Castration PapMV virus-like particle subunit vaccine and preparation method thereof

CN120769868APending Publication Date: 2025-10-10SHENZHEN HERZ LIFE SCI TECH CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202480015550.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2023-03-21
Filing Date
2024-02-23
Publication Date
2025-10-10

AI Technical Summary

Technical Problem

The existing technology has not yet provided a castrated PapMV virus-like particle subunit vaccine that is easy to be industrially produced, has strong immunogenicity, and has a fast immune response. In particular, no method for constructing a GnRH castrate vaccine using PapMV protein has been reported.

Method used

By constructing the GnRH-VLP recombinant protein, combining GnRH and papaya mosaic virus capsid protein, using nucleic acid and expression vector technology to express GnRH-PapMV virus-like particles in host cells, and using chemical coupling methods to obtain the recombinant protein, forming GnRH- I-PapMV virus-like particles for vaccine preparation.

Benefits of technology

It achieves efficient induction of specific antibody responses, significantly reduces testosterone levels and testicular volume, is suitable for animal castration, and has a simple production process and high purity, making it suitable for industrial production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000022_0000
    Figure 00000022_0000
  • Figure 00000022_0001
    Figure 00000022_0001
  • Figure 00000023_0000
    Figure 00000023_0000
Patent Text Reader

Abstract

Relates to the technical field of biology, in particular to a castrated PapMV virus-like particle subunit vaccine and a preparation method thereof. The invention provides the GnRH-I-PapMV recombinant protein which is high in purity and good in specificity. The vaccine prepared from the GnRH-I-PapMV recombinant protein is high in antigen purity, good in safety and good in castration effect.
Need to check novelty before this filing date? Find Prior Art

Description

Castration-resistant PapMV virus-like particle subunit vaccine and preparation method thereof

[0001] This application claims priority to the Chinese patent application filed with the China Patent Office on March 21, 2023, with application number 202310317333.6 and invention name “GnRH-VLP recombinant castration vaccine and its preparation method”, the entire contents of which are incorporated by reference into this application. Technical Field

[0002] The present invention relates to the field of biotechnology, in particular to a castrated PapMV virus-like particle subunit vaccine and a preparation method thereof. Background Art

[0003] Castration is the indirect removal of an animal's reproductive system or the resulting loss of sexual function. This includes the removal of the testes in males and the ovaries in females, collectively known as gonadectomy. In addition to surgical removal of the gonads, local radiation exposure and chemical treatment can also be used for castration. Castration deprives vertebrates of their source of sex hormones, which can sometimes lead to the degeneration of genital appendages and secondary and tertiary sexual characteristics.

[0004] Gonadotropin-releasing hormone (GnRH) is an endogenous polypeptide hormone in animals. Physiological doses of GnRH-I can increase gonadotropin concentrations (e.g., a mild increase in FSH and a significant increase in LH), promote the synthesis and secretion of gonadal hormones (e.g., estradiol, progesterone, and testosterone), and promote follicular maturation and ovulation, testicular development and sperm maturation, and the development and maintenance of secondary sexual characteristics. Furthermore, GnRH-I can directly affect the gonads, regulating the synthesis and secretion of gonadal steroid hormones and promoting gamete formation.

[0005] Self-antigen proteins are often difficult to elicit antibody responses against. One approach to improving vaccination efficacy is to increase the reproducibility of the applied antigens. Unlike isolated proteins, viruses can induce rapid and potent immune responses, both with and without T cell help, without any adjuvants. Compared to a few proteins, they can trigger immune responses far more robust than their isolated components. With respect to B cell responses, it is well known that a key factor in viral immunogenicity is the reproducibility and order of surface epitopes. Many viruses exhibit quasi-crystalline surfaces with regularly arranged epitopes that efficiently crosslink epitope-specific immunoglobulins on B cells. This crosslinking of B cell surface immunoglobulins is a strong activation signal, directly inducing cell cycle progression and IgM antibody production. Furthermore, this triggered B cell activation can activate T helper cells, in turn inducing the conversion of IgM to IgG antibodies in B cells and the generation of long-lived B cell memory targets for any vaccination. Viral structure has even been implicated in the production of anti-antibodies in autoimmune diseases and is part of the natural response to pathogens. Therefore, antigens presented on highly organized viral surfaces can induce strong antibody responses against these antigens.

[0006] Virus-like particles are the main capsid protein of an RNA bacteriophage. They are self-assembled from multiple monomers into a new type of highly immunogenic virus-like particles (VLPs). These VLPs do not contain the phage RNA genome and cannot replicate. However, studies have found that a variety of polypeptides can be fused to the N- or C-terminus of the virus-like particle protein, and the resulting fusion protein forms virus-like particles when expressed in a host, typically and preferably in Escherichia coli. In addition, it has been found that if the polypeptide contains at least one antigen, the antigen or at least one antigenic site of the antigen is displayed on the outer surface of the assembled VLP, the assembled VLP can effectively improve the immunogenicity of the target antigen. In addition to the virus-like particles AP205 and Qβ that have been reported, there are also a variety of VLP platforms such as CuMV and tobacco mosaic virus VLP, all of which have the potential to be developed into castration vaccines.

[0007] Papaya mosaic virus (PapMV) is a member of the Flexiviridae family of the genus Potexvirus in the family Potexviridae. The virus is a curved rod-shaped virus with a length of 500 nm and a diameter of 13 nm. The capsid protein CP is composed of 215 amino acids with a molecular weight of approximately 23 kDa. Studies have shown that non-infectious nanoparticles made from recombinant PapMV CP are similar in shape and appearance to wild-type virus purified from plants. The PapMV vaccine platform has been used in vaccine platform technology to enhance the immunogenicity of peptide antigens fused to the nanoparticle structure because it can induce a long-lasting memory response to antigens fused to its surface. However, there are no reports in the prior art on how to use PapMV protein to construct a GnRH castration vaccine.

[0008] Summary of the Invention

[0009] In view of this, the technical problem to be solved by the present invention is to provide a castrated PapMV virus-like particle subunit vaccine and a preparation method thereof, which is easy to obtain through bacterial culture, has a high expression yield, is convenient for industrial production, has strong immunogenicity and a fast immune response.

[0010] The present invention provides a GnRH-VLP recombinant protein, GnRH-PapMV, which comprises GnRH and the capsid protein of papaya mosaic virus.

[0011] The GnRH has an amino acid sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2, or a sequence in which one or more amino acids are substituted, deleted, added and / or replaced based on the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2; or a sequence with more than 90% homology to the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2.

[0012] The capsid protein of the papaya mosaic virus (PapMV) has the amino acid sequence shown in SEQ ID NO: 5, or a sequence in which one or more amino acids are substituted, deleted, added and / or replaced based on the amino acid sequence shown in SEQ ID NO: 5; or a sequence with a homology of more than 90% to the amino acid sequence shown in SEQ ID NO: 5.

[0013] In some embodiments, the C-terminus of GnRH in the GnRH-VLP recombinant protein provided by the present invention is coupled to the N-terminus of the papaya mosaic virus capsid protein.

[0014] The present invention also provides:

[0015] 1), a nucleic acid encoding the GnRH-VLP recombinant protein;

[0016] II), an expression unit containing a nucleic acid encoding GnRH-VLP;

[0017] III), a recombinant vector containing a nucleic acid encoding GnRH-VLP or an expression unit as described above;

[0018] IV), transforming or transfecting host cells with an expression vector for GnRH-VLP;

[0019] V) The culture product of the host cells as described above.

[0020] The nucleic acid can be DNA, RNA, cDNA or PNA. The DNA form includes cDNA, genomic DNA or artificially synthesized DNA. The DNA can be single-stranded or double-stranded. The nucleic acid can include nucleotide sequences with different functions, such as coding regions and non-coding regions such as regulatory sequences (such as promoters or transcription terminators). The nucleic acid can be linear or circular in topology. The nucleic acid can be, for example, a part of a vector (such as an expression or cloning vector), or a fragment. The nucleic acid can be obtained directly from a natural source, or can be prepared with the assistance of recombination, enzymatic methods or chemical techniques. The RNA form is mRNA obtained by gene transcription, etc. The gene sequence can use a wild-type sequence or can be codon-optimized, which is not limited by the present invention. The nucleic acids of the present invention encode GNRH and PapMV respectively. The nucleic acid encoding PapMV is a nucleic acid encoding the full length or partial fragment of PapMV.

[0021] The expression units provided by the present invention include GNRH and PapMV. The expression units include the nucleic acid of the present invention in a single or multiple tandem form with a promoter and a terminator, which are not limited in the present invention.

[0022] Furthermore, the recombinant expression vector herein refers to a nucleic acid vector, a recombinant DNA molecule comprising a desired coding sequence and appropriate nucleic acid sequences or elements necessary for expression of the operably linked coding gene in a specific host organism. Nucleic acid sequences or elements necessary for expression in bacteria include promoters, ribosome binding sites, and possibly other sequences. The recombinant expression vector is selected based on the host organism. The expression vector described in the present invention can be circular or linear, and this is not a limitation of the present invention. For example, a prokaryotic host can be Escherichia coli, Bacillus, Streptomyces, or cyanobacteria; its backbone vector can be a pET series plasmid, a pGEX series plasmid, a pKBP series plasmid, or a pcDNA series plasmid. For example, the recombinant backbone vector is a pET series vector, and optionally, the backbone vector of the recombinant vector is pET-21(+), pET-24(+), pET-23(+), or pET-28a(+).

[0023] The construction of the recombinant vector provided by the present invention includes cloning the nucleic acid fragment encoding the fusion protein as described above into an expression vector by homologous recombination. In some embodiments, the present invention provides a recombinant plasmid PapMV-pET28a, which is obtained by cloning the nucleotide sequence shown in SEQ ID NO. 2 into the NdeI and XhoI sites of the prokaryotic expression vector pET28a by homologous recombination. In other embodiments, the present invention provides a recombinant plasmid GnRH-I-pcDNA3.1, which is obtained by cloning the nucleotide sequence shown in SEQ ID NO. 3 into the HindIII and EcoRI sites of the eukaryotic expression vector pcDNA3.1 by homologous recombination.

[0024] Furthermore, the present invention also provides a host cell transformed or transfected with the aforementioned recombinant vector, or with the aforementioned nucleic acid integrated into its genome.

[0025] The host described in the present invention includes bacteria, fungi, viruses or animals. The bacteria include Gram-positive bacteria and Gram-negative bacteria; the Gram-positive bacteria include but are not limited to Escherichia coli. The fungi include molds, yeasts, and mushrooms; the yeasts include Saccharomyces cerevisiae, Saccharomyces cerevisiae, Pichia pastoris, and Candida. The viruses include but are not limited to adenoviruses, adeno-associated viruses, lentiviruses, and prions. The animals include humans, mice, rabbits, pigs, zebrafish, and the like. The expression of the nucleic acid encoding the recombinant protein in the host can be either integrated or episomal, and the present invention does not limit this. In the embodiment of the present invention, PapMV is expressed using Escherichia coli C2566H as the host, and GnRH-I is expressed using eukaryotic cells HEK293f as the host.

[0026] Furthermore, the present invention also provides a culture product of the host cell.

[0027] The method for preparing the GnRH-PapMV recombinant protein of the present invention comprises: culturing the host cell as described above to obtain a culture product containing the recombinant protein;

[0028] Alternatively, the method comprises preparing GnRH-I protein and PapMV separately, and obtaining the recombinant protein through coupling.

[0029] As described above, the method for preparing the fusion protein includes:

[0030] GnRH-I protein and PapMV protein were prepared separately, and fusion protein was obtained by coupling.

[0031] Or include:

[0032] (1) The 10-peptide gene fragment of GnRH-I was directly synthesized and cloned into the pcDNA3.1 eukaryotic expression vector to obtain the positive recombinant plasmid GnRH-I-pcDNA3.1, which was expressed in HEK293f cells and purified to obtain the GnRH-I recombinant protein;

[0033] (2) The papaya mosaic virus capsid protein gene (GenBank: 1494025) was cloned into the prokaryotic expression vector pET28a to obtain the recombinant expression vector PapMV-pET28a, and the recombinant expression vector was transformed into the Escherichia coli C2566H expression strain to express the PapMV recombinant protein;

[0034] (3) GnRH-I protein and PapMV protein were coupled by chemical coupling method to obtain GnRH-I-PapMV virus-like particles.

[0035] As a preferred embodiment of the preparation method of recombinant HEK293f expressing GnRH-I recombinant protein, the eukaryotic expression vector is pcDNA3.1.

[0036] As a preferred embodiment of the method for preparing PapMV virus-like particles expressed by recombinant Escherichia coli, the prokaryotic expression vector is pET28a.

[0037] As a preferred embodiment of the method for preparing recombinant PapMV virus-like particles, the recombinant expression strain PapMV-pET28a-C2566H is cultured to an OD of 600 When the expression level reaches 0.8-1.0, IPTG with a final concentration of 1 mM is added to induce expression.

[0038] Furthermore, the fusion protein, the nucleic acid, the expression unit, the recombinant vector, the host cell, the culture product or the composition of the present invention are used in the preparation of subunit vaccines.

[0039] The present invention also provides a vaccine containing GnRH-VLP. Specifically, the present invention provides a castration PapMV virus-like particle subunit vaccine, which includes the recombinant protein as described above. The vaccine is a castration vaccine for male animals. The male animals are animals that can be castrated, including birds and mammals. For example, mice, rats, cats, dogs, horses, or animals of the same family and genus as the above animals. Preferably, they are felines, canines, or rodents, such as mice. The vaccine also includes an adjuvant. The adjuvant includes an aluminum salt adjuvant, a protein adjuvant, a nucleic acid adjuvant, a lipid-containing adjuvant, a mixed adjuvant, or an aggregate structure adjuvant. In some embodiments of the present invention, the adjuvant is an aluminum hydroxide adjuvant. In the GnRH-VLP vaccine of the present invention, the adjuvant is not limited. In some embodiments, the GnRH-VLP vaccine is prepared using an aluminum adjuvant. The concentration of GnRH-VLP in the vaccine is 800, 400, 200, or 100 μg / mL, preferably, the concentration is 400 μg / mL.

[0040] Furthermore, the method for preparing the subunit vaccine comprises mixing the recombinant protein with an adjuvant; or mixing the composition with a buffer solution. Preferably, the volume ratio of the mixture is 1:1.

[0041] Immunizing animals with the vaccine of the present invention can achieve the effect of castration. Therefore, the present invention also provides the use of the above-mentioned vaccine in animal castration. Correspondingly, the present invention also provides the use of the above-mentioned vaccine in animal castration. Correspondingly, the present invention also provides a method for castrating animals, comprising administering the vaccine as described above. In the present invention, the castration includes increasing the level of GnRH antibodies, reducing the level of testosterone, reducing the volume and / or weight of the testicles, and preventing animal pregnancy. In the present invention, the dosage administered is 200 μg. 10 to 100 days after immunization, the anti-GnRH recombinant protein antibody titer and testosterone level decreased.

[0042] In some tests, testosterone levels are reduced to 50% to 90% of the original level, specifically 50% to 70%, 60% to 80%, 70% to 90%, and more specifically 50% to 60%, 60% to 70%, 70% to 80%, or 80% to 90%. In a specific embodiment, testosterone levels are reduced to 3.11% of the original level.

[0043] In some tests, the testicular weight of mice was reduced to 50% to 90% of the original level, specifically 50% to 70%, 60% to 80%, 70% to 90%, and more specifically 50% to 60%, 60% to 70%, 70% to 80%, or 80% to 90%. In a specific embodiment, the testicular weight of mice was reduced to 20.15% of the original level.

[0044] In some tests, the cat's testicular volume is reduced to 50% to 90% of its original level, specifically 50% to 70%, 60% to 80%, 70% to 90%, more specifically 50% to 60%, 60% to 70%, 70% to 80%, 80% to 90%. In a specific embodiment, the cat's testicular volume is reduced to 94.56% of its original level.

[0045] The beneficial effects of the present invention are as follows:

[0046] First, PapMV is a papaya mosaic virus. The viral capsid protein has the ability to self-assemble into nanoparticles. It is non-infectious and has strong antigenic immunity.

[0047] Second, the antigen expressed in tandem with the PapMV virus-like particles showed high antigenicity, inducing high levels of specific antibodies in mice, rats, cats, dogs, and horses, and a rapid humoral immune response;

[0048] Third, the GnRH-I-PapMV virus-like particles of the present invention are expressed in large quantities by HEK293f cells and Escherichia coli, the production process is simple, and the GnRH-I-PapMV virus-like particles are of high purity;

[0049] Fourth, the GnRH-I protein of the present invention is suitable for vaccine preparation: The 293f recombinant expression cell line selected in the present invention provides a eukaryotic expression environment, overcoming the potential for protein misfolding and loss of function in E. coli-expressed proteins due to the lack of specialized cofactors, molecular chaperones, and post-translational modifications. These factors disrupt protein-protein interactions within eukaryotic multi-subunit complexes, surface receptors, and secreted proteins. 293F cells are a suspension cell culture-adapted cell line derived from HEK293 cells. Expression is achieved by transient transfection of cells using an inexpensive reagent formulated with branched PEI via endocytosis. This method is suitable for both small-scale (30 mL) and large-scale (300 mL) cell transfections, yielding high yields of purified protein.

[0050] Fifth, PapMV virus-like particles are connected to GnRH-I protein in vitro. The conditions are easy to control, the connection efficiency is high, the yield is higher than that of chimeric expression, it is easy to operate, and it is convenient for industrial production. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for the embodiments or the description of the prior art. Obviously, the drawings described below are only exemplary. Those skilled in the art can derive other implementation drawings based on the provided drawings without inventive effort.

[0052] FIG1 is a schematic diagram of a recombinant plasmid after the GnRH-I gene provided in an embodiment of the present invention is connected to the pcDNA3.1 plasmid;

[0053] FIG2 is a schematic diagram of the recombinant plasmid after the PapMV gene provided in an embodiment of the present invention is connected to the pET28a plasmid;

[0054] FIG3 is a schematic diagram of SDS-PAGE of GnRH-I-PapMV virus-like particle protein provided in an embodiment of the present invention;

[0055] Figure 4 shows the testosterone levels in mice after immunization;

[0056] Figure 5 shows the average testicular weight of mice;

[0057] Figure 6 shows the changes in testicular volume in male cats. DETAILED DESCRIPTION

[0058] To make the above-mentioned objects, features, and advantages of the present invention more readily apparent, specific embodiments of the present invention are described in detail below with reference to the accompanying drawings. The following description sets forth numerous specific details to facilitate a full understanding of the present invention. However, the present invention can be implemented in many other ways than those described herein, and those skilled in the art may make similar modifications without departing from the scope of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below.

[0059] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present invention pertains. The terms used herein in the specification of the present invention are for the purpose of describing specific embodiments only and are not intended to limit the present invention. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.

[0060] The molecular biology experimental methods used in the examples of the present invention, such as enzyme digestion and homologous recombination ligation, can be found in the second edition of Molecular Cloning. The basic materials for preparing the GnRH-I-PapMV virus-like particles of the present invention include: the PapMV protein nucleotide sequence (GenBank: 1494025), the GNRH-I nucleotide sequence (SEQ ID NO. 3 and SEQ ID NO. 4), the pET28a plasmid, the pcDNA3.1 plasmid, the C2566H Escherichia coli strain, the Tiangen Plasmid Miniprep Kit, LB medium, IPTG, kanamycin, a nickel column, and imidazole. The nucleotide sequences were sent to BGI for synthesis of the GnRH-I-pcDNA3.1 and PapMV-pET28a recombinant plasmids.

[0061] The present invention provides a GnRH-I-PapMV recombinant protein. First, the GnRH-I gene is expressed in eukaryotic HEK293f cells using the pcDNA3.1 vector. The papaya mosaic virus capsid protein gene (GenBank: 1494025) is cloned into the prokaryotic expression vector pET28a to obtain a recombinant expression vector. The recombinant expression vector is transformed into an Escherichia coli C2566H expression strain, and the transformed E. coli C2566H strain expresses the protein. Next, the GnRH-I protein and the PapMV protein are coupled using a chemical coupling method to obtain GnRH-I-PapMV virus-like particles for preparing a GnRH-I-PapMV subunit vaccine. The amino acid sequence of the PapMV is shown in SEQ ID NO. 1.

[0062] The sequences involved in the present invention include:

[0063] GnRH is also referred to herein as GnRH-I, and its amino acid sequence is:

[0064] QHWSYGLRPG (SEQ ID NO: 1, denoted as GnRH-I Q )

[0065] or EHWSYGLRPG (SEQ ID NO: 2, denoted as GnRH-I E )

[0066] The nucleic acid sequence encoding GnRH-1 is:

[0067] CAACACTGGAGCTACGGTTTGAGACCCGGT (SEQ ID NO.3, encoding GnRH-I Q );

[0068] or GAACACTGGAGCTACGGTTTGAGACCCGGT (SEQ ID NO. 4, encoding GnRH-IE )

[0069] PapMV amino acid sequence:

[0070] Nucleic acid sequence encoding PapMV:

[0071] The test materials used in the present invention are all common commercial products and can be purchased on the market. The present invention is further described below with reference to the following examples:

[0072] Example 1

[0073] Provided is a PapMV virus-like particle. The virus-like particle is obtained by expressing a PapMV-pET28a recombinant plasmid formed by connecting a cucumber mosaic virus PapMV gene with a pET28a plasmid through an expression strain.

[0074] Specifically, the papaya mosaic virus (PapMV) gene was directly synthesized by BGI between the NdeI and XhoI sites of the pET28a vector to generate the recombinant plasmid PapMV-pET28a. The expression strain used was the Escherichia coli C2566H expression strain. The PapMV-pET28a-C2566H recombinant expression strain was selected using 50 μg / ml of kanamycin.

[0075] The above-mentioned method for preparing PapMV virus-like particles comprises the following steps:

[0076] (1) Construction of recombinant plasmid: PapMV gene was ligated with pET28a plasmid to construct PapMV-pET28a recombinant plasmid;

[0077] (2) Transforming the recombinant plasmid into an expression strain: The PapMV-pET28a recombinant plasmid was transformed into the Escherichia coli C2566H expression strain to obtain the recombinant expression strain PapMV-pET28a-C2566H;

[0078] (3) Bacterial culture and purification of CMV virus-like particles: The recombinant expression strain PapMV-pET28a-C2566H was cultured, and the biomass was separated by centrifugation to obtain PapMV virus-like particles.

[0079] Specifically, the steps of plasmid sequencing and extraction are as follows:

[0080] (a1) Use a pipette to inoculate 5 μL of the glycerol stock containing the plasmid into 5 mL of 2YT medium (containing 50 μg / mL kanamycin). Incubate with shaking at 37°C for 14-16 hours. Make a replicate (send the replicates to a sequencing company for sequencing).

[0081] (a2) Centrifuge one of the tubes at 10,000 × g for 1 min at room temperature to collect the cells and remove as much of the supernatant as possible.

[0082] (a3) Add 250 μl of Buffer A1 (make sure RNase A is added) and thoroughly resuspend the bacterial cells by pipetting or vortexing.

[0083] (a4) Add 250 μl of Buffer B1, gently invert 5-10 times to mix, and let stand for 2-5 minutes until the solution becomes viscous and clear.

[0084] (a5) Add 350 μl of Buffer N1 and immediately invert several times until the solution is thoroughly mixed and a white flocculent precipitate appears.

[0085] (a6) Transfer the centrifuge tube to a high-speed centrifuge and centrifuge at 13,000 rpm for 10 min at room temperature (if there is a white precipitate in the supernatant, centrifuge again);

[0086] (a7) Add 500 μl DNA Wash Buffer (make sure anhydrous ethanol has been added) to the spin column. Centrifuge at 13,000 rpm for 1 min at room temperature. Discard the waste liquid from the collection tube and return the spin column to the collection tube.

[0087] (a8) Place the spin column back into the high-speed centrifuge and centrifuge with the lid open at 13,000 rpm at room temperature for 2 min to completely remove any residual ethanol.

[0088] (a9) Transfer the spin column to a new 1.5 mL centrifuge tube. Add 50–100 μl (volume > 50 μl) of ddH2O (pH 7.0–8.5) or Elution Buffer to the center of the DNA column. Incubate at room temperature for 2 minutes. Centrifuge at 13,000 rpm for 1 minute to elute the plasmid DNA.

[0089] The sequencing feedback results are correct.

[0090] Specifically, the steps for transforming C2566H competent cells are as follows:

[0091] (c1) Remove four tubes of C2566H competent cells and thaw on ice for 5 min.

[0092] (c2) Add 5 μL of each extracted plasmid to the competent cells and incubate on ice for 30 min;

[0093] (c3) heat shock in a 42°C water bath for 1 min;

[0094] (c4) Take out and place on ice for 5 min;

[0095] (c5) Add 900 μL of 2YT liquid medium and incubate for 1 h (37°C, 225 rpm);

[0096] (c6) Take 100 μL of each plate (containing kanamycin resistance).

[0097] Specifically, the steps for preparing 2YT medium are as follows:

[0098] (d1) adding 16 g of Bacto trypsin;

[0099] (d2) adding 10 g of Bacto yeast extract;

[0100] (d3) adding 5 g of NaCl;

[0101] (d4) adjusting the pH to 7.0 with 5 M NaOH;

[0102] (d5) Adjust to 1 L with distilled water;

[0103] (d6) or use pre-mixed powders and sterilize by autoclaving;

[0104] Specifically, the steps for inducing expression of the PapMV-pET28a recombinant expression strain are as follows:

[0105] (e1) Select a single colony and place it in 50 mL of culture medium (50 mg / L of kanamycin) for 4 h.

[0106] (e2) Add 50 mL of bacterial suspension to 800 mL of culture medium (kanamycin 50 mg / L) and culture at 30°C with shaking at 200 rpm until OD 600 =0.8;

[0107] (e3) Add 0.2 mM IPTG and culture at 25°C for 24 h with shaking at 200 rpm;

[0108] (e4) Collect biomass for 10 min at 4500 rpm.

[0109] Specifically, the steps for purifying PapMV virus-like particles are as follows:

[0110] (f1) Ultrasonic disruption of bacterial cells for 45 min, 3 s on, 4 s off, power 125 W. After sonication, ultrasonication was continued at 9500 rpm for 20 min at 4°C, and the supernatant was collected.

[0111] (f2) preparing sucrose solutions of 30% (w / v) and 60% (w / v) (mass ratio of sucrose to water) and ultracentrifuging them at 26,500 rpm in a swinging bucket rotor at 4°C for 3 h. Collecting the interlayers and the precipitate;

[0112] (f3) To remove sucrose, Tris-HCl-NaCl buffer (50 mM Tris-HCl, pH = 8.4, 20 mM NaCl) can be added for secondary ultracentrifugation. Centrifuge at 30,000 rpm in a swinging rotor at 4°C for 3 h. Collect the interlayers and precipitate, and ultrafilter the target protein using a 30 kDa ultrafiltration tube and replace it with PBS solvent to obtain PapMV virus-like particles.

[0113] Example 2

[0114] Provided is a method for preparing a GnRH-I recombinant protein, the specific embodiments of which include:

[0115] (1) Construction of recombinant plasmids: The nucleotide sequences shown in SEQ ID NO.3 and SEQ ID NO.4 were sent to BGI for synthesis into pcDNA3.1 vector to obtain recombinant plasmids GnRH-I and GnRH-II. Q -pcDNA3.1 and GnRH-I E -pcDNA3.1;

[0116] (2) Expression of GnRH-I: GnRH-I Q -pcDNA3.1 and GnRH-I E -pcDNA3.1 recombinant plasmid was transformed into HEK293f expression cell line to obtain GnRH-I Q -pcDNA3.1 and GnRH-I E -pcDNA3.1 recombinant expression cell line;

[0117] (3) Cell culture and GnRH-I protein purification: Cultivate the GnRH-I Q -pcDNA3.1 and GnRH-I E -pcDNA3.1 recombinant expression cell line, centrifugation to separate the supernatant, the supernatant was purified by nickel column to obtain GnRH-I Q and GnRH-I E protein;

[0118] Specifically, in step (1), the GnRH-I Q -pcDNA3.1 and GnRH-I E -pcDNA3.1 recombinant plasmid was transformed into bacterial DH5α competent cells, and then the extracted plasmid was transfected into HEK293f cells using PEI, and then GnRH-I was obtained by screening with bleomycin. Q -pcDNA3.1 and GnRH-I E -pcDNA3.1 HEK293f recombinant expression cell line.

[0119] The basic materials for preparing GnRH-I protein in the embodiment of the present invention include: GnRH-I protein CDS sequence, pcDNA3.1 plasmid, PEI transfection reagent, Tiangen plasmid mini-extraction kit and HEK293f cells. Q and GnRH-I E Protein CDS sequences were sent to gene companies to synthesize GnRH-I Q -pcDNA3.1 and GnRH-I E -pcDNA3.1 recombinant plasmid. Plasmid sequencing and extraction procedures are the same as above.

[0120] Specifically, HEK293f cells in the logarithmic growth phase were sampled and counted to ensure that the cell quantity was sufficient and the viability was above 95% for transient transfection. The extracted plasmid was transfected into HEK293f cells as follows:

[0121] (1) Centrifuge the cells and replace the medium one day before transient transfection;

[0122] (2) Collect a certain amount of cell suspension according to experimental requirements and centrifuge at 1000 rpm for 5 min at room temperature;

[0123] (3) Gently resuspend the cells in RPMI1640 containing 0.1% F68 to a certain cell density;

[0124] (4) Take a 1.5 mL sterile EP tube and add a certain concentration of plasmid as needed. After it is fully mixed, add it to a certain amount of PEI, mix well and let it stand for 5 minutes;

[0125] (5) Add the DNA / PEI complex to the cell suspension to fully mix the DNA / PEI complex and cells;

[0126] (6) Place in a shaker at 37°C, 180 rpm, and culture for 3 h. Then, add EXCELL293 serum-free medium and continue culturing.

[0127] (7) Collect samples every day, test cell density and viability, and stop collecting samples when the cell viability is lower than 50%.

[0128] Specifically, GnRH-I Q and GnRH-I E The protein purification steps are as follows:

[0129] (1) The harvested cell culture medium was centrifuged at 4000 rpm for 20 min at room temperature, and the supernatant was collected and filtered through a 0.45 μm filter membrane;

[0130] (2) Wash the column with 10 column volumes of ultrapure water and then equilibrate the column with 20 column volumes of PBS;

[0131] (3) Sample loading (can be repeated twice);

[0132] (4) 25 mM imidazole wash for 10 column volumes;

[0133] (5) 50 mM imidazole wash for 10 column volumes;

[0134] (6) 100 mM imidazole elution for 10 column volumes;

[0135] (7) 250 mM imidazole elution for 10 column volumes;

[0136] Concentrate the protein-containing imidazole solution to obtain high-purity GnRH-I Q and GnRH-I E protein.

[0137] Example 3

[0138] Provided is a GnRH-I-PapMV vaccine. The PapMV virus-like particles and the GnRH-I protein are coupled to form GnRH-I-PapMV through a chemical coupling reagent SMPH, and then mixed with an aluminum hydroxide adjuvant to obtain the GnRH-I-PapMV vaccine.

[0139] Specifically, PapMV virus-like particles and GnRH-I protein were coupled with chemical coupling reagents SMPH and TCEP to prepare GnRH-I-PapMV, and the steps are as follows:

[0140] (1) Calculation of coupling substance dosage

[0141] PapMV dosage: molecular weight 23 kDa, i.e. 23 mg / ml = 1 mM;

[0142] SMPH dosage: succinimidyl 6-(BETA-maleimidopropionamido) hexanoate, molecular weight 378.4 g / mol, prepared at 10 mg / ml;

[0143] GnRH-I dosage: prepared in Example 2, molecular weight 1.1 kDa, i.e. 1.1 mg / ml = 1 mM;

[0144] TCEP dosage: tris-(2-carboxyethyl)phosphine hydrochloride, molecular weight 286.65 g / mol, preparation concentration 0.5 M;

[0145] (2) PapMV was mixed with SMPH and incubated on a shaker at 25°C and 200 rpm for 25 min. After the reaction, a desalting column was used to remove the side reaction products.

[0146] (3) GnRH-I was mixed with TCEP and incubated on a shaker at 25°C and 200 rpm for 25 min. After the reaction, a desalting column was used to remove the side reaction products.

[0147] (4) The desalted PapMV+SMPH was mixed with GnRH-I+TCEP, incubated at 25°C, 200 rpm, for 3 hours, and 10 μl of the sample was used for SDS-PAGE identification to check the coupling effect.

[0148] See Figure 3, GnRH-I is displayed on the surface of VLP through chemical cross-linking agents, resulting in a coupling band (~25kDa), which is GnRH-I Q -PapMV and GnRH-I E -PapMV virus-like particles. 50 μg of GnRH-I-PapMV virus-like particles were mixed with aluminum hydroxide adjuvant at a volume ratio of 1:1 for immunization, which was the GnRH-I-PapMV vaccine.

[0149] Comparative Example

[0150] At the same time, GnRH-I-AP205 virus-like particles were prepared according to the same system as the GnRH-I-AP205 virus-like particle preparation method mentioned in patent CN112500456B for subsequent immune control experiments.

[0151] Example 4

[0152] Provided is a GnRH-I-PapMV virus-like particle subunit vaccine immunization method:

[0153] As described in Example 3, GnRH-I Q -PapMV and GnRH-I E - PapMV virus-like particles and aluminum hydroxide adjuvant were mixed in a volume ratio of 1:1 for immunization. On day 0, day 14, and day 28, 50 μg GnRH-I Q -PapMV and GnRH-I E Eight-week-old male C57BL / 6 mice were immunized with PapMV virus-like particles vaccine (five mice per group), and the GnRH-I-AP205 virus-like particles and aluminum hydroxide adjuvant immunization group, GnRH-I Q -PapMV and GnRH-I E -PapMV without adjuvant group, adjuvant PBS negative group, simple PapMV experimental group and simple GnRH-I Q and GnRH-I EExperimental group. Anti-GnRH-I recombinant protein antibody titers and testosterone levels were measured in these mice. On day 70 after immunization, the mice were sacrificed and testicular weights were measured.

[0154] Example 5 Determination of mouse anti-GnRH-I antibody titer

[0155] At different time points during the experiment, sera were collected from immunized mice and control mice. Anti-GnRH-I IgG antibody titers were determined by ELISA as follows. Q and GnRH-I E 96-well plates were coated overnight at 4°C, with 100 μl per well. The next day, the plates were washed five times with 1:1000 PBST and blocked with 300 μl of 2% BSA at 37°C for 2 h. The plates were then washed five times with 1:1000 PBST. Mouse serum was serially diluted with 2% BSA at an initial concentration of 1:500, followed by two-fold dilutions to 1:1000, 1:2000, 1:4000, 1:8000, 1:16000, 1:32000, 1:64000, 1:128000, and 1:256000. From high to low dilutions, 100 μl per well was added, and the plates were incubated at room temperature with shaking for 45 min. The plates were then washed five times with 1:1000 PBST. HRP-conjugated goat anti-mouse polyclonal antibody was used as a secondary antibody at a dilution of 1:5000 in 2% skim milk powder, with 100 μl per well incubated at room temperature with shaking for 45 minutes. Development was performed with TMB for 5-10 minutes, followed by termination with 2M sulfuric acid. The absorbance was read at 450 nm. The optical density (OD) at 450 nm was measured using an ELISA reader (BioRad Benchmark). These data were used to calculate the serum dilution with the maximum OD450.

[0156] Table 1 shows that the GnRH-I prepared in Example 3 Q -PapMV and GnRH-I E In the male mice immunized with PapMV virus-like particles without adjuvant, the average titer reached 8000 on day 28, and the average titer remained at 32000 after the third booster. Q -PapMV and GnRH-I E -The average titer of the PapMV virus-like particle adjuvant group reached 16,000 on day 28, and then remained stable at 128,000 after the third injection. Q and GnRH-I EAfter three immunizations, the titer of the immunized group only reached 8000, and no antibody titer was detected in the PapMV mixed adjuvant and PBS mixed adjuvant immunization groups. The results clearly show that GnRH-I-PapMV virus-like particles can induce high anti-GnRH antibody titers, and the immunization effect is better when supplemented with adjuvants. Compared with the comparative example, the GnRH-I constructed in Example 3 Q -PapMV and GnRH-I E -PapMV can induce the body to produce antibodies in a long-term manner and is more suitable for the preparation of GnRH-I-PapMV subunit vaccines.

[0157] Table 1

[0158] At various time points during the above experiments, serum was collected from immunized mice and control mice. Testosterone levels in mouse serum were determined using Testosterone-ELISA (IBL, Hamburg, Germany).

[0159] Figure 4 shows that the use of GnRH-I Q -PapMV and GnRH-I E In mice immunized with PapMV virus-like particles without aluminum hydroxide adjuvant, the average testosterone level was greatly suppressed (<2 ng / ml) on day 42 after immunization, and the level was still below 2 ng / ml on day 70. Q -PapMV and GnRH-I E In mice immunized with PapMV supplemented with aluminum hydroxide adjuvant, the average testosterone level dropped to <2 ng / ml on the 28th day. After 42 days, the average testosterone level remained stable at around 0.18 and 0.21. From the 28th day onwards, the average testosterone level was significantly lower than that of the group immunized without adjuvant. Q -PapMV+adjuvant immunization group was compared with the control group GnRH-I at the same time Q The average level of hormones in the central nervous system of the mice immunized with aluminum hydroxide was about 30.2 times lower, and GnRH-I E -PapMV+adjuvant immunization group was compared with the control group GnRH-I at the same time E The average hormone level in the central nervous system of the mice immunized with GnRH-I-AP205 virus-like particles + aluminum hydroxide adjuvant was about 30.4 times lower. The hormone level in the central nervous system of the mice immunized with GnRH-I-AP205 virus-like particles + aluminum hydroxide adjuvant was about 27 times lower than the average hormone level in the mice immunized with GnRH-I + aluminum hydroxide. This clearly proves that the GnRH-I-PapMV + adjuvant immunization group has a stronger inhibitory effect on mouse testosterone.

[0160] Mice were sacrificed on day 70, and the testicles were removed and weighed before being fixed in 4% formaldehyde.

[0161] Figure 5 shows that on day 70, GnRH-I Q and GnRH-I E The testicular weight of immunized mice was not significantly reduced, while that of mice receiving GnRH-I Q -The testicular weight of mice immunized with PapMV virus-like particles and aluminum hydroxide adjuvant was reduced by 79.85% and those receiving GnRH-I E -The testicular weight of mice immunized with PapMV virus-like particles and aluminum hydroxide adjuvant decreased by 78.81%, and the testicular weight of mice immunized with GnRH-I-AP205 virus-like particles and aluminum hydroxide adjuvant decreased by 75.77%, which clearly shows that the vaccine combined with GnRH-I-PapMV and adjuvant has a significant inhibitory effect on the mouse testicles.

[0162] Example 6: Testicular volume determination of experimental cats

[0163] Six healthy male rural cats aged 12 months were divided into two groups, 3 in each group, one of which was the injection group and the other was the control group. Q PapMV virus-like particles were mixed with aluminum hydroxide adjuvant at a volume ratio of 1:1 for immunization. 200 μg was injected subcutaneously behind the ear and neck. A second injection was given 28 days later at the same dose and route. A control group received no injection. All experimental animals were housed individually under the same conditions and observation.

[0164] After the first vaccination, measure the width and length of the testicles with a vernier caliper or tape measure every 14 days and calculate the testicular volume using the following formula:

[0165] Testicular volume = (width / 4) × (length / 2) × 4 / 3 × 3.14.

[0166] As shown in Figure 6, the testicular volume of the male cats in the injection group decreased, while the testicular volume of the male cats in the control group increased. This clearly shows that GnRH-I Q -The vaccine composed of PapMV and adjuvant has a significant inhibitory effect on the testicles of cats.

[0167] Example 7 Determination of pregnancy status in experimental dogs

[0168] Ten healthy Chinese pastoral dogs aged 12-14 months (6 male dogs and 4 female dogs) were divided into two groups, with 3 male dogs and 2 female dogs in each group. One group was the injection group and the other was the control group.

[0169] The injection group received a subcutaneous injection of 200 μg GnRH-I behind the ear and neck. Q PapMV + adjuvant was injected a second time 28 days later, using the same route. The control group received no injection. All cats were housed and observed under the same conditions.

[0170] Eight healthy male and twelve female Chinese rural dogs aged 12 to 24 months were cage-paired with the injected and control groups. Fourteen days after the second injection, the three males from the injected and control groups were cage-paired with two healthy females, respectively; and the four females from the injected and control groups were cage-paired with two healthy males, respectively. The males from each group were rotated to breed to minimize behavioral incompatibilities that could affect successful pairing.

[0171] After the cohabitation test begins, check whether the female dogs in the experimental group and the male dogs in the same cage are pregnant. After 30 days of observation, ultrasound is used to check for pregnancy.

[0172] As can be seen from Table 2, none of the female dogs in the injection group and the paired female dogs became pregnant, while the female dogs in the control group and the paired female dogs became pregnant, indicating that GnRH-I Q -PapMV+adjuvant is very effective for castration of dogs and is suitable for the development of castration vaccines.

[0173] Table 2 Pregnancy status of experimental animals

Claims

1. GnRH-VLP recombinant protein, characterized in that Including GnRH and papaya mosaic virus capsid protein.

2. The recombinant protein according to claim 1, characterized in that The C-terminus of GnRH was coupled to the N-terminus of papaya mosaic virus capsid protein; wherein GnRH has an amino acid sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2; The papaya mosaic virus capsid protein has the amino acid sequence shown in SEQ ID NO:

5.

3. Biomaterial, characterized in that Include any of the following: 1), a nucleic acid encoding the recombinant protein according to claim 1; II), an expression unit containing the nucleic acid described in I); III), a recombinant vector containing the nucleic acid described in I) or the expression unit described in II); IV), a host cell transformed or transfected with the expression vector described in III); V) and IV) the culture products of the host cells.

4. The method for preparing the recombinant protein according to claim 1 or 2, characterized in that: The method comprises culturing the host cell described in claim 3 to obtain a culture product containing the recombinant protein described in claim 1; Or it includes preparing GnRH-I protein and papaya mosaic virus capsid protein separately, and obtaining the recombinant protein according to claim 1 or 2 through coupling.

5. Use of the recombinant protein according to claim 1 or 2, the biological material according to claim 3 or the product obtained by the preparation method according to claim 4 in the preparation of a subunit vaccine for animal castration.

6. A vaccine, characterized in that The invention comprises the recombinant protein according to claim 1 or 2 and an adjuvant.

7. The vaccine according to claim 6, characterized in that The adjuvant is aluminum hydroxide adjuvant.

8. The method for preparing the vaccine according to claim 6 or 7, characterized in that: The method comprises mixing the recombinant protein according to claim 1 or 2 with an adjuvant.

9. The preparation method according to claim 8, characterized in that: The volume ratio of the mixture is 1:

1.

10. A method for castration of an animal, characterized in that: Comprising administration of the vaccine of claim 6 or 7.