Castration TMV particle subunit vaccine and preparation method thereof

Abstract

The invention relates to a castrated TMV virus-like particle subunit vaccine and a preparation method thereof. The GnRH-I-TMV recombinant protein is high in purity and good in specificity. A vaccine prepared from the GnRH-I-TMV recombinant protein is high in antigen purity, good in safety and good in castration effect.

Description

Castration TMV granule subunit vaccine and preparation method thereof

[0001] This application claims priority to the Chinese patent application filed with the China Patent Office on March 21, 2023, with application number 202310317333.6 and invention name “GnRH-VLP recombinant castration vaccine and its preparation method”, the entire contents of which are incorporated by reference into this application. Technical Field

[0002] The present invention relates to the field of biotechnology, in particular to a castration-resistant mitochondrial virus (TMV) granule subunit vaccine and a preparation method thereof. Background Art

[0003] Castration is the indirect removal of an animal's reproductive system or the resulting loss of sexual function. This includes the removal of the testes in males and the ovaries in females, collectively known as gonadectomy. In addition to surgical removal of the gonads, local radiation exposure and chemical treatment can also be used for castration. Castration deprives vertebrates of their source of sex hormones, which can sometimes lead to the degeneration of genital appendages and secondary and tertiary sexual characteristics.

[0004] Gonadotropin-releasing hormone (GnRH) is an endogenous polypeptide hormone in animals. Physiological doses of GnRH-I can elevate gonadotropin concentrations (e.g., a mild increase in FSH and a significant increase in LH), promoting the synthesis and secretion of gonadal hormones (e.g., estradiol, progesterone, and testosterone), promoting follicular maturation and ovulation, testicular development and sperm maturation, and the development and maintenance of secondary sexual characteristics. Furthermore, GnRH-I can directly affect the gonads, regulating the synthesis and secretion of gonadal steroid hormones and promoting gamete formation.

[0005] Self-antigen proteins are often difficult to elicit antibody responses against. One approach to improving vaccination efficacy is to increase the reproducibility of the applied antigens. Unlike isolated proteins, viruses can induce rapid and potent immune responses, both with and without T cell help, without any adjuvants. Compared to a few proteins, they can trigger immune responses far more robust than their isolated components. With respect to B cell responses, it is well known that a key factor in viral immunogenicity is the reproducibility and order of surface epitopes. Many viruses exhibit quasi-crystalline surfaces with regularly arranged epitopes that efficiently crosslink epitope-specific immunoglobulins on B cells. This crosslinking of B cell surface immunoglobulins is a strong activation signal, directly inducing cell cycle progression and IgM antibody production. Furthermore, this triggered B cell activation can activate T helper cells, in turn inducing the conversion of IgM to IgG antibodies in B cells and the generation of long-lived B cell memory targets for any vaccination. Viral structure has even been implicated in the production of anti-antibodies in autoimmune diseases and is part of the natural response to pathogens. Therefore, antigens presented on highly organized viral surfaces can induce strong antibody responses against these antigens.

[0006] TMV belongs to the tobacco mosaic virus group. Its genome is a positive-sense single-stranded RNA with a cap structure, totaling 6395 base pairs. TMV is a rod-shaped virus particle, 300 nm in length, composed of 2130 CP subunits that package the viral genome in a left-handed helix. The TMV capsid protein CP is highly immunogenic and can promote T cell immune responses. However, there are no reports on how to use TMV to construct a GnRH castration vaccine.

[0007] Summary of the Invention

[0008] In view of this, the technical problem to be solved by the present invention is to provide a castrated TMV virus-like particle subunit vaccine and a preparation method thereof, which is easy to obtain through bacterial culture, has a high expression yield, is convenient for industrial production, has strong immunogenicity and a fast immune response.

[0009] The present invention provides a GnRH-VLP recombinant protein, which comprises GnRH and a capsid protein of tobacco mosaic virus.

[0010] The GnRH has an amino acid sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2, or a sequence in which one or more amino acids are substituted, deleted, added and / or replaced based on the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2; or a sequence with more than 90% homology to the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2.

[0011] The capsid protein of the tobacco mosaic virus (TMV CP) has the amino acid sequence shown in SEQ ID NO: 5, or a sequence in which one or more amino acids are substituted, deleted, added and / or replaced based on the amino acid sequence shown in SEQ ID NO: 5; or a sequence with more than 90% homology to the amino acid sequence shown in SEQ ID NO: 5.

[0012] In some embodiments, in the GnRH-VLP recombinant protein provided herein, GnRH is located at the N-terminus of the recombinant protein, and the TMV capsid protein is located at the C-terminus of the recombinant protein. In some embodiments, in the recombinant protein, the two fragments are chemically coupled, connected by a linker, or the GnRH fragment is displayed on the surface of the TMV particle via biotin-streptavidin.

[0013] The nucleic acid can be DNA, RNA, cDNA or PNA. The DNA form includes cDNA, genomic DNA or artificially synthesized DNA. The DNA can be single-stranded or double-stranded. The nucleic acid can include nucleotide sequences with different functions, such as coding regions and non-coding regions such as regulatory sequences (such as promoters or transcription terminators). The nucleic acid can be linear or circular in topology. The nucleic acid can be, for example, a part of a vector (such as an expression or cloning vector), or a fragment. The nucleic acid can be obtained directly from a natural source, or can be prepared with the assistance of recombination, enzymatic methods or chemical techniques. The RNA form is mRNA obtained by gene transcription, etc. The gene sequence can use a wild-type sequence or can be codon-optimized, and the present invention is not limited to this. The nucleic acids described in the present invention encode GnRH and TMV CP respectively. The nucleic acid encoding TMV CP is a nucleic acid encoding the full length or partial fragment of TMV CP.

[0014] The expression unit provided by the present invention is an expression unit comprising GnRH, which comprises the nucleic acid of the present invention in a single or multiple tandem form, a promoter, and a terminator, and the present invention does not limit this.

[0015] Furthermore, the recombinant expression vector herein refers to a nucleic acid vector, a recombinant DNA molecule comprising a desired coding sequence and appropriate nucleic acid sequences or elements necessary for expression of the operably linked coding gene in a specific host organism. Nucleic acid sequences or elements necessary for expression in bacteria include promoters, ribosome binding sites, and possibly other sequences. The recombinant expression vector is selected based on the host. The expression vector described in the present invention may be circular or linear, and this is not limited in the present invention. Taking a prokaryotic host as an example, it may be Escherichia coli, Bacillus, Streptomyces, or Cyanobacteria; its backbone vector may be a pET series plasmid, a pGEX series plasmid, a pKBP series plasmid, or a pcDNA series plasmid (e.g., pcDNA3.1). For example, the recombinant backbone vector is a pET series vector, and optionally, the backbone vector of the recombinant vector is pET-21(+), pET-24(+), pET32a, pET-23(+), or pET-28a(+).

[0016] The construction of the recombinant vector provided by the present invention comprises cloning the nucleic acid fragment encoding the fusion protein as described above into an expression vector by homologous recombination method.

[0017] In some embodiments, the backbone vector of the recombinant vector is pcDNA3.1. The recombinant plasmid GnRH-I-pcDNA3.1 is obtained by cloning the nucleotide sequence of SEQ ID NO. 3 into the HindIII and EcoRI sites of the eukaryotic expression vector pcDNA3.1 via homologous recombination. In other embodiments, the backbone vector of the recombinant vector is pKBP121. Furthermore, the present invention provides a host cell transformed or transfected with the aforementioned recombinant vector, or having the aforementioned nucleic acid integrated into its genome.

[0018] The hosts described in the present invention include bacteria, fungi, viruses, or animals. The bacteria include Gram-positive bacteria and Gram-negative bacteria; the Gram-positive bacteria include but are not limited to Escherichia coli. The fungi include molds, yeasts, and mushrooms; the yeasts include Saccharomyces cerevisiae, Saccharomyces cerevisiae, Pichia pastoris, and Candida. The viruses include but are not limited to adenoviruses, adeno-associated viruses, lentiviruses, and prions. The animals include humans, mice, rabbits, pigs, zebrafish, and the like. The expression of the nucleic acid encoding the recombinant protein in the host can be either integrated or episomal, and the present invention does not limit this.

[0019] Furthermore, the present invention also provides a culture product of the host cell.

[0020] The method for preparing the GnRH-TMV recombinant protein of the present invention comprises:

[0021] GnRH-I protein and tobacco mosaic virus capsid protein TMV CP are prepared respectively, and the recombinant protein is obtained through coupling.

[0022] As described above, the method for preparing the fusion protein includes:

[0023] (1) The decapeptide gene of GNRH-I was concatenated with the streptavidin SA gene, and the synthesized fragment was directly cloned into the pcDNA3.1 eukaryotic expression vector to obtain the positive recombinant plasmid GnRH-I-SA-pcDNA3.1. The GnRH-I-SA recombinant protein was expressed in HEK293f cells and purified;

[0024] (2) TMV CP protein was obtained according to the method described in Smith ML, Lindbo JA, Dillard-Telm S, Brosio PM, Lasnik AB, McCormick AA, Nguyen LV, Palmer KE. Modified tobacco mosaic virus particles as scaffolds for display of protein antigens for vaccine applications. Virology. 2006 May 10; 348(2): 475-88;

[0025] (3) TMV CP protein was biotinylated using EZ-Link NHS-PEO4-biotin and then coupled with GnRH-I-SA recombinant protein to obtain GnRH-I-TMV particles.

[0026] As a preferred embodiment of the method for preparing the recombinant HEK293f expressing GnRH-I-SA recombinant protein, the eukaryotic expression vector is pcDNA3.1.

[0027] Furthermore, the fusion protein, the nucleic acid, the expression unit, the recombinant vector, the host cell, the culture product or the composition of the present invention are used in the preparation of subunit vaccines.

[0028] The present invention also provides a vaccine containing GnRH-VLP. Specifically, the present invention provides a castration TMV virus-like particle subunit vaccine, which includes the recombinant protein as described above. The vaccine is a castration vaccine for male animals. The male animals are animals that can be castrated, including birds and mammals. For example, mice, rats, cats, dogs, horses, or animals of the same family and genus as the above animals. Preferably, they are felines, canines, or rodents, such as mice. The vaccine also includes an adjuvant. The adjuvant includes an aluminum salt adjuvant, a protein adjuvant, a nucleic acid adjuvant, a lipid-containing adjuvant, a mixed adjuvant, or an aggregate structure adjuvant. In some embodiments of the present invention, the adjuvant is an aluminum hydroxide adjuvant. In the GnRH-VLP vaccine of the present invention, the adjuvant is not limited. In some embodiments, the GnRH-VLP vaccine is prepared using an aluminum adjuvant. The concentration of GnRH-VLP in the vaccine is 800, 400, 200, or 100 μg / mL, preferably, the concentration is 400 μg / mL.

[0029] Furthermore, the method for preparing the subunit vaccine comprises mixing the recombinant protein with an adjuvant; or mixing the composition with a buffer solution. Preferably, the volume ratio of the mixture is 1:1.

[0030] Immunizing animals with the vaccine of the present invention can achieve the effect of castration. Therefore, the present invention also provides the use of the above-mentioned vaccine in animal castration. Accordingly, the present invention also provides a method for castrating animals, comprising administering the vaccine as described above. The administration method includes injection. In the present invention, the castration includes increasing the level of GnRH antibodies, reducing the level of testosterone, reducing the volume and / or weight of the testicles, and preventing animal pregnancy. In the present invention, the dosage administered is 50 μg for mice and 200 μg for cats or dogs. 10 to 100 days after immunization, the testosterone level and testicular weight decrease.

[0031] In some tests, testosterone levels are reduced to 50% to 90% of the original level, specifically 50% to 70%, 60% to 80%, 70% to 90%, and more specifically 50% to 60%, 60% to 70%, 70% to 80%, or 80% to 90%. In a specific embodiment, testosterone levels are reduced to 4.17% of the original level.

[0032] In some tests, the testicular weight of mice was reduced to 50% to 90% of the original level, specifically 50% to 70%, 60% to 80%, 70% to 90%, more specifically 50% to 60%, 60% to 70%, 70% to 80%, 80% to 90%. In a specific embodiment, the testicular weight of mice was reduced to 20.2% of the original level.

[0033] In some tests, the cat's testicular volume is reduced to 50% to 90% of its original level, specifically 50% to 70%, 60% to 80%, 70% to 90%, more specifically 50% to 60%, 60% to 70%, 70% to 80%, 80% to 90%. In a specific embodiment, the cat's testicular volume is reduced to 94% of its original level.

[0034] The beneficial effects of the present invention are as follows:

[0035] First, TMV is the tobacco mosaic virus. The viral capsid protein has the ability to self-assemble into nanoparticles. It is non-infectious and has strong antigenic immunity.

[0036] Second, the antigen coupled with TMV showed high antigenicity and could induce high levels of specific antibodies in mice, rats, cats, dogs and horses, with a rapid humoral immune response;

[0037] Third, the GnRH-I-TMV virus-like particles of the present invention are expressed in large quantities by HEK293f cells and Nicotiana benthamiana plants, and the production process is simple;

[0038] Fourth, the GnRH-I protein of the present invention is suitable for vaccine preparation: The HEK293f recombinant expression cell line selected in the present invention provides a eukaryotic expression environment, overcoming the potential for protein misfolding and loss of function in E. coli-expressed proteins due to the lack of specialized cofactors, molecular chaperones, and post-translational modifications. These factors disrupt protein-protein interactions within eukaryotic multi-subunit complexes, surface receptors, and secreted proteins. HEK293F cells are a suspension cell culture-adapted cell line isolated from HEK293 cells. Expression is achieved by transient transfection of cells using an inexpensive reagent formulated with branched PEI via endocytosis. This method is suitable for both small-scale (30 mL) and large-scale (300 mL) cell transfections, yielding high yields of purified protein. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for the embodiments or the description of the prior art. Obviously, the drawings described below are only exemplary. For those skilled in the art, other implementation drawings can be derived from the provided drawings without inventive effort:

[0040] FIG1 is a schematic diagram of SDS-PAGE of GnRH-I-TMV coupling provided in an embodiment of the present invention;

[0041] Figure 2 shows the antibody titers in mice immunized with GnRH-I-TMV;

[0042] Figure 3 shows the testosterone levels in mouse serum;

[0043] Figure 4 shows the testicular weights of mice in each group;

[0044] Figure 5 shows the changes in testicular volume of male cats in each group. DETAILED DESCRIPTION

[0045] To make the above-mentioned objects, features, and advantages of the present invention more readily apparent, specific embodiments of the present invention are described in detail below with reference to the accompanying drawings. The following description sets forth numerous specific details to facilitate a full understanding of the present invention. However, the present invention can be implemented in many other ways than those described herein, and those skilled in the art may make similar modifications without departing from the scope of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below.

[0046] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present invention pertains. The terms used herein in the specification of the present invention are for the purpose of describing specific embodiments only and are not intended to limit the present invention. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.

[0047] The molecular biology experimental methods used in the examples of the present invention, such as enzyme digestion and homologous recombination ligation, can be found in the second edition of Molecular Cloning. The basic materials for preparing the GnRH-I-TMV virus-like particles of the present invention include: the TMV coat protein gene nucleotide sequence (SEQ ID NO. 6), the GnRH-I nucleotide sequence (SEQ ID NO. 3 or SEQ ID NO. 4), the pcDNA3.1 plasmid, the BL21 (DE3) Escherichia coli strain, the Tiangen Plasmid Miniprep Kit, a nickel column, and imidazole. The nucleotide sequence was sent to BGI for synthesis of the GnRH-I-SA-pcDNA3.1 recombinant plasmid.

[0048] The sequences involved in the present invention include:

[0049] GnRH is also referred to herein as GnRH-I, and its amino acid sequence is:

[0050] QHWSYGLRPG (SEQ ID NO: 1, denoted as GnRH-1 Q )

[0051] or EHWSYGLRPG (SEQ ID NO: 2, denoted as GnRH-I E )

[0052] The nucleic acid sequence encoding GnRH-1 is:

[0053] CAACACTGGAGCTACGGTTTGAGACCCGGT (SEQ ID NO.3, encoding GnRH-I Q )

[0054] or GAACACTGGAGCTACGGTTTGAGACCCGGT (SEQ ID NO. 4, encoding GnRH-I E )

[0055] The amino acid sequence of the TMV protein is:

[0056] The nucleic acid sequence encoding the TMV protein is (this sequence has been codon-optimized and performs better than other optimization schemes):

[0057] The present invention provides a GnRH-I-TMV virus-like particle. First, the GNRH-I gene and the streptavidin SA gene are concatenated and connected to a pcDNA3.1 vector. The GnRH-I-SA recombinant protein is expressed in HEK293f cells and purified. TMV CP protein is obtained according to the method described by Smith ML et al. in Modified tobacco mosaic virus particles as scaffolds for display of protein antigens for vaccine applications. Virology. 2006 May 10; 348(2): 475-88. The TMV CP protein is biotinylated and then coupled with the GnRH-I-SA recombinant protein to obtain GnRH-I-TMV particles for preparing a GnRH-I-TMV subunit vaccine.

[0058] The test materials used in the present invention are all common commercial products and can be purchased on the market. The present invention is further described below with reference to the following examples:

[0059] Example 1

[0060] 1. Provide a method for preparing GnRH-I-SA recombinant protein, used for preparing GnRH-I-TMV particles and comparative experiments, the specific implementation method includes:

[0061] (1) Construction of recombinant plasmid: The nucleotide sequences shown in SEQ ID NO.3 and SEQ ID NO.4 were sent to BGI and concatenated with the streptavidin SA gene to synthesize GnRH-I Q -SA-pcDNA3.1 and GnRH-I E -SA-pcDNA3.1 recombinant plasmid;

[0062] (2) Expression of GnRH-I-SA: The GnRH-I-SA-pcDNA3.1 recombinant plasmid was transformed into the HEK293f expression cell line to obtain the GnRH-I-SA-pcDNA3.1 recombinant expression cell line;

[0063] (3) Cell culture and GnRH-I-SA protein purification: The GnRH-I-SA-pcDNA3.1 recombinant expression cell line was cultured, the supernatant was separated by centrifugation, and the supernatant was purified by nickel column to obtain GnRH-I-SA protein;

[0064] Specifically, in step (1), the GnRH-I-pcDNA3.1 recombinant plasmid is transformed into bacterial DH5α competent cells, the plasmid is cloned in large quantities, and then the extracted plasmid is transfected into HEK293f cells using PEI to obtain the GnRH-I-SA-pcDNA3.1 HEK293f recombinant expression cell line.

[0065] The basic materials for preparing the GnRH-I-SA protein in this embodiment include: the GnRH-I-SA protein CDS sequence, pcDNA3.1 plasmid, PEI transfection reagent, Tiangen Plasmid Miniprep Kit, and HEK293f cells. The GnRH-I protein CDS sequence was sent to a genetics company for synthesis of the GnRH-I-SA-pcDNA3.1 recombinant plasmid. Plasmid sequencing and extraction procedures were the same as above.

[0066] Specifically, HEK293f cells in the logarithmic growth phase were sampled and counted to ensure that the cell quantity was sufficient and the viability was above 95% for transient transfection. The extracted plasmid was transfected into HEK293f cells as follows:

[0067] (1) Centrifuge the cells and replace the medium one day before transient transfection;

[0068] (2) Collect a certain amount of cell suspension according to experimental requirements and centrifuge at 1000 rpm for 5 min at room temperature;

[0069] (3) Gently resuspend the cells in RPMI1640 containing 0.1% F68 to a certain cell density;

[0070] (4) Take a 1.5 mL sterile EP tube and add a certain concentration of plasmid as needed. After it is fully mixed, add it to a certain amount of PEI, mix well and let it stand for 5 minutes;

[0071] (5) Add the DNA / PEI complex to the cell suspension to fully mix the DNA / PEI complex and cells;

[0072] (6) Place in a shaker at 37°C, 180 rpm, and culture for 3 h. Then, add EXCELL293 serum-free medium and continue culturing.

[0073] (7) Collect samples every day, test cell density and viability, and stop collecting samples when the cell viability is lower than 50%.

[0074] Specifically, the GnRH-I-SA protein purification steps are as follows:

[0075] (1) The harvested cell culture medium was centrifuged at 4000 rpm for 20 min at room temperature, and the supernatant was collected and filtered through a 0.45 μm filter membrane;

[0076] (2) Rinse the nickel column with 10 column volumes of ultrapure water and then equilibrate the nickel column with 20 column volumes of PBS;

[0077] (3) Sample loading (can be repeated twice);

[0078] (4) Wash with PBS containing 25 mM imidazole for 5 column volumes;

[0079] (5) Wash with 5 column volumes of PBS containing 50 mM imidazole;

[0080] (6) elution with PBS containing 100 mM imidazole for 5 column volumes;

[0081] (7) elution with 5 column volumes of PBS containing 250 mM imidazole;

[0082] The protein-containing solution was concentrated to obtain highly pure GnRH-I-SA protein.

[0083] 2. Provide a TMV particle and biotinylation scheme for the preparation of GnRH-I-TMV particles and comparative experiments.

[0084] TMV CP protein was obtained according to the method described in Smith ML, Lindbo JA, Dillard-Telm S, Brosio PM, Lasnik AB, McCormick AA, Nguyen LV, Palmer KE. Modified tobacco mosaic virus particles as scaffolds for display of protein antigens for vaccine applications. Virology. 2006 May 10; 348(2): 475-88. The protein was biotinylated using a biotin labeling kit (Beijing Meikewande Biotechnology Co., Ltd. 6014-2), unreacted biotin was removed by ultrafiltration, and the biotinylated protein was exchanged into PBS.

[0085] 3. Provide a GnRH-I-TMV protein particle.

[0086] GnRH-I-SA was mixed with biotinylated TMV CP at a mass ratio of 3:1 and reacted at room temperature for 4 h to fuse streptavidin to the biotinylated TMV CP. GnRH-I-TMV particles were precipitated with 4% PEG 6000 and 4% NaCl and centrifuged at 10,000 × g for 15 min to remove unbound GnRH-I-SA. GnRH-I-TMV was resuspended in PBS for the preparation of GnRH-I-TMV subunit vaccine.

[0087] Example 2 GnRH-TMV subunit vaccine

[0088] Tobacco mosaic virus (TMV) is a plant virus that cannot infect animal cells, but has been shown to interact with and stimulate mammalian dendritic cells. The GnRH gene sequence was cloned into a prokaryotic expression vector to generate a recombinant expression vector. The GnRH protein was expressed and purified, and then chemically conjugated to the surface of TMV to create a GnRH-TMV-VLP subunit vaccine.

[0089] 1. Acquisition of GnRH-TMV target protein

[0090] (1) Construction of recombinant plasmid: The GnRH gene sequence was directly synthesized into the pKBP121 expression vector by a gene company to obtain the recombinant plasmid GnRH-TMV-pKBP121.

[0091] (2) Transfer the recombinant plasmid into the plant expression system: The recombinant plasmid GnRH-TMV-pKBP121 was transiently transfected into tobacco (Nicotiana benthamiana, Nb).

[0092] (3) Purification of GnRH-TMV-pKBP121: The transfected plants were harvested, the soluble protein fraction was separated, and GnRH was purified by a combination of protein A affinity and anion exchange chromatography.

[0093] (4) Modified TMV-NtK with an N-terminal lysine mutation (NtK) was generated by infecting wild-type Nb plants with TMV N-terminal lysine mutation virus. Infected tissues were harvested, soluble proteins were isolated, and virions were purified using a combination of Capto-Q and Capto-Core 700 chromatography. Inactivation was confirmed by exposure to ultraviolet light at 254 nm (UV254) at 5142 J / m2 in an ISO 5 environment.

[0094] (5) Chemical coupling of GnRH-TMV and TMV-NtK: TMV-NtK was mixed with GnRH-TMV at a molar ratio of 1:1 in 100 mM 2-(N-morpholino)ethanesulfonic acid and 500 mM NaCl solution at pH 6. 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) was added, followed by 5 mM N-hydroxysulfosuccinimide (NHS). The EDC concentration was optimized based on the time and concentration of EDC to produce no "free" protein antigen, which varied depending on the protein. The coupling was terminated with 1 mM methylamine, and the coupled vaccine was then dialyzed against PBS overnight (Slidalyzer, 10 kD MCO). The TMV-Ag conjugate was visualized using 8-16% SDS-PAGE gels (BioRad). The final dialyzed vaccine concentration was determined by BCA analysis (BioRad).

[0095] Comparative Example

[0096] GnRH-I-AP205 virus-like particles were prepared according to the same system as the GnRH-I-AP205 virus-like particle preparation method mentioned in patent CN112500456B for subsequent immune control experiments.

[0097] Example 3

[0098] Provides a GnRH-I-TMV subunit vaccine immunization method:

[0099] Eight-week-old male C57BL / 6 mice (five mice per group) were immunized with the vaccine described in Example 1 on days 0, 14, and 28, mixed with 50 μg of GnRH-I-TMV and aluminum hydroxide adjuvant in a 1:1 volume ratio. Groups were also assigned to receive GnRH-I-AP205 plus aluminum hydroxide adjuvant, GnRH-I-TMV without adjuvant, PBS-negative adjuvant, TMV alone, and GnRH-I alone. Anti-GnRH-I recombinant protein antibody titers and testosterone levels were measured in these mice. On day 70 after immunization, the mice were sacrificed and testicular weights were measured.

[0100] Example 4 Determination of mouse anti-GnRH-I antibody titer

[0101] At various time points during the experiment, serum was collected from immunized and control mice. Anti-GnRH-I IgG antibody titers were determined by ELISA as follows. 96-well plates were coated with 2 μg / ml GnRH-I overnight at 4°C, with 100 μl per well added. The next day, the plates were washed five times with 1:1000 PBST and blocked with 300 μl of 2% BSA at 37°C for 2 h. The plates were then washed five times with 1:1000 PBST. Mouse serum was serially diluted with 2% BSA at a starting concentration of 1:500, followed by two-fold dilutions to 1:1000, 1:2000, 1:4000, 1:8000, 1:16000, 1:32000, 1:64000, 1:128000, and 1:256000. 100 μl per well was added from the highest to the lowest dilutions, and the plates were incubated at room temperature with shaking for 45 min. Wash the plate five times with 1:1000 PBST. Use HRP-labeled goat anti-mouse polyclonal antibody as a secondary antibody at a dilution of 1:5000 in 2% skim milk powder, with 100 μl per well, and incubate at room temperature with shaking for 45 minutes. TMB color development takes 5–10 minutes, followed by addition of 2 M sulfuric acid to terminate the reaction, and the absorbance is read at 450 nm. Optical density (OD) at 450 nm is measured using an ELISA reader (BioRad Benchmark), and the maximum OD is calculated using these data. 450 Serum dilution.

[0102] Figure 2 shows that in male mice immunized with the unadjuvanted GnRH-I-TMV particles prepared in Example 1, the average titer reached 16,000 on day 28. After the fourth booster dose, the average titer briefly increased to 32,000 before returning to an average titer of 16,000. In the GnRH-I-TMV + adjuvant group, the average titer reached 64,000 on day 28, remained stable at 128,000 after the third dose, and gradually decreased to 64,000 after four doses. In the GnRH-I alone immunization group, the titer reached only 8,000 after three immunizations and dropped to 4,000 after the fourth dose. No antibody titers were detected in either the TMV adjuvanted or PBS adjuvanted groups. These results clearly demonstrate that the GnRH-I-TMV particles prepared in Example 1 can induce high anti-GnRH-I antibody titers, and that the effect is even greater when immunized with an adjuvant. Compared with the comparative example, the GnRH-I-TMV constructed in Example 1 can more rapidly stimulate the production of high-titer GnRH-I antibodies.

[0103] At various time points during the above experiments, serum was collected from immunized mice and control mice. Testosterone levels in mouse serum were determined using a testosterone-ELISA (IBL, Hamburg, Germany).

[0104] Figure 3 shows that in mice immunized with GnRH-I-TMV without aluminum hydroxide adjuvant, the average testosterone level was greatly suppressed (<2 ng / ml) on day 42 after immunization, and the level was still below 2 ng / ml on day 70. Q In mice immunized with -TMV+aluminum hydroxide adjuvant, the average testosterone level dropped to <2 ng / ml on day 28, and remained stable at around 0.24 ng / ml after day 42, which was significantly lower than that of the control group GnRH-I at the same time. Q The average level of hormones in the central nervous system of the mice immunized with aluminum hydroxide was about 22.7 times lower; E -TMV + aluminum hydroxide adjuvant immunization mice 42 days after the average testosterone level remained stable at about 0.22ng / ml, compared with the control group GnRH-I at the same time E The average central nervous system hormone level in mice immunized with GnRH-I-TMV plus aluminum hydroxide was approximately 25.1 times lower. This clearly demonstrates that the GnRH-I-TMV plus adjuvant immunization group has a more significant inhibitory effect on mouse testosterone. However, the GnRH-I-AP205 virus-like particles constructed in the control group did not suppress mouse testosterone levels to the same extent as GnRH-I-TMV, failing to achieve a similar effect.

[0105] Mice were sacrificed on day 70, and the testicles were removed and weighed before being fixed in 4% formaldehyde.

[0106] Figure 4 shows that the testicular weight of mice immunized with GnRH-I+aluminum hydroxide adjuvant did not decrease substantially on day 70. Q -The testicular weight of mice immunized with TMV virus-like particles and aluminum hydroxide adjuvant was reduced by 79.8%, and mice receiving GnRH-I E Testicular weight decreased by 79.2% in mice immunized with GnRH-I-TMV VLPs and aluminum hydroxide adjuvant, demonstrating that the GnRH-I-TMV vaccine combined with an adjuvant has a more pronounced inhibitory effect on the mouse testicles. In the control group, the GnRH-I-AP205 VLPs, a comparative construct, reduced testicular weight by 76.9%, a lesser effect than the GnRH-I-TMV VLPs and aluminum hydroxide adjuvant group.

[0107] Example 5: Testicular volume determination of experimental cats

[0108] Six healthy, 12-month-old male rural cats were divided into two groups of three: one injected and the other a control. The injected group received a 1:1 volume ratio of GnRH-I-TMV mixed with aluminum hydroxide adjuvant (200 μg) subcutaneously injected behind the ear. Twenty-eight days later, a second injection was administered using the same route. The control group received no injection. All animals were housed individually under the same conditions.

[0109] After the first vaccination, measure the width and length of the testicles with a vernier caliper or tape measure every 14 days and calculate the testicular volume using the following formula:

[0110] Testicular volume = (width / 4) × (length / 2) × 4 / 3 × 3.14.

[0111] As shown in Figure 5, the testicular volume of the male cats in the injection group decreased, while the testicular volume of the male cats in the control group increased. This clearly shows that the vaccine combining GnRH-I-TMV with adjuvant has a significant inhibitory effect on the cat's testicles.

[0112] Example 6: Determination of pregnancy status of experimental cats

[0113] Six healthy rural male cats and four female dogs aged 12-24 months were divided into two groups, with three male cats and two female dogs in each group. One group was the injection group and the other was the control group.

[0114] The injected group received a subcutaneous injection of 200 μg of GnRH-I-TMV plus adjuvant behind the ear and neck. Twenty-eight days later, a second injection was administered through the same route. The control group received no injection. All experimental cats were housed individually under the same conditions.

[0115] Eight healthy male dogs aged 12 to 24 months and 12 healthy female cats aged 12 to 14 months were cage-paired with the injected and control groups. Fourteen days after the second injection, the three male cats in the injected and control groups were cage-paired with two healthy female cats, respectively; and the four female dogs in the injected and control groups were cage-paired with two healthy male dogs, respectively. Each group was rotated to breed to minimize behavioral incompatibilities between cats and dogs that could affect successful pairing.

[0116] After the cohabitation test begins, examine the females in the experimental group and their cohabiting females for pregnancy. After 30 days of observation, perform ultrasound to check for pregnancy.

[0117] As can be seen from Table 1, none of the female animals in the injection group and the paired female animals became pregnant, while the female animals in the control group and the paired female animals became pregnant, indicating that GnRH-I-TMV+adjuvant has a good castration effect on cats and dogs and is suitable for the development of castration vaccines for cats and dogs.

[0118] Table 1 Pregnancy status of experimental animals

Claims

1. GnRH-VLP recombinant protein, characterized in that Includes GnRH-I and capsid protein of tobacco mosaic virus.

2. The recombinant protein according to claim 1, characterized in that GnRH-I and the capsid protein of tobacco mosaic virus were non-covalently linked by biotin and streptavidin to obtain GnRH-I-TMV particles; GnRH has an amino acid sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2; The capsid protein of tobacco mosaic virus has the amino acid sequence shown in SEQ ID NO:

5.

3. Biomaterial, characterized in that Include any of the following: 1), a nucleic acid encoding the recombinant protein according to claim 1; II), an expression unit containing the nucleic acid described in I); III), a recombinant vector containing the nucleic acid described in I) or the expression unit described in II); IV), a host cell transformed or transfected with the expression vector described in III); V) and IV) the culture products of the host cells.

4. The method for preparing the recombinant protein according to claim 1 or 2, characterized in that: The method comprises culturing the host cell described in claim 3 to obtain a culture product containing the recombinant protein described in claim 1; Or it includes preparing GnRH-I protein and capsid protein of tobacco mosaic virus separately, and obtaining the recombinant protein of claim 1 or 2 through coupling.

5. Use of the recombinant protein according to claim 1 or 2, the biological material according to claim 3 or the product obtained by the preparation method according to claim 4 in the preparation of a subunit vaccine for animal castration.

6. A vaccine, characterized in that The invention comprises the recombinant protein according to claim 1 or 2 and an adjuvant.

7. The vaccine according to claim 6, characterized in that The adjuvant is aluminum hydroxide adjuvant.

8. The method for preparing the vaccine according to claim 6 or 7, characterized in that: The method comprises mixing the recombinant protein according to claim 1 or 2 with an adjuvant.

9. The preparation method according to claim 8, characterized in that: The volume ratio of the mixture is 1:

1.

10. A method for castration of an animal, characterized in that: Comprising administration of the vaccine of claim 6 or 7.

Images