB17, HGB18, HGB19, HGB20, and HGB21

[0125] Using the same method as in Example 1 (1), starting from the HGB01 strain, the HGB02, HGB03, HGB04, HGB05, HGB06, HGB07, HGB08, HGB09, HGB10, HGB11, HGB12, HGB13, HGB14, HGB15, HGB16, HGB17, HGB18, HGB19, HGB20, and HGB21 strains were obtained in sequence.

[0126] The difference between each strain construction process and Example 1 (1) is that different starting strains, different targeting fragments, and different primers are used. The specific starting strains, targeting fragments (the specific sequences of the sequence fragments are shown in Table 1), primers, modified targets, and obtained strain information used in each step are shown in Table 3.

[0127] Table 3. Construction process of HGB01-HGB20

[0128] Step number Starting strain Target practice clip name The targeting fragment contains the sequence fragment (5'-3') Modified targets Amplification primers Identification primers Obtain strains 1 MC02 HGB-1 poxBup、LKL、poxBdown Knockout of the pyruvate oxidase (poxB) gene poxB-1 / poxB-2 poxB-3 / KanR HGB01 2 HGB01 HGB-2 pflBup, LKL, P119, dhaB, TrrnB, P119, gdrAB, TrrnB, pflBdown The pyruvate formate lyase (pflB) gene was knocked out and replaced with the expression cassettes of the Klebsiella pneumoniae glycerol dehydratase (dhaB) gene cluster and the Klebsiella pneumoniae glycerol dehydratase activator (gdrAB) gene cluster. pflB-1 / pflB-2 pflB-3 / KanR HGB02 3 HGB02 HGB-3 galRup, LKL, P119, pcs, TrrnB, P119, pccB, TrrnB, P119, mmcE, TrrnB, galRdown The galactose repressor (galR) gene was knocked out and replaced with the expression cassettes of the Chloroflexus propionyl-CoA synthetase (pcs) gene, the Streptomyces coelicolor propionyl-CoA carboxylase β subunit (pccB) gene, and the Propionibacterium freudenreichii methylmalonyl-CoA epimerase (gdrAB) gene. galR-1 / galR-2 galR-3 / KanR HGB03 HGB03 HGB-4 fadRup, LKL, P119, CA, rbs, BT, TrrnB, fadRdown The fatty acid degradation transcription factor (fadR) gene was knocked out and replaced with the expression cassettes of the Synechococcus microcarbamate carbonic anhydrase (CA) gene and the cyanobacterium carbon assimilation factor (BT) gene. fadR-1 / fadR-2 fadR-3 / KanR HGB04 HGB04 HGB-5 ppcup、LKL、P119、ppcdown Replace the promoter of the phosphoenolpyruvate carboxylase (ppc) gene with the P119 promoter ppc-1 / ppc-2 ppc-3 / KanR HGB05 HGB05 HGB-6 glpFup, LKL, P119, glpFdown Replace the promoter of the glycerol transporter (glpF) gene with the P119 promoter glpF-1 / glpF-2 glpF-3 / KanR HGB06 HGB06 HGB-7 glpDup, LKL, P119, glpDdown Replace the promoter of the glycerol-3-phosphate dehydrogenase (glpD) gene with the P119 promoter glpD-1 / glpD-2 glpD-3 / KanR HGB07 HGB07 HGB-8 serAup, LKL, P119, serAdown Replace the promoter of the phosphoglycerate dehydrogenase (serA) gene with the P119 promoter serA-1 / serA-2 serA-3 / KanR HGB08 HGB08 HGB-9 serCup, LKL, P119, serCdown Replace the promoter of the phospho-L-serine aminotransferase (serC) gene with the P119 promoter serC-1 / serC-2 serC-3 / KanR HGB09 HGB09 HGB-10 glyAup,LKL,P119,glyAdown Replace the promoter of the L-serine hydroxymethyltransferase (glyA) gene with the P119 promoter glyA-1 / glyA-2 glyA-3 / KanR HGB10 HGB10 HGB-11 puuCup, LKL, P119, puuCdown Replace the promoter of the 3-hydroxypropionaldehyde dehydrogenase (puuC) gene with the P119 promoter puuC-1 / puuC-2 puuC-3 / KanR HGB11 HGB11 HGB-12 accAup, LKL, P119, accAdown Replace the promoter of the acetyl-CoA carboxylase α subunit (accA) gene with the P119 promoter accA-1 / accA-2 accA-3 / KanR HGB12 HGB12 HGB-13 scpAup, LKL, P119, scpAdown Replacement of the promoter of the methylmalonyl-CoA mutase (scpA) gene with the P119 promoter scpA-1 / scpA-2 scpA-3 / KanR HGB13 HGB13 HGB-14 yfeXup, LKL, yfeXdown Knockout of porphyrinogen peroxidase (yfeX) yfeX-1 / yfeX-2 yfeX-3 / KanR HGB14 HGB14 HGB-15 hemBup, LKL, P119, hemBdown Replacement of the promoter of the porphobilinogen synthase (hemB) gene with the P119 promoter hemB-1 / hemB-2 hemB-3 / KanR HGB15 HGB15 HGB-16 hemCup, LKL, P119, hemCdown Replace the promoter of the hydroxymethylcholine synthase (hemC) gene with the P119 promoter hemC-1 / hemC-2 hemC-3 / KanR HGB16 HGB16 HGB-17 hemEup,LKL,P119,hemEdown Replacement of the promoter of the uroporphyrinogen decarboxylase (hemE) gene with the P119 promoter hemE-1 / hemE-2 hemE-3 / KanR HGB17 HGB17 HGB-18 hemFup,LKL,P119,hemFdown Replace the promoter of the coproporphyrinogen oxidase (hemF) gene with the P119 promoter hemF-1 / hemF-2 hemF-3 / KanR HGB18 HGB18 HGB-19 hemGup, LKL, P119, hemGdown Replace the promoter of the protoporphyrinogen oxidase (hemG) gene with the P119 promoter hemG-1 / hemG-2 hemG-3 / KanR HGB19 HGB19 HGB-20 ccmAup, LKL, P119, ccmAdown Replace the promoter of the cytochrome c maturation protein A gene (ccmA) with the P119 promoter ccmA-1 / ccmA-2 ccmA-3 / KanR HGB20 MC02 HGB-20 ccmAup, LKL, P119, ccmAdown Replace the promoter of the cytochrome c maturation protein A gene (ccmA) with the P119 promoter ccmA-1 / ccmA-2 ccmA-3 / KanR HGB21

[0129] Example 2 Construction of plasmids pS-H, pY-H, and pY-HHB

[0130] (1) Preparation of backbone fragments

[0131] Preparation of backbone fragment pS: It was obtained by PCR amplification using plasmid pSB1s as template and universal primers pSY-F / pSY-R.

[0132] Preparation of backbone fragment pY: It was obtained by PCR amplification using plasmid pYB1k as template and universal primers pSY-F / pSY-R.

[0133] (2) Preparation of target gene fragments

[0134] Preparation of the target gene fragment hemA: A DNA fragment containing hemA was synthesized by Qingke Biotechnology with the sequence hemA (Table 1). This DNA fragment was used as a template for PCR amplification using primers hemA-1 / hemA-2.

[0135] Preparation of the target gene fragment hemH: A DNA fragment containing hemH was synthesized by Qingke Biotechnology with the sequence hemH (Table 1). This DNA fragment was used as a template for PCR amplification using primers hemH-1 / hemH-2.

[0136] Preparation of the target gene fragment HHB: A DNA fragment containing HHB was synthesized by Qingke Biotechnology. The 5'-3' sequence contains hemH (without TAA), linker, ho1, RBS, and bvr. This DNA fragment was used as a template for PCR amplification using primers hemH-1 / HHB-2.

[0137] The above PCRs were all amplified using high-fidelity TransStart FastPfu DNA polymerase (Beijing Quanshijin Biotechnology Co., Ltd., product catalog number AP221), and the target fragments were recovered by agarose gel electrophoresis.

[0138] (3) Obtaining recombinant plasmid using Gibson assembly method

[0139] The backbone fragments were ligated with the target gene fragment using the Gibson assembly method (Gibson DG, Young L, et al. Enzymatic assembly of DNA molecules up to selpxMeral hundred kilobases. Nat. methods. 2009; 6(5):343-345) to generate a recombinant expression vector. Competent Escherichia coli DH5α cells (purchased from Beijing Quanshijin Biotechnology Co., Ltd., product catalog number CD201) were transformed using the CaCl2 method. The cells were evenly plated on LB plates containing streptomycin or kanamycin and cultured overnight at 37°C. Clones were selected and identified using the universal primers ara-F / rrn-R. Clones capable of amplifying the target fragment were sequenced and selected for plasmid extraction. Positive clones were then selected for plasmid extraction to obtain a positive plasmid.

[0140] Plasmids pS-H, pY-H, and pY-HHB were constructed using the same method, differing only in the backbone fragments and target gene fragments. Detailed information is shown in Table 4.

[0141] Table 4. Plasmid construction information

[0142] Serial number plasmids Skeleton fragments Target gene fragment Antibiotics used for screening 1 pS-H pS hemA Streptomycin 2 pY-H pY hemH Kanamycin 3 pY-HHB pY HHB Kanamycin

[0143] Example 3: Production of heme and bilirubin using recombinant Escherichia coli

[0144] The test bacteria were recombinant E. coli HGB30 and HGB31, and the control bacteria were HGB32 and HGB33. The relevant strain information is shown in Table 5.

[0145] (1) Recombinant Escherichia coli HGB30, HGB31, HGB32, and HGB33.

[0146] The plasmid obtained in Example 2 was transformed into the recombinant bacteria obtained in Example 1 using the calcium chloride transformation method. After overnight culture at 37°C on LB plates containing streptomycin and kanamycin, clones were selected and frozen at -80°C. Information on the relevant strains used in the construction process is shown in Table 5.

[0147] Table 5 Strain information

[0148] strain Recipient bacteria plasmids HGB30 HGB20 pS-H, pY-H HGB31 HGB19 pS-H, pY-HHB HGB32 HGB21 pS-H, pY-H HGB33 MC02 pS-H, pY-HHB

[0149] (2) Using glycerol as raw material, heme is synthesized by recombinant Escherichia coli HGB30

[0150] The composition and final concentrations of the glycerol medium used are as follows: Na₂HPO₄: 25 mM, KH₂PO₄: 25 mM, NH₄Cl: 50 mM, Na₂SO₄: 5 mM, MgSO₄: 2 mM, glycerol: 2% (g / 100 mL), yeast extract: 0.5% (g / 100 mL). During the transformation process, glycerol can be supplemented to a final concentration of 1% (g / 100 mL).

[0151] The recombinant bacteria HGB30 and the control strain HGB32 cultured overnight were inoculated at a 1% inoculum into a shake flask containing 200 ml of LB medium containing streptomycin and kanamycin. The culture was carried out at 37°C for 3-4 h until the OD600nm reached 0.6-0.8. Then, arabinose at a final concentration of 0.2 g / L was added and the culture was continued at 37°C for 12 h. The bacteria were collected by centrifugation at 8000 rpm for 10 min.

[0152] The collected cells were resuspended in shake flasks containing 10 mL of glycerol medium and transformed at 120 rpm and 37°C for 24 h. The supernatant was centrifuged and filtered. The heme content was determined by HPLC. The yield was calculated as g / L of heme per liter of the shake flask. The HPLC analysis was performed using a Waters C18 column (250 mm × 4.6 mm, 5 μm) with a mobile phase of methanol / phosphoric acid (40 / 60) at a flow rate of 0.5 mL / min and a column temperature of 35°C. A heme standard was purchased from Aladdin (Cat. No. H104216). The retention time of the heme standard was 16.9 min.

[0153] The results showed that the heme production of the control strain HGB32 was 0, while the average heme production of the recombinant strain HGB30 was 1.08±0.13 g / L. The constructed strain can effectively utilize glycerol to synthesize heme.

[0154] (3) Using glycerol as raw material, recombinant Escherichia coli HGB31 was used to synthesize bilirubin

[0155] The composition and final concentrations of the glycerol medium used are as follows: Na₂HPO₄: 25 mM, KH₂PO₄: 25 mM, NH₄Cl: 50 mM, Na₂SO₄: 5 mM, MgSO₄: 2 mM, glycerol: 2% (g / 100 mL), yeast extract: 0.5% (g / 100 mL). During the transformation process, glycerol can be supplemented to a final concentration of 1% (g / 100 mL).

[0156] The recombinant bacteria HGB31 and the control strain HGB33 cultured overnight were inoculated at a 1% inoculum into a shake flask containing 200 ml of LB medium containing streptomycin and kanamycin. The culture was carried out at 37°C for 3-4 h until the OD600nm reached 0.6-0.8. Then, arabinose at a final concentration of 0.2 g / L was added and the culture was continued at 37°C for 12 h. The bacteria were collected by centrifugation at 8000 rpm for 10 min.

[0157] The collected cells were resuspended in a shake flask containing 10 mL of glycerol culture medium, transformed at 120 rpm and 37 ° C for 24 h, and the cells were centrifuged and recorded as 24 h samples. The cells before transformation were taken and recorded as 0 h samples. The cells were resuspended in 0.1 M potassium phosphate buffer (pH 7.0) and ultrasonically disrupted before centrifugation to obtain the precipitate. The precipitate was extracted with dichloromethane and centrifuged to obtain the organic phase, and the bilirubin content was detected by HPLC. The HPLC results of the samples are as follows: Figure 1 The difference in bilirubin content between the 24-hour sample and the 0-hour sample was calculated and converted to bilirubin production per liter (g / L) in the shake flask. HPLC was performed using a Waters C18 column (250 mm × 4.6 mm, 5 μm); the mobile phase consisted of DMSO / acetonitrile / 0.5 M ammonium phosphate buffer (5:7:7) at a flow rate of 0.5 mL / min; the column temperature was 30°C. Bilirubin standards were purchased from Aladdin (Cat. No. B104211). The retention time of the bilirubin standard was 20 minutes.

[0158] The results showed that the bilirubin accumulation of the control strain HGB33 was 0 during the 0-24h period, while that of the recombinant strain HGB31 was 1.12±0.21 g / L. The constructed strain was able to effectively utilize glycerol to synthesize bilirubin.

[0159] The production characteristics of related strains are shown in Table 6.

[0160] Table 6 Comparison of yield of each strain

[0161] strain Hemoglobin (g / L) Bilirubin accumulation in 0-24 hours (g / L) HGB30 1.08±0.13 - HGB32 0 - HGB31 - 1.12±0.21 HGB33 - 0

Claims

1. A recombinant Escherichia coli comprising the following modifications: (1) Knockout of the gene encoding pyruvate oxidase (poxB); (2) knockout of the gene encoding pyruvate formate lyase (pflB); (3) Knockout of the gene encoding the galactose repressor (galR); (4) Knockout of the gene encoding the fatty acid degradation transcription factor (fadR); (5) Knockout of the gene encoding porphyrinogen peroxidase (yfeX); (6) Enhance the expression of phosphoenolpyruvate carboxylase gene (ppc); (7) Enhance the expression of the glycerol transporter gene (glpF); (8) Enhance the expression of glycerol-3-phosphate dehydrogenase gene (glpD); (9) Enhance the expression of phosphoglycerate dehydrogenase gene (serA); (10) Enhance the expression of the phospho-L-serine aminotransferase gene (serC); (11) Enhance the expression of L-serine hydroxymethyltransferase gene (glyA); (11) Enhance the expression of 3-hydroxypropionaldehyde dehydrogenase gene (puuC); (13) Enhance the expression of acetyl-CoA carboxylase α subunit gene (accA); (14) Enhance the expression of methylmalonyl-CoA mutase gene (scpA); (15) Enhance the expression of porphobilinogen synthase gene (hemB); (16) Enhance the expression of hydroxymethylcholine synthase gene (hemC); (17) Enhance the expression of uroporphyrinogen decarboxylase gene (hemE) (18) Enhance the expression of coproporphyrinogen oxidase gene (hemF); (19) Enhance the expression of protoporphyrinogen oxidase gene (hemG); (20) Introducing the glycerol dehydratase gene cluster (dhaB), including genes encoding glycerol dehydratase α subunit, glycerol dehydratase β subunit, and glycerol dehydratase γ subunit; (21) Introducing the glycerol dehydratase activating factor gene cluster (gdrAB), including genes encoding the glycerol dehydratase activating factor α subunit and the glycerol dehydratase activating factor β subunit; (22) Introduction of the propionyl-CoA synthetase gene (pcs); (23) Introduction of the propionyl-CoA carboxylase β subunit gene (pccB); (24) Introduction of carbonic anhydrase gene (CA); (25) Introduction of carbon assimilation factor gene (BT); (26) Introduction of the methylmalonyl-CoA epimerase gene (mmcE); (27) Introduction of 5-aminolevulinic acid synthase gene (hemA); (28) Introducing the ferrochelatase gene (hemH).

2. A recombinant Escherichia coli, comprising the steps of performing the transformations (1) to (28) of claim 1 and the following transformations in Escherichia coli: (29) Strengthen the cytochrome c maturation protein A gene (ccmA).

3. A recombinant Escherichia coli, comprising the following modifications (1) to (28) of claim 1 and carried out in Escherichia coli: (30) Introduction of the heme oxygenase gene (ho1); (31) Introduce the biliverdin reductase gene (bvr).

4. A method for constructing a recombinant Escherichia coli with improved hemoglobin production, comprising the following steps: performing the transformation according to the transformation (1) to (29) in any one of claims 1 and 2.

5. A method for constructing a recombinant Escherichia coli with improved bilirubin production, comprising the following steps: performing the transformation according to the transformation (1)-(28), (30), and (31) in any one of claims 1 and 3.

6. A method for producing or increasing hemoglobin production, comprising the following steps: culturing the recombinant Escherichia coli according to any one of claims 1 and 2 using glycerol as a carbon source, collecting the bacteria, and obtaining hemoglobin.

7. A method for producing or increasing bilirubin production, comprising the following steps: culturing the recombinant Escherichia coli according to any one of claims 1 and 3 using glycerol as a carbon source, collecting the bacteria, and obtaining bilirubin.

8. Use of the recombinant Escherichia coli according to any one of claims 1 and 2 in producing or increasing hemoglobin production.

9. Use of the recombinant Escherichia coli according to any one of claims 1 and 3 in producing or increasing bilirubin production.

10. A product for producing or increasing hemoglobin production, wherein the active ingredient is the recombinant Escherichia coli according to any one of claims 1 and 2.

11. A product for producing or increasing bilirubin production, wherein the active ingredient is the recombinant Escherichia coli according to any one of claims 1 and 3.

Images