Application of CGRP receptor small molecule antagonist in preparation of medicine for treating eosinophilic chronic sinusitis with nasal polyp

Abstract

The invention discloses an application of a CGRP receptor small molecule antagonist in preparation of a medicine for treating eosinophilic chronic sinusitis with nasal polyp. The pharmaceutical preparation is composed of an effective amount of a CGRP receptor small molecule antagonist and pharmaceutically acceptable auxiliary materials, the dosage form is nasal spray / nose drop / irrigation, and the pharmaceutical preparation is simple and convenient in administration route, easy to operate and convenient for patients to use. According to the invention, by inhibiting CGRP-mediated mast cell activation, eosinophilic granulocyte inflammation is significantly relieved, and especially, the traditional Chinese medicine composition has a definite treatment advantage on eosinophilic granulocyte nasal polyp; and compared with a biological agent of a targeted type 2 cytokine, the small molecule compound is safer, simpler and more convenient to obtain, the treatment cost of a patient can be remarkably reduced, and a new efficient and economic choice is provided for nasal polyp treatment.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, specifically to the field of therapeutic drug technology for eosinophilic chronic sinusitis with nasal polyps, and more particularly to the use of a CGRP receptor small molecule antagonist in the preparation of a drug for treating eosinophilic chronic sinusitis with nasal polyps. Background Art

[0002] Chronic rhinosinusitis with nasal polyps (CRSwNP) is a chronic inflammatory disease that occurs primarily in the sinus mucosa and is accompanied by the formation of polyps.

[0003] In recent years, multiple phase II or phase III clinical studies targeting type 2 cytokines and eosinophilic inflammation in nasal polyps have shown that targeted biologics (such as dupilumab and mepolizumab) that block type 2 cytokines (including anti-IL-5R, anti-IL-4Rα, and anti-IgE) have shown encouraging efficacy in patients with eosinophilic CRSwNP with a predominantly type 2 inflammation who have a poor response to glucocorticoid therapy: they can significantly reduce polyp size, improve clinical symptoms, and reduce the risk of reoperation. However, the limitations of existing targeted biologics are also very prominent: First, it is only effective in 40%-60% of patients with high expression of type 2 inflammation, and has no significant improvement in patients with non-type 2 inflammation phenotypes or low responses; Second, biologics require long-term injections (e.g., dupilumab, administered subcutaneously every two weeks), and the annual cost of treatment can be as high as 100,000 to 200,000 yuan, placing a heavy burden on patient compliance and the economy. Third, some patients may experience hypersensitivity reactions (such as redness and swelling at the injection site and systemic rash), posing a safety risk. These drawbacks suggest an urgent need for the development of novel targets or drugs that target the eosinophilic inflammation mechanism of nasal polyps.

[0004] Nasal epithelial cells, as the first line of defense in nasal mucosal immunity, not only serve as a barrier but also possess crucial immunomodulatory functions, playing a central role in regulating eosinophilic inflammation in nasal polyps. However, epithelial cells are highly heterogeneous, and the precise subtypes involved in regulating eosinophilic inflammation remain unclear. Recent advances such as single-cell sequencing have revealed that respiratory epithelial cells comprise diverse subpopulations. In addition to the common basal, ciliated, and goblet cells, specialized subtypes exist, including solitary chemosensory cells and neuroendocrine cells (pulmonary neuroendocrine cells (PNECs). Neuroendocrine cells sense stimuli such as oxygen, mechanical stretch, and chemicals, and upon activation, release neuropeptides such as calcitonin gene-related polypeptide (CGRP), gastrin-releasing peptide (GRP), chromogranin A (CHGA), and synaptophysin (SYP). These neuropeptides have immunomodulatory functions. For example, CGRP has been shown to promote the secretion of inflammatory factors by activating immune cells such as ILC2 and macrophages. However, existing research has largely focused on the role of CGRP in diseases such as migraine and asthma (for example, CGRP receptor antagonists have been approved for migraine prevention). Its pathological mechanisms in CRSwNP (especially its regulatory effects on eosinophilic inflammation) and its therapeutic potential have not been systematically studied, creating a significant technical gap.

[0005] Currently, there are no reports of drugs using neuropeptides (especially CGRP) to treat nasal polyps. Given this background, the development of novel therapeutic targets (such as the neuropeptide CGRP) for eosinophilic inflammation in CRSwNP has important clinical significance and innovative value in addressing the shortcomings of existing biologics, such as their limited efficacy and limited scope of application. Summary of the Invention

[0006] The present invention aims to overcome the shortcomings of prior art glucocorticoids and type 2 cytokine-targeted biologics, such as insufficient efficacy, narrow scope of application, and high treatment costs, for some patients with eosinophilic chronic sinusitis with nasal polyps. The present invention provides a small molecule CGRP receptor antagonist for use in the preparation of a drug for treating eosinophilic chronic sinusitis with nasal polyps. The small molecule CGRP receptor antagonist of the present invention can effectively treat eosinophilic chronic sinusitis with nasal polyps by intervening in the proinflammatory effects of the neuropeptide CGRP, providing a more precise, economical, and safe treatment option for patients with eosinophilic chronic sinusitis with nasal polyps.

[0007] To achieve the above objectives, the present invention provides the following technical solutions: 1. Application of small molecule CGRP receptor antagonists The present invention provides a small molecule CGRP receptor antagonist for use in the preparation of a medicament for treating eosinophilic chronic rhinosinusitis with nasal polyps. The small molecule CGRP receptor antagonist is a small molecule compound that binds to the CGRP receptor CRLR (capable of specifically inhibiting CGRP).

[0008] Furthermore, the CGRP receptor small molecule antagonist has a molecular weight of ≤1000Da.

[0009] Furthermore, the CGRP receptor small molecule antagonist is Olcegepant.

[0010] 2. Drug preparations for the treatment of eosinophilic chronic sinusitis with nasal polyps The present invention also provides a pharmaceutical preparation for treating eosinophilic chronic sinusitis with nasal polyps, which comprises an effective amount of the above-mentioned CGRP receptor small molecule antagonist.

[0011] Furthermore, in the pharmaceutical preparation, the effective concentration of the CGRP receptor small molecule antagonist is 2-5 μM.

[0012] Furthermore, in the pharmaceutical preparation, the effective concentration of the CGRP receptor small molecule antagonist is 3 μM.

[0013] Furthermore, it also includes pharmaceutically acceptable auxiliary materials.

[0014] Furthermore, the auxiliary material is any one of physiological saline, glucose, vitamin C and amino acid.

[0015] Furthermore, the pharmaceutical preparation is a spray preparation, nasal drops or irrigant.

[0016] Furthermore, the spray preparation is any one of an atomizer, a spray and a suspension.

[0017] Preparation method of the above-mentioned pharmaceutical preparation (taking spray preparation as an example): ① Weigh a small molecule CGRP receptor antagonist (purity ≥98%) and dissolve it in normal saline (pH 6.5-7.5) at a concentration of 3 μM. ②Add vitamin C (0.1% w / v) as an antioxidant and stir until completely dissolved; ③ Sterilize by filtration through a 0.22 μm sterile filter membrane and dispense into a high-pressure spray device, 10 mL per bottle; After sealing, the above-mentioned drug preparations shall undergo sterility testing (which must comply with the sterility testing method of the 2025 edition of the Chinese Pharmacopoeia) and CGRP antagonist concentration testing (HPLC method, deviation ≤±5%). The quality control standards are as follows: ① pH value: 6.5-7.5 (pH value determination method of the 2025 edition of the Chinese Pharmacopoeia); ② Sterility: Must pass sterility test (no bacterial or fungal growth); ③Main drug content: CGRP receptor small molecule antagonist concentration is 3μM±0.15μM (HPLC method); ④Stability: After 6 months of storage at room temperature (25°C), the degradation rate of the main drug is ≤5% (verified by accelerated test).

[0018] Principle of the Invention Through systematic research, the present invention reveals the abnormal expression of nasal mucosal PNEC and its secreted CGRP in Eos CRSwNP and its mechanism of action in type 2 inflammation.

[0019] 1. The present invention used immunofluorescence staining and quantitative analysis using the image analysis software ImageJ, and found that the distribution density of PNECs in the nasal mucosa of Eos CRSwNP patients was significantly higher than that in the normal control group, while there was no significant difference between the Non-Eos CRSwNP group and the normal control group. Further RT-PCR detection found that the mRNA expression levels of the PNEC lineage-determining transcription factor ASCL1 and the neuropeptide CGRP were significantly upregulated in the Eos CRSwNP group. ELISA verification showed that the expression level of CGRP protein was significantly increased in the Eos CRSwNP group. Immunofluorescence co-localization showed that CGRP in the nasal mucosal epithelial tissue was mainly derived from PNECs. In summary, it was shown that PNECs and the CGRP they secrete are abnormally highly expressed in Eos CRSwNP.

[0020] 2. Expression correlation analysis in the present invention showed that in CRSwNP tissue, the expression levels of PNEC and its secreted CGRP were significantly positively correlated with the mRNA expression levels of IL-5 and IL-13. There was a clear positive correlation between the mRNA expression of ASCL1 and CGRP and the expression of IL-5 and IL-13, suggesting that PNEC and its secreted CGRP may play an inductive role in the type 2 inflammatory response in CRSwNP.

[0021] 3. Immunofluorescence staining analysis revealed that CRLR and RAMP1, components of the CGRP receptor complex, colocalize in mast cells. Furthermore, the number of PGP9.5-positive PNECs in nasal polyps was positively correlated with the number of tryptase-positive mast cells, suggesting that mast cells may serve as downstream target cells of CGRP and may be functionally responsive to CGRP stimulation.

[0022] 4. This study found that both CRLR and RAMP1 are expressed in mouse bone marrow-derived mast cells (BMMCs). CGRP significantly promotes BMMC degranulation, as evidenced by a significant upregulation of β-hexosaminidokinase levels in the culture supernatant. CGRP stimulation of BMMCs activates the cAMP-PKA-pCREB downstream signaling pathway and increases the mRNA expression of Il-5 and Il-13 in BMMCs, suggesting that CGRP may promote the production of type 2 inflammatory factors by mast cells. In vivo animal studies have demonstrated that mast cells play a key role in CGRP-mediated type 2 inflammation in the upper airways, and that CRLR antagonists can significantly alleviate the inflammatory response.

[0023] Olcegepant, a small molecule CRLR antagonist administered intranasally in mice, significantly alleviated papain-induced type 2 inflammatory responses, reduced eosinophil infiltration and goblet cell proliferation, and decreased IL-5 and IL-13 expression in nasal tissue. These results suggest that PNEC-derived CGRP plays a key role in maintaining type 2 inflammation in the upper airways and that CRLR antagonists have potential clinical application.

[0024] In summary, the present invention reveals the abnormal expression of PNEC and its secreted CGRP in Eos CRSwNP and its key mechanism of action in type 2 inflammation, and verifies the anti-inflammatory effect of CRLR antagonists through in vivo experiments, providing a theoretical basis and potential application value for the development of therapeutic strategies targeting the CGRP signaling pathway.

[0025] Beneficial effects of the present invention 1. Clear efficacy: The CGRP receptor small molecule antagonist of the present invention can significantly reduce local inflammation of nasal polyps in patients with eosinophilic chronic sinusitis with nasal polyps by blocking the pro-inflammatory effect of CGRP on mast cells, thereby compensating for the defect that existing biological agents are ineffective in 40%-60% of patients.

[0026] 2. Economy and safety: The synthesis process of small molecule compounds is mature and low-cost, and systemic side effects can be avoided through local administration (spray / nasal drops / rinse). Their safety is better than biological agents that require long-term injections.

[0027] 3. Easy to use: The drug preparation is in the form of spray preparation, nasal drops or irrigants, which have a simple route of administration and can be administered by patients themselves, significantly improving treatment compliance. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 The immunofluorescence images of PNEC distribution in the ethmoid sinus mucosa / nasal polyp epithelial tissues of normal controls and patients with nasal polyps, as well as the PNEC lineage-determining transcription factor ASCL1 and neuropeptide CGRP (encoding gene is CALCA) expression levels; Among them, A is the organizational distribution diagram of PNEC (left figure) and the corresponding statistical diagram (right figure); B is a schematic diagram of the mRNA expression levels of the PNEC lineage-determining transcription factor ASCL1; C is a schematic diagram of the mRNA expression level of neuropeptide CGRP; D is a schematic diagram of the protein expression level of neuropeptide CGRP; E is a schematic diagram of immunofluorescence co-localization of PGP9.5 and CGRP in nasal mucosal epithelial tissue; In the figure, Control: control; Eos CRSwNP: eosinophilic chronic rhinosinusitis with nasal polyps; Non-Eos CRSwNP: non-eosinophilic chronic rhinosinusitis with nasal polyps; PGP9.5: protein gene product 9.5; DAPI: 4,6-diamidino-2-phenylindole; ASCL1: basic helix-loop-helix transcription factor 1 of the non-setose scale family; CALCA: calcitonin gene-related peptide α (gene encoding CGRP); CGRP: calcitonin gene-related peptide.

[0029] express P <0.05, express P <0.01, express P <0.001.

[0030] Figure 2 Schematic diagram of the positive correlation between ASCL1 and CALCA mRNA expression and tissue IL-5 and IL-13 mRNA expression levels in CRSwNP patients; A is a schematic diagram showing the positive correlation between ASCL1 mRNA expression and tissue IL-5 and IL-13 mRNA expression levels; B is a schematic diagram showing the positive correlation between CALCA mRNA expression and tissue IL-5 and IL-13 mRNA expression levels; In the figure, ASCL1: basic helix-loop-helix transcription factor 1 of the setae-less scale family; CALCA: calcitonin gene-related peptide alpha (the gene encoding CGRP); IL-5: interleukin-5; IL-13: interleukin-13.

[0031] Figure 3 Schematic diagram showing the expression of CGRP receptor subunits CRLR and RAMP1 on the surface of mast cells in nasal polyp tissues of CRSwNP patients and the correlation between the distribution of mast cells and PNECs; Wherein, A is a schematic diagram of the expression of CGRP receptor subunits CRLR and RAMP1 on the surface of mast cells; B is a schematic diagram of the correlation between PNEC distribution and mast cell tryptase expression in nasal polyp tissue; In the figure, CRLR: calcitonin receptor-like receptor; RAMP1: receptor activity-modifying protein 1; Tryptase: tryptase; PGP9.5: protein gene product 9.5; DAPI: 4,6-diamidino-2-phenylindole.

[0032] Figure 4 Schematic diagram showing that CGRP can promote the degranulation of mouse bone marrow-derived mast cells and the production of type 2 inflammatory factors Il-5 and Il-13; Among them, A is a schematic diagram of the expression levels of CGRP receptor subunits CRLR and RAMP1 in BMMCs; B is a schematic diagram of the production of β-hexosaminidokinase in mast cell supernatant; C is a schematic diagram of the expression levels of type 2 inflammatory factors Il-5 and Il-13 mRNA in mast cells; In the figure, CD117: stem cell factor receptor (c-Kit), a mast cell surface marker; FcεR1: high-affinity IgE receptor, a mast cell surface marker; CRLR: calcitonin receptor-like receptor; RAMP1: receptor activity-modifying protein 1; CGRP: calcitonin gene-related peptide; Il-5: interleukin-5; Il-13: interleukin-13.

[0033] express P <0.05, express P <0.001.

[0034] Figure 5 Schematic diagram of the cAMP-PKA-pCREB signaling pathway downstream of CGRP activation in mast cells; The left figure is a schematic diagram of the protein expression level of pCREB in BMMCs; The figure on the right is the corresponding statistical diagram.

[0035] In the figure, pCREB: phosphorylated cyclic AMP response element binding protein; β-actin: β-actin; kDa: kilodalton, molecular weight unit; CGRP: calcitonin gene-related peptide.

[0036] express P <0.05.

[0037] Figure 6Schematic diagram of the ECRS modeling scheme; A is a schematic diagram of the modeling scheme for eosinophilic chronic rhinosinusitis (ECRS) using papain; B: Mast cell-deficient mice adoptively transferred WT or CRLR - / + Schematic diagram of the ECRS modeling protocol using mouse-derived BMMCs and Papain; C: Schematic diagram of the ECRS modeling scheme in which WT mice were pretreated with the CGRP receptor small molecule antagonist Olcegepant and then treated with Papain.

[0038] In the figure, Papain: papain; CRLR: calcitonin receptor-like receptor; BMMCs: bone marrow-derived mast cells; Olcegepant: selective non-peptide antagonist of the calcitonin gene-related peptide (CGRP) receptor.

[0039] Figure 7 Schematic diagram of mouse head section staining and mouse nasal mucosal tissue mRNA expression levels Among them, A is a schematic diagram of HE staining of mouse head sections (left) and the corresponding statistical graph (right); B is a schematic diagram of PAS staining of mouse head sections (left) and the corresponding statistical graph (right); C is a schematic diagram of RT-PCR detection of type 2 inflammatory factors Il-5 and Il-13 mRNA expression levels in mouse nasal mucosal tissue; In the figure, Papain: papain; WT: wild-type mouse; CRLR: calcitonin receptor-like receptor; BMMCs: bone marrow-derived mast cells; Il-5: interleukin-5; Il-13: interleukin-13.

[0040] express P <0.05, express P <0.01, express P <0.001.

[0041] Figure 8 Schematic diagram of mouse head section staining and mRNA expression levels in mouse nasal mucosa tissue; Among them, A is a schematic diagram of HE staining of mouse head sections (left) and the corresponding statistical graph (right); B is a schematic diagram of PAS staining of mouse head sections (left) and the corresponding statistical graph (right); C is a schematic diagram of RT-PCR detection of the mRNA expression levels of type 2 inflammatory factors Il-5 and Il-13 in mouse nasal mucosal tissue.

[0042] In the figure, Papain: papain; Olcegepant: selective non-peptide antagonist of calcitonin gene-related peptide (CGRP) receptor; Il-5: interleukin-5; Il-13: interleukin-13; express P <0.05, express P <0.01. DETAILED DESCRIPTION

[0043] The present invention is further described in detail below with reference to specific embodiments so that those skilled in the art can understand.

[0044] Description of the research subjects, sample collection and sources in the following examples 1. The research subjects are divided into: ① Normal control group, patients who underwent decompression surgery for simple sinus cysts, nasal tumors, or traumatic optic nerve injury, and the ethmoid sinus mucosa without obvious inflammation was collected during the surgery; ② In the eosinophilic CRSwNP group, the eosinophil count in the nasal polyp tissue was greater than 10% of the total inflammatory cells, and the resected nasal polyp tissue was collected during surgery; In the non-eosinophilic CRSwNP group, the eosinophil count in nasal polyp tissue was less than 10% of the total inflammatory cell count, and resected nasal polyp tissue was collected during surgery. All subjects had not used systemic or topical glucocorticoids or leukotriene receptor antagonists within one month before surgery. None of the subjects received immunotherapy. Patients with choanal polyps, fungal sinusitis, cystic fibrosis, primary ciliary dyskinesia, immunodeficiency, systemic vasculitis, IgG4-related disease, acute upper respiratory tract infection or asthma exacerbation within 4 weeks, and other nasal diseases were excluded. Concomitant allergic rhinitis was diagnosed according to the ARIA criteria (Brozek JL, et al. Journal of Allergy and Clinical Immunology 2017;140:950-8); asthma was diagnosed according to the GINA criteria (https: / / ginasthma.org / ).

[0045] Example 1 Nasal mucosal histopathology and immunofluorescence staining During surgery, samples of ethmoid sinus mucosa from a control group and nasal polyps from patients with Eos CRSwNP (eosinophilic chronic sinusitis with nasal polyps) and non-Eos CRSwNP (non-eosinophilic chronic sinusitis with nasal polyps) were collected. The tissues were fixed by completely immersing them in an appropriate volume of 4% universal tissue paraformaldehyde solution. After 24 hours, the tissues were embedded in paraffin and sections approximately 4 μm thick were prepared.

[0046] Immunofluorescence staining was used to identify the expression of PGP9.5. + The expression distribution of PNEC in nasal mucosa tissues of each group ( Figure 1 A); Immunofluorescence colocalization was used to study the colocalization of PGP9.5 and CGRP in nasal mucosal epithelial tissue ( Figure 1 E) and the expression distribution of CGRP receptor subunits CRLR and RAMP1 in mast cells ( Figure 3 A).

[0047] The results showed that PNECs were scattered along the nasal epithelium and significantly increased in the EosCRSwNP group ( Figure 1 A); CGRP and PGP9.5 are co-localized in nasal mucosal epithelial tissue ( Figure 1 E), that is, CGRP mainly comes from PNEC; mast cells and their surface CGRP receptor subunits CRLR and RAMP1 are co-localized ( Figure 3 A).

[0048] Example 2 Detection of Neuropeptides in Nasal Mucosa Tissue 1) RT-PCR detection of neuropeptide expression in nasal mucosal tissue: During surgery, the ethmoid sinus mucosa of the normal control group, nasal polyps of Eos CRSwNP and Non-Eos CRSwNP patients were collected, and total RNA was extracted. RT-PCR was used to verify the expression of the PNEC lineage-determining transcription factor ASCL1 and the neuropeptide CGRP (encoding gene) in a large sample. CALCA ) mRNA expression levels ( Figure 1 B); 2) Analyze the correlation between the mRNA expression levels of ASCL1 and CALCA in patients with CRSwNP and the mRNA expression levels of type 2 inflammatory factors IL-5 and IL-13 ( Figure 2 ).

[0049] The results showed that the PNEC lineage-determining transcription factor ASCL1 and the neuropeptide CGRP (encoding gene CALCA ) mRNA expression levels were significantly increased in the EosCRSwNP group ( Figure 1B and C); The mRNA expression levels of ASCL1 and CALCA were positively correlated with the mRNA expression levels of IL-5 and IL-13 in tissues ( Figure 2 ).

[0050] Example 3 Regulatory Effects of CGRP on Bone Marrow-Derived Mast Cells 1) Culture of mouse bone marrow-derived mast cells: Mouse bone marrow-derived mast cells (BMMCs) were generated and cultured from wild-type C57BL / 6J mice. Specific culture protocol: BMMCs were collected from the femoral and tibial bone marrow of C57BL / 6J mice and cultured in RIPM 1640 medium supplemented with 10% fetal bovine serum, 100 U / mL penicillin, 100 μg / mL streptomycin, 50 μmol / L β-mercaptoethanol, 10 ng / mL mouse recombinant IL-3, and 20 ng / mL mouse recombinant stem cell factor (SCF) for 6-10 weeks with weekly medium changes. BMMCs were identified as mature by flow cytometry for the co-expression of c-Kit and FcεRI. Only BMMCs with a purity exceeding 90% were used in subsequent cell stimulation experiments.

[0051] 2) Using the method described in 1) above, when BMMCs were cultured to week 9 and the purity of mature MCs was greater than 90% as determined by flow cytometry, BMMCs were stimulated with 1 μM CGRP for 6 hours, and BMMCs were collected for quantitative RT-PCR to detect the mRNA expression levels of Il-5 and Il-13 ( Figure 4 C). After BMMCs were stimulated with 1uM CGRP for 2 hours, the cell culture supernatant was extracted and the level of β-hexosaminidokinase was detected by ELISA ( Figure 4 B).

[0052] Results showed that CGRP promoted mast cell degranulation ( Figure 4 B) and type 2 inflammatory cytokines ( Figure 4 C).

[0053] Example 4 A method for preparing a pharmaceutical preparation (spray preparation) for treating eosinophilic chronic sinusitis with nasal polyps comprises the following steps: ① Weigh the CGRP receptor small molecule antagonist Olcegepant (purity ≥98%, Olcegepant (BIBN-4096) is a potent and selective calcitonin gene-related peptide 1 (CGRP1) receptor antagonist, purchased from MedChemExpress (MCE), catalog number HY-10095, website: https: / / www.medchemexpress.cn / Olcegepant.html) and dissolve it in normal saline (pH 6.5-7.5) at a concentration of 3 μM. ②Add vitamin C (0.1% w / v) as an antioxidant and stir until completely dissolved; ③ Sterilize by filtering through a 0.22 μm sterile filter membrane and dispense into a high-pressure spray device, 10 mL per bottle; thus, the pharmaceutical preparation is obtained.

[0054] After sealing, the above-mentioned drug preparations shall undergo sterility testing (which must comply with the sterility testing method of the 2025 edition of the Chinese Pharmacopoeia) and CGRP antagonist concentration testing (HPLC method, deviation ≤±5%). The quality control standards are as follows: ① pH value: 6.5-7.5 (pH value determination method of the 2025 edition of the Chinese Pharmacopoeia); ② Sterility: Must pass sterility test (no bacterial or fungal growth); ③Main drug content: CGRP receptor small molecule antagonist concentration is 3μM±0.15μM (HPLC method); ④Stability: After 6 months of storage at room temperature (25°C), the degradation rate of the main drug is ≤5% (verified by accelerated test).

[0055] Example 4 Adoptive transfer of mast cell-deficient mice CRLR - / + Study on an animal model of mouse-derived BMMCs and a drug preparation containing a small molecule antagonist of the CGRP receptor to inhibit eosinophilic inflammation of the nasal mucosa 1) Establishment of a papain-induced eosinophilic chronic sinusitis mouse model: ① Based on previous studies (Wang WQ, et al. Nat Immunol 23(10):1484-1494), a papain-induced eosinophilic chronic sinusitis mouse model was constructed as follows: On days 0, 1, and 2, 20 μL of 2 mg / mL Papain was instilled into each nostril. No treatment was given on days 3-6. On days 7-11, 20 μL of 2 mg / mL Papain was instilled into each nostril. Mice were killed on day 12. Figure 6 A).

[0056] ② Adoptive transfer of mast cell-deficient mice: To demonstrate the importance of mast cells, Kit w-sh / w-sh BMMCs were adopted and transferred into mice. CRLR - / + BMMCs were obtained from mice and cultured in vitro. After BMMCs matured, 10^6 cells were adoptively transferred into the basal tissue culture medium in a volume of 200 μL via tail vein injection. Kit w-sh / w-sh Mice were treated with papain 48 hours after adoptive transfer of BMMCs. Figure 6 B).

[0057] ③ Pretreatment of the drug preparation prepared in Example 4: When the mice were subjected to ECRS modeling, 20 μL of the drug preparation was instilled into each nostril every day starting three days in advance (day 0-2). Papain modeling was also performed on the fourth day, and continued until the 15th day (day 14). The mice were killed on the 16th day ( Figure 6 C).

[0058] 2) Sampling and Testing: After mice were deeply anesthetized, nasal lavage fluid was obtained and stored at -80°C. After sacrifice, the head was separated, and the skin and soft tissue were removed. A coronal incision was made 1 mm behind the eyes, and the nasal cavity and sinus sections were isolated. The sections were decalcified, fixed, and embedded in paraffin. Serial coronal sections were made at 4 μm thickness. Alternatively, the nasal cavity and sinus mucosa were obtained by microscopic dissection and stored at -80°C. The following studies were then performed: ① Histomorphological observation: HE and PAS staining were used to observe eosinophil infiltration and goblet cell metaplasia in the nasal mucosa of mice ( Figure 7 A and B; Figure 8 A and B); ②RT-PCR was performed using the following primer pairs to detect the mRNA expression levels of Il-5 and Il-13 in mouse nasal mucosal tissues ( Figure 7 C; Figure 8 C); the primer pair sequences are as follows: house mouse Il-5-F:TCAGGGGCTAGACATACTGAAG, house mouse Il-5-R: CCAAGGAACTCTTGCAGGTAAT; house mouse Il-13-F:TGAGCAACATCACACAAGACC, house mouse Il-13-R: GGCCTTGCGGTTACAGAGG.

[0059] The results showed that adoptive transfer CRLR - / + Mast cell-deficient mice derived from mouse BMMCs showed reduced eosinophilic inflammation in the nasal mucosa, as evidenced by decreased eosinophil numbers, reduced goblet cell metaplasia, and suppressed mRNA expression of type 2 inflammatory factors Il-5 and Il-13 ( Figure 7 Olcegepant-containing drug formulations administered intranasally can reduce eosinophilic inflammation in the nasal mucosa of mice, as evidenced by a decrease in the number of eosinophils, reduced goblet cell metaplasia, and suppressed mRNA expression of Il-5 and Il-13 in tissues ( Figure 8 ).

[0060] Although the above embodiments have been described in detail, they are only a part of the embodiments of the present invention, not all of them. People can also obtain other embodiments based on this embodiment without inventiveness, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. Use of a small molecule CGRP receptor antagonist in the preparation of a medicament for treating eosinophilic chronic sinusitis with nasal polyps; characterized in that: The CGRP receptor small molecule antagonist is a small molecule compound that binds to the CGRP receptor CRLR.

2. The use according to claim 1, characterized in that: The CGRP receptor small molecule antagonist has a molecular weight of ≤1000 Da.

3. The use according to claim 2, characterized in that: The CGRP receptor small molecule antagonist is Olcegepant.

4. A pharmaceutical preparation for treating eosinophilic chronic sinusitis with nasal polyps, characterized by: It comprises an effective amount of the CGRP receptor small molecule antagonist according to any one of claims 1 to 3.

5. The pharmaceutical preparation for treating eosinophilic chronic sinusitis with nasal polyps according to claim 4, characterized in that: In the pharmaceutical preparation, the effective concentration of the CGRP receptor small molecule antagonist is 2-5 μM.

6. The pharmaceutical preparation according to claim 5, characterized in that: In the pharmaceutical preparation, the effective concentration of the CGRP receptor small molecule antagonist is 3 μM.

7. The pharmaceutical preparation according to claim 5 or 6, characterized in that: It also includes pharmaceutically acceptable excipients.

8. The pharmaceutical preparation for treating eosinophilic chronic sinusitis with nasal polyps according to claim 7, characterized in that: The auxiliary material is any one of physiological saline, glucose, vitamin C and amino acid.

9. The pharmaceutical preparation for treating eosinophilic chronic sinusitis with nasal polyps according to claim 8, characterized in that: The pharmaceutical preparation is a spray preparation, nasal drops or irrigating agent.

10. The pharmaceutical preparation for treating eosinophilic chronic sinusitis with nasal polyps according to claim 9, characterized in that: The spray preparation is any one of an atomizer, a spray and a suspension.

Images