CAR-NK cell of targeted death receptor 5 as well as preparation method and application of CAR-NK cell

Abstract

The invention discloses a CAR-NK cell of a targeted death receptor 5 as well as a preparation method and application of the CAR-NK cell. The preparation method comprises the following steps: constructing a virus for expressing CAR of targeted DR5; sorting NK cells by adopting a negative selection method; the method comprises the following steps: adopting an NK cell amplification reagent purchased from Yicosai, adding 1-10% of Super Grow purchased from Daraceae into an NK culture medium, and culturing NK cells; and after culturing for 5-9 days, adding a virus for expressing the CAR of the targeted DR5 and a virus transduction enhancer, culturing at 37 DEG C in 5% CO2, and after the cell density is increased to 1-3 * 10 < 6 > cells / mL, carrying out passage to obtain the target DR5. According to the amplification process, the culture medium which is definite in component, free of serum and free of animal source components is adopted, feeder cells and pure cell factors are not used for stimulating and culturing the NK cells from human peripheral blood, large-scale and long-term amplification of the high-purity CAR-NK cells can be achieved, and the amplification process can be used for allogeneic retransfusion.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and specifically relates to a CAR-NK cell targeting death receptor 5 and a preparation method and application thereof. Background Art

[0002] Chimeric antigen receptors (CARs) are receptor proteins that are genetically engineered and expressed on the cell surface. They are composed of an antigen recognition region (single chain variable fragment, scFv), a hinge region, a transmembrane region, and an intracellular signal transduction region. Chimeric antigen receptors are expressed on the surface of immune cells through viral infection or electroporation, thereby constructing CAR-immune cells. CAR-T cell therapy involves expressing CAR molecules on the surface of T cells. CAR-T cells can specifically recognize and bind to tumor antigens, possess the self-renewal and killing capabilities of T cells, and specifically kill tumor cells in an MHC-independent manner. Emily, the first American childhood leukemia patient in the world to receive CD19 CAR-T cell therapy, remains healthy and has not relapsed 10 years later. Currently, there are 11 CAR-T cell therapies approved for marketing worldwide, including 5 in China (Yikeda, Benoda, Fukosu, Yuanruida and Saikaize). The therapeutic targets are CD19 or BCMA, and the diseases treated are concentrated in the fields of B-cell leukemia, lymphoma and multiple myeloma. However, facing more than 90% of solid tumors, there is no successful CAR-T cell product on the market. Moreover, all the currently available CAR-T products are autologous and cannot be allogeneically transfused. They are not shelf products, and patients need to wait for a long time for CAR-T cell preparation and testing before they can obtain cells for transfusion. Some patients may not be able to collect enough T cells, or it may be difficult for the patient's T cells to expand in vitro after multiple rounds of chemotherapy and radiotherapy, or there is not enough time to wait for the T cell preparation process. Therefore, there is an urgent need to develop new targets for allogeneic transfusion CAR-immune cell therapy.

[0003] As a crucial member of the innate immune system, NK cells play a crucial role in the body's fight against tumors, viral infections, and immune regulation. Compared to T cells, NK cells have a broader antigen spectrum, higher affinity, a more rapid immune response, a more manageable safety profile, and fewer transplant restrictions. Without the need for autologous cells, there are significant opportunities for the development of "off-the-shelf" products. CAR-NK cells modified with CAR have many advantages: 1. CAR-NK cells have the activity of rapidly killing tumors, and the killing effect can be seen within 1 hour in vitro and 4 hours in vivo; 2. When CAR-NK cells kill tumors, they will not produce cytokine storm and neurotoxicity, with extremely low side effects, and have a short residence time in the body without long-term toxicity; 3. CAR-NK cells do not require strict HLA matching and can be allogeneically infused without producing graft-versus-host disease (GvHD); 4. CAR-NK cells retain the intrinsic ability to recognize and target tumor cells through their natural receptors and have multiple modes of killing tumors, thereby reducing the possibility of tumor cells escaping killing during CAR-NK targeted therapy; 5. NK cells are widely available and can be supplied allogeneically, can be produced on a large scale, and are more convenient to use, lower in cost, and more controllable in quality; 6. "Off-the-shelf" products based on automated intelligent manufacturing can be standardized and mass-produced, expanding treatment opportunities and reducing treatment costs.

[0004] Currently, NK cells are used clinically from five main sources: human peripheral blood (PB), umbilical cord blood (UCB), human embryonic stem cells (hESCs), induced pluripotent stem cells (iPSCs), and the NK-92 cell line. Cells derived from hESCs or iPSCs have the potential for malignant transformation, posing clinical safety risks. NK92 cells are tumor-derived and aneuploid, requiring irradiation prior to infusion, which negatively impacts their long-term in vivo persistence and overall therapeutic potential. UCB-derived NK cells have excellent in vitro proliferation capacity, but their limited source and low expression of KIR, NKG2C, DNAM1, adhesion molecules, and IL-2Ra contribute to their weaker tumor-killing ability than PB-derived NK cells. PB-derived NK cells offer advantages such as relatively easy collection, ease of in vitro expansion, and lack of toxic side effects. However, the proportion of NK cells in PBMCs is only 5%-15%. It is still a technical challenge to expand PBMC-derived NK cells on a large scale in vitro, obtain high-purity NK cells, and realize clinical allogeneic transfusion. Although large-scale NK cell expansion can be achieved by using feeder cell culture, the mixing of feeder cells affects the purity of NK cells and thus affects the safety of clinical use. It is difficult to stably achieve high-purity (more than 98%) cells by culturing NK cells derived from human peripheral blood using cytokine stimulation. The NK purity is often only 50% to 90%, and contains a large number of impurity cells (such as CD3 + The future development direction is to use culture medium with clear ingredients and no animal-derived components, add only cytokines, and culture and expand on a large scale to obtain high-purity NK cells for clinical use, which is safer.

[0005] Death receptor 5 (DR5) is highly expressed in human cancers, including colon, gastric, pancreatic, ovarian, breast, and non-small cell lung cancers, but is absent or expressed at low levels in normal cells. Therefore, DR5 is considered a therapeutic target for a variety of tumors. The applicant has previously developed a murine monoclonal antibody against DR5, 3E7 (ZL201711166864.0), obtained a humanized monoclonal antibody against DR5, and developed CAR-T cells using the antibody's scFv sequence. They have demonstrated that DR5 CAR-T cells can target DR5-positive tumors and exert anti-tumor effects (patent application number: 202210932327.7). Existing DR5 CAR-T products are personalized cell therapy products that can only be autologously infused, not allogeneically. Furthermore, CAR-T cell therapy for tumors often results in a sharp increase in cytokines such as IL-6, leading to a cytokine storm phenomenon. This poses safety concerns, including neurotoxicity, which can be life-threatening in severe cases.

[0006] At present, there are no reports of CAR-NK cells targeting DR5. It is of great significance to establish an effective method for preparing CAR-NK cells targeting DR5 and set a precedent for its application in tumor immunotherapy. Summary of the Invention

[0007] In order to solve the problem of preparing CAR-NK cells from human peripheral blood, achieving large-scale cell expansion, high NK cell purity, and stable CAR transduction efficiency, thereby producing a CAR-NK cell for clinical medical treatment and cellular immunotherapy of tumors, the present invention provides a CAR-NK cell targeting death receptor 5 and its preparation method and application.

[0008] The specific technical solutions are as follows:

[0009] The present invention provides a method for preparing CAR-NK cells targeting death receptor 5, comprising the following steps:

[0010] 1) Construction of a virus expressing CAR targeting death receptor 5;

[0011] 2) Prepare peripheral blood mononuclear cells and isolate NK cells using negative selection;

[0012] 3) The sorted NK cells were cultured using NK cell expansion reagent (NE000-N022) purchased from Ekosai and 1% to 10% Super Grow (6122012) purchased from Dakowei. The above reagents were used according to the instructions;

[0013] 4) After 5-9 days of NK cell culture, add virus expressing CAR targeting death receptor 5 and viral transduction enhancer to the cultured NK cells, mix well and centrifuge at room temperature, then place in a 37°C, 5% CO2 incubator for culture until the cell density grows to 1-3×10 6 The cells were passaged with NK cell complete culture medium and collected after the culture was completed to obtain CAR-NK cells targeting death receptor 5.

[0014] Furthermore, in step 2), the negative selection method for NK cell sorting was performed using an NK cell sorting kit (480054) purchased from BioLegend according to the instructions.

[0015] Furthermore, in step 4), a virus expressing a CAR targeting death receptor 5 is added to the cultured NK cells at an MOI of 0.5 to 5;

[0016] Preferably, the virus expressing CAR targeting death receptor 5 is BaEv lentivirus, and the viral transduction enhancer is Lenti Boost;

[0017] Preferably, the volume ratio of the Lenti Boost to the cell virus mixture is 1:100 to 1:400;

[0018] Preferably, the centrifugation at room temperature in step 4) is performed at 600-1000 g for 60-120 min.

[0019] Furthermore, in step 4), the cells are passaged using NK cell complete culture medium at a ratio of 1:2 to 1:3.

[0020] Furthermore, the total in vitro culture time of the sorted NK cells is 21 to 150 days.

[0021] Furthermore, the CAR targeting death receptor 5 in step 1) comprises a death receptor 5 binding domain, a transmembrane domain, and an intracellular signaling domain, wherein the death receptor 5 binding domain is an anti-death receptor 5 single-chain antibody or an anti-death receptor 5 domain antibody;

[0022] Preferably, the CAR targeting death receptor 5 further comprises IL15 and / or CXCR2;

[0023] Preferably, the death receptor 5 binding domain is a single-chain antibody against death receptor 5, and the structure of the single-chain antibody against death receptor 5 is VH-linker-VL or VL-linker-VH;

[0024] Preferably, the intracellular signaling domain comprises one or more costimulatory signaling domains and a primary signaling domain;

[0025] Preferably, the transmembrane domain is selected from the transmembrane region of TCR alpha, beta, zeta chain, CD3ε, CD3ζ, CD4, CD5, CD8α, CD9, CD16, NKp44, NKp46, NKG2D, CD22, CD27, CD28, CD33, CD37, CD45, CD64, CD80, CD86, CD134, CD137, CD152, CD154 or PD1;

[0026] Preferably, the costimulatory signaling domain is selected from the intracellular signaling region of CARD11, CD2, CD7, CD27, CD28, CD30, CD40, OX40, CD137, CD134, PD-L2, PD-L1, CD278, DAP10, DAP12, 2B4, LAT, NKD2C, SLP76, TRIM, FcεRIγ, MyD88 and 41BBL;

[0027] Preferably, the primary signaling domain is selected from the group consisting of TCRξ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, CD278, CD66d and CD3ζ;

[0028] Preferably, the transmembrane domain is selected from the transmembrane domain of CD8α, CD4, CD45, PD1, CD154 or CD28;

[0029] Preferably, the costimulatory signaling domain is selected from the group consisting of CD137, CD134, CD28 and the intracellular signaling region of CD137;

[0030] Preferably, the transmembrane domain is selected from the transmembrane domain of CD8α or CD28;

[0031] Preferably, the costimulatory signaling domain is selected from the intracellular signaling domain of CD137;

[0032] Preferably, the primary signaling domain is selected from CD3ζ;

[0033] Preferably, the CAR targeting death receptor 5 further comprises a hinge domain;

[0034] Preferably, the CAR targeting death receptor 5 further comprises a signal peptide;

[0035] Preferably, the hinge domain is selected from the CD8α hinge region;

[0036] Preferably, the signal peptide is selected from CD8α signal peptide;

[0037] Preferably, the CAR targeting death receptor 5 comprises, from N-terminus to C-terminus: a signal peptide, a death receptor 5 binding domain, a hinge region, a transmembrane domain and an intracellular signaling domain;

[0038] Preferably, the CAR targeting death receptor 5 comprises a signal peptide, a death receptor 5 binding domain, a hinge region, a transmembrane domain, an intracellular signaling domain, a 2A peptide, IL15, a 2A peptide, and CXCR2 from the N-terminus to the C-terminus.

[0039] Furthermore, the anti-death receptor 5 is the monoclonal antibody 3E7 or a humanized sequence thereof, the nucleotide sequence encoding the light chain variable region of the monoclonal antibody 3E7 is shown in SEQ ID NO.2 or SEQ ID NO.11, and the nucleotide sequence encoding the heavy chain variable region of the monoclonal antibody 3E7 is shown in SEQ ID NO.4 or SEQ ID NO.10;

[0040] The nucleotide sequence encoding IL15 is shown in SEQ ID NO. 12;

[0041] The nucleotide sequence encoding CXCR2 is shown in SEQ ID NO.13.

[0042] On the other hand, the present invention also provides CAR-NK cells targeting death receptor 5 prepared by the above preparation method.

[0043] Furthermore, the CAR-NK cells also express other sequences, including cytokines, chemokines, safety switches, siRNAs that reduce PD-1 expression or proteins that block PD-L1, or another CAR targeting other tumor antigens or tumor microenvironment.

[0044] Another aspect of the present invention provides the use of the CAR-NK cells targeting death receptor 5 in the preparation of drugs for treating tumors;

[0045] Preferably, the tumor is a DR5-positive tumor;

[0046] Preferably, the tumor is liver cancer, lung cancer, colon cancer or pancreatic cancer.

[0047] The beneficial effects of the present invention are:

[0048] The DR5 CAR-NK cell culture and expansion process constructed by the present invention uses a culture medium with clear ingredients, serum-free, and animal-derived components, and pure cytokine stimulation to culture NK cells derived from human peripheral blood. Tumor cells such as K562 are not used as feeder cells (NK cells expressing DR5 are used as feeder cells themselves). Large-scale and long-term CAR-NK cell expansion can be achieved (cell expansion exceeds 100,000 times, and the cell in vitro culture time can exceed 100 days). High-purity CAR-NK cells are obtained (CD3-CD56+NK cell purity exceeds 99%, and the proportion of CAR-positive cells can be close to 100%). Allogeneic transfusion can be achieved, thereby reducing costs, making it possible to make off-the-shelf products, and increasing the accessibility of cell therapy. In addition, CAR-NK almost does not produce cytokines such as IL-6, does not cause cytokine storms, does not cause GvHD, does not cause long-term toxic side effects, and has better clinical treatment safety. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1 Schematic diagram of the CAR structure of Example 1, wherein SP: signal peptide; H: Hinge region; TM: transmembrane domain; 4-1BB: co-stimulatory signal domain; CD3ζ: primary signal domain; T2A: 2A peptide.

[0050] Figure 2 The figure shows the expansion fold and viability of NK and CAR-NK cells cultured in vitro.

[0051] Figure 3 Figure 2 shows the phenotype of CAR-NK cells cultured in vitro for 21 days.

[0052] Figure 4 The figure shows the CAR positivity rate of CAR-NK cells cultured in vitro for 118 days using flow cytometry. As can be seen from the figure, the CAR positivity rate of DR5 CAR-NK cells cultured in vitro for a long time is close to 100%.

[0053] Figure 5 Flow cytometry analysis of CAR-NK cells expressing DR5 and TRAIL. Left: 14 days of in vitro culture; Right: 104 days of in vitro culture.

[0054] Figure 6 The RTCA test results of DR5 CAR-NK cells killing Huh7 cells. The red line represents normal growth of tumor cells in culture medium, the green line represents tumor cells with the addition of NK cells, and the blue line represents tumor cells with the addition of CAR-NK cells (CAR positive rate 49.2%).

[0055] Figure 7 The figure shows the cytokine release after 24h co-culture of DR5 CAR-NK and Huh7 cells (effect-target ratio 1:1).

[0056] Figure 8 The RTCA test results of DR5 CAR-NK killing A549 cells.

[0057] Figure 9 The results of DR5 CAR-NK cell killing of HCT116 (left) and HepG2 (right) cells (CAR positive rate 33%).

[0058] Figure 10 The results of anti-PANC1 tumor in DR5 CAR-NK mice.

[0059] Figure 11 Figure B shows the results of humanized DR5 CAR-NK cells that can secrete IL15 and express CXCR2 against HCT116 tumors in mice; Figure A is a schematic diagram of the CAR structure used in this example, where scFv (H7L6) is the single-chain antibody sequence of the humanized 3E7 antibody. DETAILED DESCRIPTION

[0060] To more clearly understand the present invention, the present invention is further described with reference to the following examples and accompanying drawings. The examples are intended to illustrate the present invention only and are not intended to limit the present invention in any way. In the examples, all raw materials and reagents are commercially available. Experimental methods without specific conditions are conventional methods and conditions well known in the art, or according to the conditions recommended by the instrument manufacturer.

[0061] Example 1

[0062] 1. Construction of BaEv Lentivirus Expressing CAR Targeting Death Receptor 5

[0063] 1. Design of CAR structure targeting death receptor 5

[0064] The structure of the CAR targeting death receptor 5 in this example is as follows Figure 1 As shown in the figure, the CAR targeting death receptor 5 includes, from N-terminus to C-terminus, a signal peptide, 3E7 scFv, a hinge region, a transmembrane domain, a costimulatory signaling domain, a primary signaling domain, a 2A peptide, GFP, and WPRE, which are sequentially connected to form the CAR sequence. The signal peptide is the CD8α signal peptide, the 3E7 scFv is composed of the light chain variable region and the heavy chain variable region of the 3E7 monoclonal antibody connected by a linker, the hinge region is the CD8α hinge, the transmembrane domain is the CD8αTM, the costimulatory signaling domain is 4-1BB, the primary signaling domain is CD3ζ, and the 2A peptide is T2A.

[0065] Nucleotide sequence of SP (CD8α signal peptide) (SEQ ID NO.1):

[0066] ATGGCCCTCCCTGTCACCGCCCTGCTGCTTCCGCTGGCTCTTCTGCTCCACGCCGCT CGGCCC

[0067] Nucleotide sequence of 3E7 (light chain) (SEQ ID NO. 2):

[0068] GACATTTGTGATGACACAATCTCCATCCTCCCTGGCTGTGTCAGCAGGAGAGAAGGTCACTATGAGCTGCAAATCCAGTCAGAGTCTGCTCAACAGTAGAACCCGGAAGAACTACTTGGCTTGGTACCAGCAGAAACCAGGGCAGTCTCCTAAACTGCTGATCTACTGGG CATCCACTAGGGAATCTGGGGTCCCTGATCGCTTCATAGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAGCAGTGTGCAGGCTGAAGACCTGGCAGTTTTATTACTGCAAGCAATCTTATAATCTTCCGTTCACGTTCGGTGCTGGGACCAAGCTGGAGCTGAAA

[0069] Linker nucleotide sequence (SEQ ID NO.3):

[0070] GGTGGCGGTGGCTCGGGCGGTGGTGGGTCGGGTGGCGGCGGATCT

[0071] Nucleotide sequence of 3E7 (heavy chain) (SEQ ID NO.4):

[0072] GAAGTGAAGCTTCTCGAGTCTGGAGGTGGCCTGGTGCAGCCTGGAGGCAGCCTGAAACTCTCCTGTGCAGCCTCAGGATTCGATTTTAGTACATGCTGGATGAATTGGGTCCGGCAGGCTCCAGGGAAAGGACTAGAATGGATTGGAGAAATTAATCCAGATAGTAGTAGGATAAATTATATGCCATCTCTAAAGGAAAAATTCATCATCTCCAGAGACAACGCCAAAAATACACTGTACCTGCAAATGAGCAAAGTGAGATCTGAAGACACAGCCCTTTATTACTGTGCAAGGGGAGGAACTTTCTATGCTATGGACTACTGGGGTCAAGGAACCTCAGTCACCGTCTCCTCA

[0073] Nucleotide sequence of CD8α hinge (SEQ ID NO.5):

[0074] ACCACTACCCCAGCACCGAGGCCACCCACCCCGGCTCCTACCATCGCCTCCCAGCCTCTGTCCCTGCGTCCGGAGGCATGTAGACCCGCAGCTGGTGGGGCCGTGCATACCCGGGGTCTTGACTTCGCCTGCGATATC3]

[0075] Nucleotide sequence of CD8α TM (SEQ ID NO.6):

[0076] TACATTTGGGCCCCTCTGGCTGGTACTTGCGGGGTCCTGCTGCTTTCACTCGTGATCACTCTTTACTGTAAGCGCGGT

[0077] Nucleotide sequence of 4-1BB (SEQ ID NO.7):

[0078] ​CGGAAGAAGCTGCTGTACATCTTTAAGCAACCCTTCATGAGGCCTGTGCAGACTACTCAAGAGGAGGACGGCTGTTCATGCCGGTTCCCAGAGGAGGAGGAAGGCGGCTGCGAACTG

[0079] Nucleotide sequence of CD3ζ (SEQ ID NO.8):

[0080] AGAGTGAAGTTCAGCAGGAGCGCAGACGCCCCCGCGTACCAGCAGGGCCAGAACCAGCTCTATAACGAGCTCAATCTAGGACGAAGAGAGGAGTACGATGTTTTGGACAAGAGACGTGGCCGGGACCCTGAGATGGGGGGAAAGCCGAGAAGGAAGAACCCTCAGGAAGGCCTGTACAATGAACTGCAGAAAGATAAGATGGCGGAGGCCTACAGTGAGATTGGGATGAAAGGCGAGCGCCGGAGGGGCAAGGGGCACGATGGCCTTTACCAGGGTCTCAGTACAGCCACCAAGGACACCTACGACGCCCTTCACATGCAGGCCCTGCCCCCTCGC

[0081] Nucleotide sequence of T2A-EGFP (SEQ ID NO.9):

[0082] GAATTCGAGGGCAGAGGAAGTCTGCTAACATGCGGTGACGTCGAGGAGAATCCTGGCCCAGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAG TTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCG AGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGT GCAGCTCGCCGACCACTACCAGCAGAACACCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTGAGTCGAC

[0083] 2. The above CAR sequence was synthesized and constructed into the pCDH expression plasmid (completed by Jinweizhi Company). It was transfected into 293T cells together with the pMDLg / pRRE, pRSV-Rev, and pMD2.G (baboon envelope glycoprotein) packaging plasmids to package and produce the BaEv lentivirus expressing the CAR targeting death receptor 5.

[0084] 2. Preparation of CAR-NK cells

[0085] 1. Isolation and culture of NK cells

[0086] Peripheral blood was collected, and buffy coat cells were isolated after Ficoll density gradient centrifugation to obtain peripheral blood mononuclear cells (PBMCs). NK cells were cultured using a self-assembled NK cell culture method, which included negative selection of NK cells using the NK cell sorting kit (480054, purchased from Biolegend), culturing NK cells with the NK cell expansion reagent (NE000-N022, purchased from Ecosine), and adding 1% Super Grow (6122012, purchased from Dakoway) to the NK culture medium to promote NK cell growth. These reagents were used according to the manufacturer's instructions.

[0087] 2. Viral transduction and CAR-NK culture

[0088] After 5-9 days of NK cell culture, sample and count the NK cells. Based on the count results, add DR5CARBaEv lentivirus at an MOI of 1 and Lenti Boost (volume ratio 1:400, Sirion Biotech). Mix thoroughly and centrifuge at 600g for 90 minutes at room temperature. Place in a 37°C, 5% CO2 incubator for culture. Retain some NK cells without lentivirus transduction and continue to culture in the incubator. Check cell density and viability every 2-3 days. When the cell density reaches 1-3×10 6 NK or CAR-NK cells were passaged at 4% NK / mL.

[0089] Figure 2 The figure shows the expansion times and viability of NK cells and CAR-NK cells cultured in vitro. Figure 2 It can be seen that after 21 days of in vitro culture of PBMC-derived NK cells, the cell proliferation multiple can reach more than 100,000 times. The level of in vitro proliferation of CAR-NK is slightly lower than that of NK, and the cell viability can be maintained at more than 90%.

[0090] 3. Flow cytometry

[0091] After 21 days of in vitro culture, 0.5×10 6 NK or CAR-NK cells were plated with APC-anti-CD3, APC / CY7-anti-CD56, and PE / CY7-anti-CD16 antibodies (BioLegend) and incubated at 4°C for 30 min in the dark. After incubation, 1 mL of DPBS was added, the supernatant was removed by centrifugation, and 200 μL of DPBS was added to mix thoroughly before analyzing the cell purity and phenotype using flow cytometry.

[0092] Figure 3 Figure 2 is the phenotype of CAR-NK cells cultured in vitro for 21 days. Figure 3 It can be seen that after 21 days of in vitro culture, 99.5% of the cells were CD3-CD56 +NK cells, and 99.1% of NK cells are CD16 + Significant CAR-positive NK cells were detected (FITC channel, positive rate 49.2%).

[0093] When DR5 CAR-NK cells are cultured in vitro, it can be observed that the proportion of CAR-positive NK cells gradually increases with the extension of culture time, until it approaches 100%. At the same time, NK cells will gradually express DR5 from not expressing DR5. Therefore, DR5CAR-NK cells can use NK cells expressing DR5 as feeder cells, thereby continuously increasing the proportion of CAR-positive NK cells and achieving long-term cell expansion. Figure 4 The positive rate of CAR-NK cells after long-term culture in vitro for 118 days was close to 100%. Figure 5 Flow cytometry plots of CAR-NK cells expressing DR5 and TRAIL. Left: 14 days of in vitro culture; Right: 104 days of in vitro culture. As can be seen, NK cells gradually express DR5 over time, shifting from non-expressing DR5 to expressing DR5.

[0094] 3. In vitro killing function test

[0095] Tumor cell cytotoxicity experiments were performed using a real-time cell analyzer (xCElligence RTCA SP). First, 50 μL of tumor cell culture medium and 50 μL of complete culture medium containing 10,000 Huh7 cells, 10,000 A549 cells, 40,000 HCT116 cells, or 20,000 HepG2 cells were added to the E-Plate wells of the instrument. Approximately 5 to 24 hours later, 100 μL of the corresponding number of CAR-NK cells and NK cells (uninfected NK cells as a control) were added according to different effector-target ratios (E:T). The cells were then co-cultured for a period of time (>24 hours). The cell cytotoxicity was analyzed based on the CI values ​​obtained on the real-time cell analyzer. The cell culture supernatant was collected and cytokine levels were measured using the BD CBA assay kit.

[0096] Figure 6 The results of RTCA detection of DR5 CAR-NK cells killing Huh7 cells are shown in Figure 2. Figure 6 It can be seen that DR5CAR-NK cells cultured in vitro for 21 days have a very strong killing effect on DR5-positive Huh7 tumor cells. Especially at a low efficiency target ratio, NK cells have almost no ability to kill tumor cells, while CAR-NK cells can still kill tumor cells in a dose-dependent manner. The applicant prepared multiple batches of DR5 CAR-NK cells, and the CAR positivity rate of DR5 CAR-NK cells used in this experiment was 49.2%. Figure 7The figure shows the cytokine release after 24h co-culture of DR5 CAR-NK cells and Huh7 cells (effect-target ratio 1:1). Figure 7 It can be seen that after 24 hours of co-culture with DR5-positive tumor cells, DR5 CAR-NK cells can secrete a large amount of cytokines, such as granulocyte macrophage colony-stimulating factor (GM-CSF), monocyte chemoattractant protein-1 (MCP-1), perforin, and granzyme B, which are significantly higher than the cytokine secretion level of NK cells. No IL-6 expression was detected in the supernatants of CAR-NK and NK cells.

[0097] Figure 8 The results of RTCA detection of DR5 CAR-NK killing A549 cells. Figure 7 It can be seen that DR5CAR-NK cells cultured in vitro for 118 days have a dose-dependent tumor cell killing effect.

[0098] Figure 9 To test the in vitro killing effect of DR5 CAR-NK on HCT116 (left) and HepG2 (right) cells, the applicant prepared multiple batches of DR5 CAR-NK cells. The CAR positivity rate of the DR5 CAR-NK cells used in this experiment was 33%. Figure 9 It can be seen that under the same effector-target ratio conditions, DR5 CAR-NK cells have a significantly enhanced killing effect on DR5-positive tumor cells HCT116 and HepG2 compared with NK cells.

[0099] IV. In vivo anti-tumor assay

[0100] Eighteen 6-week-old B-NDG female mice were subcutaneously inoculated with 0.2 mL of PANC1 cells (containing 5×10 6 cells), when the average tumor size is ∼100 mm 3 The animals were divided into three groups (6 animals / group) and given NK (NK cell control without DR5 CAR virus infection), CAR-NK (1×10 7 The NK group received the same number of cells as the CAR-NK group, with a CAR-positive rate of 49.2% (cells / mouse) and the vehicle (model group). The total number of cells injected in the NK group was the same as in the CAR-NK group, with two injections of CAR-NK and NK cells. Tumor size was measured with a vernier caliper, the mice were weighed, and their survival was observed. Forty-eight days after CAR-NK injection, mice were euthanized, and the tumors were isolated and weighed. Tumor volume = 1 / 2 × (long diameter) × (short diameter) × (short diameter).

[0101] Figure 10 The results of DR5 CAR-NK cell anti-PANC1 tumor in vivo in mice. Figure 10The results show that DR5 CAR-NK cells have a significant anti-tumor effect in vivo. Regarding tumor weight, the CAR-NK group vs. the model group, p < 0.01; the CAR-NK group vs. the NK group, p < 0.05. Furthermore, the body weight of mice injected with CAR-NK was stable, with no significant difference compared to the model and NK groups, demonstrating the good safety of CAR-NK cells in vivo.

[0102] Example 2

[0103] 1. Preparation of humanized DR5 CAR-NK cells that secrete IL15 and express CXCR2

[0104] 1. CAR structure design

[0105] Schematic diagram of the CAR structure of humanized DR5 CAR-NK cells that can secrete IL15 and express CXCR2 Figure 11 As shown in A, it includes from N-terminus to C-terminus: signal peptide, scFv (H7L6), Hinge region, transmembrane domain, co-stimulatory signal domain, primary signal domain, 2A peptide, IL15, 2A peptide, CXCR2 and WPRE, which are sequentially connected to obtain the CAR sequence. Among them, the nucleotide sequences of the signal peptide, Hinge region, transmembrane domain, co-stimulatory signal domain, primary signal domain, 2A peptide and WPRE are the same as those in Example 1. scFv (H7L6) is composed of heavy chains and light chains of humanized sequences connected by Linker, and the nucleotide sequence of Linker is the same as that in Example 1. IL15 is used to enhance the in vivo proliferation of CAR-NK cells, and CXCR2 is used to enhance the migration and infiltration of CAR-NK cells to the tumor site, thereby improving the anti-tumor efficacy.

[0106] Nucleotide sequence of 3E7 humanized H7L6 (heavy chain) (SEQ ID NO.10):

[0107] GAGGTGCAGCTGGTGGAGAGCGGCGGCGGCTTAGTTAAACCTGGCGGAAGCTTGAGGCTGAGCTGCGCTGCCAGCGGCTTCGATTTCAGCACCTGCTGGATGAACTGGGTGAGGCAGGCCCCCGGCAAGGGATTAGAGTGGATCGGCGAGATCAATCCCGACAGCAGCAGGATCAACTACATGCCCAGCCTGAAGGAGAAGTTCACCATCAGCAGGGACAACGCCAAGAACACCCTGTACCTGCAGATGAGCAGCGTGAGGGCCGAGGACACCGCTCTGTATTACTGCGCTAGGGGAGGAACCTTCTACGCCATGGACTACTGGGGCCAGGGAACCACCGTGACCGTCAGCAGC

[0108] Nucleotide sequence of 3E7 humanized H7L6 (light chain) (SEQ ID NO.11):

[0109] GAGATCGTGATGACCCAGAGCCCTCCCAGCCTTGCTGTGTCTCCTGGCGAGAGAGTGACCATGAGCTGCAAGAGCAGCCAGAGCCTGCTGAACAGCAGGACCAGGAAGAACTACCTGGCCTGGTACCAGCAGAAGCCCGGCCAGGCTCCTAGGCTGTTGATCTACTGGGCCAGCACAAGGGAGAGCGGCGTGCCTGCTAGATTCTCTGGAAGCGGATCCGGAACCGACTTCACCCTGACCATCAGCAGCGTGCAGCCCGAAGACCTTGCCGTGTACTACTGCAAGCAGAGCTACAACCTGCCCTTCACCTTCGGCCAGGGCACCAAGCTGGAGATCAAG

[0110] Nucleotide sequence of IL15 (SEQ ID NO.12):

[0111] ATGAGAATTTCGAAACCACATTTGAGAAGTATTTCCATCCAGTGCTACTTGTGTTTACTTCTAAACAGTCATTTTCTAACTGAAGCTGGCATTCATGTCTTCATTTTGGGCTGTTTCAGTGCAGGGCTTCCTAAAACAGAAGCCAACTGGGTGAATGTAATAAGTGATTTGAAAAAAATTGAAGATCTTATTCAATCTATGCATATTGATGCTACTTTATATACGGAAAGTGATGTTCACCCCAGTTGCAAAGTAACAGCAATGAAGTGCTTTCTCTTGGAGTTACAAGTTATTTCACTTGAGTCCGGAGATGCAAGTATTCATGATACAGTAGAAAATCTGATCATCCTAGCAAACAACAGTTTGTCTTCTAATGGGAATGTAACAGAATCTGGATGCAAAGAATGTGAGGAACTGGAGGAAAAAAATATTAAAGAATTTTTGCAGAGTTTTGTACATATTGTCCAAATGTTCATCAACACTTCT

[0112] Nucleotide sequence of CXCR2 (SEQ ID NO.13):

[0113]

[0114] 2. Preparation of CAR-NK cells

[0115] The BaEv lentivirus expressing the above CAR was prepared in the same manner as in Example 1. Humanized DR5 CAR-NK cells capable of secreting IL15 and expressing CXCR2 were further prepared in the same manner as in Example 1.

[0116] 2. In vivo anti-tumor experiments

[0117] Fifteen 6-week-old B-NDG female mice were subcutaneously inoculated with 0.2 mL of HCT116 cells (containing 5×10 6 cells), when the tumor size exceeds 100 mm 3 The animals were divided into three groups (5 animals / group) and given NK (NK cell control without DR5 CAR virus infection), CAR-NK (1×10 7 The NK group was injected with the same number of cells as the CAR-NK group, and CAR-NK and NK cells were injected six times. Tumor size was measured with a vernier caliper, and the survival of the mice was observed. Tumor volume = 1 / 2 × (long diameter) × (short diameter) × (short diameter).

[0118] Figure 11 Figure B shows the results of humanized DR5 CAR-NK cells that secrete IL15 and express CXCR2 against HCT116 tumors in mice. As shown in the figure, DR5 CAR-NK cells that secrete IL15 and express CXCR2 have significant in vivo anti-tumor effects in a rapidly proliferating tumor model.

[0119] Obviously, the above embodiments are merely examples for clarity of explanation and are not intended to limit the implementation methods. Those skilled in the art will readily appreciate that other variations or modifications based on the above descriptions are possible. It is not necessary and impossible to enumerate all implementation methods here. Obvious variations or modifications arising therefrom remain within the scope of protection of the present invention.

Claims

1. A method for preparing CAR-NK cells targeting death receptor 5, characterized in that: The steps include: 1) Construction of a virus expressing CAR targeting death receptor 5; 2) Prepare peripheral blood mononuclear cells and isolate NK cells using negative selection; 3) The sorted NK cells were cultured using NK cell expansion reagent (NE000-N022) purchased from Ekosai and 1% to 10% Super Grow (6122012) purchased from Dakowei. The above reagents were used according to the instructions; 4) After 5-9 days of NK cell culture, add virus expressing CAR targeting death receptor 5 and viral transduction enhancer to the cultured NK cells, mix well and centrifuge at room temperature, then place in a 37°C, 5% CO2 incubator for culture until the cell density grows to 1-3×10 6 The cells were passaged with NK cell complete culture medium and collected after the culture was completed to obtain CAR-NK cells targeting death receptor 5.

2. The preparation method according to claim 1, characterized in that In step 2), NK cells were sorted by negative selection using an NK cell sorting kit (480054) purchased from BioLegend according to the instructions.

3. The preparation method according to claim 1, characterized in that In step 4), a virus expressing CAR targeting death receptor 5 is added to the cultured NK cells at an MOI of 0.5 to 5; Preferably, the virus expressing CAR targeting death receptor 5 is BaEv lentivirus, and the viral transduction enhancer is Lenti Boost; Preferably, the volume ratio of the Lenti Boost to the cell virus mixture is 1:100 to 1:

400. Preferably, the centrifugation at room temperature in step 4) is performed at 600-1000 g for 60-120 min.

4. The preparation method according to claim 1, characterized in that In step 4), the cells were passaged using NK cell complete culture medium at a ratio of 1:2 to 1:

3.

5. The preparation method according to claim 1, characterized in that The total in vitro culture time of the sorted NK cells is 21 to 150 days.

6. The preparation method according to claim 1, characterized in that In step 1), the CAR targeting death receptor 5 comprises a death receptor 5 binding domain, a transmembrane domain, and an intracellular signaling domain, wherein the death receptor 5 binding domain is an anti-death receptor 5 single-chain antibody or an anti-death receptor 5 domain antibody; Preferably, the CAR targeting death receptor 5 further comprises IL15 and / or CXCR2; Preferably, the death receptor 5 binding domain is a single-chain antibody against death receptor 5, and the structure of the single-chain antibody against death receptor 5 is VH-linker-VL or VL-linker-VH; Preferably, the intracellular signaling domain comprises one or more costimulatory signaling domains and a primary signaling domain; Preferably, the transmembrane domain is selected from the transmembrane region of TCR alpha, beta, zeta chain, CD3ε, CD3ζ, CD4, CD5, CD8α, CD9, CD16, NKp44, NKp46, NKG2D, CD22, CD27, CD28, CD33, CD37, CD45, CD64, CD80, CD86, CD134, CD137, CD152, CD154 or PD1; Preferably, the costimulatory signaling domain is selected from the intracellular signaling region of CARD11, CD2, CD7, CD27, CD28, CD30, CD40, OX40, CD137, CD134, PD-L2, PD-L1, CD278, DAP10, DAP12, 2B4, LAT, NKD2C, SLP76, TRIM, FcεRIγ, MyD88 and 41BBL; Preferably, the primary signaling domain is selected from the group consisting of TCRξ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, CD278, CD66d and CD3ζ; Preferably, the transmembrane domain is selected from the transmembrane domain of CD8α, CD4, CD45, PD1, CD154 or CD28; Preferably, the costimulatory signaling domain is selected from the intracellular signaling region of CD137, CD134, CD28 and CD137; Preferably, the transmembrane domain is selected from the transmembrane domain of CD8α or CD28; Preferably, the costimulatory signaling domain is selected from the intracellular signaling domain of CD137; Preferably, the primary signaling domain is selected from CD3ζ; Preferably, the CAR targeting death receptor 5 further comprises a hinge domain; Preferably, the CAR targeting death receptor 5 further comprises a signal peptide; Preferably, the hinge domain is selected from the CD8α hinge region; Preferably, the signal peptide is selected from CD8α signal peptide; Preferably, the CAR targeting death receptor 5 comprises, from N-terminus to C-terminus: a signal peptide, a death receptor 5 binding domain, a hinge region, a transmembrane domain, and an intracellular signaling domain; Preferably, the CAR targeting death receptor 5 comprises a signal peptide, a death receptor 5 binding domain, a hinge region, a transmembrane domain, an intracellular signaling domain, a 2A peptide, IL15, a 2A peptide, and CXCR2 from the N-terminus to the C-terminus.

7. The preparation method according to claim 1, characterized in that The anti-death receptor 5 is the monoclonal antibody 3E7 or its humanized sequence, the nucleotide sequence encoding the light chain variable region of the monoclonal antibody 3E7 is shown in SEQ ID NO.2 or SEQ ID NO.11, and the nucleotide sequence encoding the heavy chain variable region of the monoclonal antibody 3E7 is shown in SEQ ID NO.4 or SEQ ID NO.10; The nucleotide sequence encoding IL15 is shown in SEQ ID NO. 12; The nucleotide sequence encoding CXCR2 is shown in SEQ ID NO.

13.

8. CAR-NK cells targeting death receptor 5 prepared by the preparation method of claims 1-7.

9. The CAR-NK cell according to claim 8, characterized in that The CAR-NK cells also express other sequences, including cytokines, chemokines, safety switches, siRNAs that reduce PD-1 expression or proteins that block PD-L1, or another CAR targeting other tumor antigens or the tumor microenvironment.

10. Use of the CAR-NK cell targeting death receptor 5 according to claim 8 in the preparation of a drug for treating tumors; Preferably, the tumor is a DR5-positive tumor; Preferably, the tumor is liver cancer, lung cancer, colon cancer or pancreatic cancer.

Images