Method for preparing bacterial expression liquid by using hpRNA of v-atpase d gene of malacosoma neustria and application thereof

By constructing the MS2+hpV-ATPase D expression vector, the bacterial expression solution was used to protect the V-ATPase D gene hpRNA from degradation in the fall webworm, thus solving the problem of nuclease degradation in RNAi control and achieving a highly efficient and environmentally friendly control effect against the fall webworm.

CN120173946BActive Publication Date: 2025-12-16ANHUI AGRICULTURAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510319638.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-18
Publication Date
2025-12-16
Estimated Expiration
2045-03-18

AI Technical Summary

Technical Problem

Existing technologies using RNAi to control fall webworm suffer from the problem of highly active nucleases in the insect gut degrading hpRNA, resulting in low control efficiency. Furthermore, chemical and manual control methods pose risks of environmental pollution and pesticide resistance.

Method used

An MS2+hpV-ATPase D expression vector was constructed, and the hpRNA fragment of the V-ATPase D gene and the MS2 protein gene of the fall webworm were introduced into bacterial competent cells. Expression was induced by IPTG, and nanoparticles were formed to protect the hpRNA from degradation. The bacterial expression solution was then prepared for the control of fall webworm.

Benefits of technology

It significantly reduces the survival rate and larval weight of the fall webworm, providing an efficient, rapid, and environmentally friendly control method and expanding the reference ideas for biological control.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120173946B_ABST
    Figure CN120173946B_ABST
Patent Text Reader

Abstract

The application discloses a method for preparing a bacterial expression liquid by using a Malacosoma americanum V-ATPase D gene hpRNA and application thereof, and is based on a targeted Malacosoma americanum V-ATPase D gene hpRNA fragment and a virus-like particle MS2 protein gene to construct an hpV-ATPase D expression vector or an MS2+hpV-ATPase D expression vector, which is introduced into a bacterial competent cell, and MS2 protein and the targeted Malacosoma americanum V-ATPase D gene hpRNA are continuously and massively expressed by IPTG induction, so as to obtain the bacterial expression liquid, wherein the MS2 protein expressed by the MS2 protein gene is protected from being degraded by a nuclease by encapsulation, and the hpRNA of the Malacosoma americanum V-ATPase D gene has good stability; experiments show that the hpV-ATPase D and the MS2+hpV-ATPase D both have a high lethal rate on the Malacosoma americanum and have a significant inhibiting effect on development and reproduction of the Malacosoma americanum. The application uses the bacterial expression liquid containing the Malacosoma americanum V-ATPase D gene hpRNA to control the Malacosoma americanum, and has the characteristics of strong practicability, convenience, rapidness, high efficiency and sensitivity, and provides a theoretical basis for research on Malacosoma americanum control methods.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, and particularly relates to a method for preparing a bacterial expression liquid by using hpRNA of V-ATPase D gene of Hyphantria cunea and application thereof. BACKGROUND

[0002] Hyphantria cunea belongs to Lepidoptera Noctuidae Arctiinae, and is also called autumn moth or net moth. Due to its strong reproductive ability, fast spreading speed, wide host and serious damage, it has been listed as an international quarantine pest.

[0003] In view of the difficulty in preventing and controlling Hyphantria cunea, the current prevention and control measures for the pest include chemical control, artificial control and biological control. The chemical control method has the characteristics of quick effect and practicality, and the prevention and control of Hyphantria cunea mainly includes the "eradication" measure at the initial stage, and the measure of spraying a large amount of pesticides. However, the chemical control method has the problems of pollution to the ecological environment, hidden danger to the safety of human and livestock, and the development of resistance of Hyphantria cunea due to long-term use of chemical pesticides, which increases the difficulty of future prevention and control. The artificial control mainly includes artificial pest control, grass enclosure pupa induction, artificial pupa searching and light killing, which has the advantages of simplicity and less environmental pollution, but is time-consuming and laborious, and is not suitable for the areas where Hyphantria cunea occurs in a large area.

[0004] The biological control measures mainly include the use of natural enemies, biocontrol bacteria, Bacillus thuringiensis delta-endotoxin (Bt protein) and RNA interference (RNAi). The research on biological control of Hyphantria cunea mainly focuses on natural enemies and Hyphantria cunea nuclear polyhedrosis virus HcNPV, and certain achievements have been made in sex pheromones and biocontrol bacteria in practical application. It is found that natural enemies such as parasitic wasp Diglyphus begini and baculovirus can effectively control the population number of Hyphantria cunea, but there are few natural enemies that can completely control the outbreak of Hyphantria cunea. When natural enemies are used to control Hyphantria cunea, the outbreak of Hyphantria cunea can only be prevented, but the prevention period is long, and more natural enemy resources need to be explored. Biocontrol bacteria are broad-spectrum insect pathogenic fungi, and their hosts include 15 families of Lepidoptera, Coleoptera and Hymenoptera. Similar to the use of natural enemies to control Hyphantria cunea, the use of biocontrol bacteria to control Hyphantria cunea has a long prevention period and can only effectively prevent the outbreak of Hyphantria cunea. Bacillus thuringiensis is a gram-positive soil bacillus, which produces many proteins during spore formation and appears in the form of crystals, which is called parasporal crystal protein and has specific insecticidal activity. It has good control effect on Lepidoptera, Diptera and Coleoptera. However, in recent years, more and more studies have reported that insects have developed resistance to it, resulting in reduced control effect, and non-target pests such as damsel and leaf mite gradually rise as dominant pests due to the reduction of pesticide spraying amount.

[0005] RNAi (RNAi) technology, as a novel and highly targeted pest control method, is a highly conserved self-defense mechanism in eukaryotic evolution, used to regulate gene expression in eukaryotic cells. It is a post-transcriptional sequence-specific silencing phenomenon triggered by hpRNA, exhibiting high specificity and efficiency. Currently, RNAi technology has shown great potential for controlling various pests, including Lepidoptera, Hemiptera, and Coleoptera, and has been proven to effectively reduce the expression level of target genes in the fall webworm (Pterygodium japonicum), making it a potential control method for this pest. Similar to other Lepidoptera pests, the fall webworm's gut contains highly active nucleases that degrade hpRNA, and there may be a problem with the low efficiency of hpRNA internalization into insect cells. These two factors severely limit the efficiency of RNAi in controlling Lepidoptera pests. Therefore, exploring the key target genes for RNAi control of the fall webworm and optimizing hpRNA delivery methods are crucial for the biological control of the fall webworm and the future construction of RNAi transgenic lines. Summary of the Invention

[0006] Technical Problem to be Solved: To address the aforementioned technical problems, the present invention aims to provide a method for preparing bacterial expression fluid using the V-ATPase D gene hpRNA from the fall webworm (Moth simonii). The method involves constructing an MS2+hpV-ATPase D expression vector using a fragment of the V-ATPase D gene hpRNA from the fall webworm and the MS2 protein gene, then introducing this vector into competent bacterial cells. After IPTG induction, the V-ATPase D gene hpRNA from the fall webworm is continuously expressed in large quantities, thus obtaining the bacterial expression fluid. In this invention, the MS2 protein gene can be expressed in competent bacterial cells to obtain the MS2 protein, which can protect the V-ATPase D gene hpRNA from degradation by nucleases, giving it good stability. Furthermore, feeding the bacterial expression fluid to the fall webworm results in a high mortality rate and significantly inhibits its development and reproduction. This invention utilizes bacterial expression fluid containing the V-ATPase D gene hpRNA from the fall webworm to control it. It is practical, convenient, rapid, highly efficient, and sensitive, providing a sound theoretical basis for research on fall webworm control methods.

[0007] Technical solution: A V-ATPase D gene hpRNA of the American white moth, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0008] A method for preparing a bacterial expression liquid using the V-ATPase D gene hpRNA of Hyphantria cunea and application thereof, comprising the following steps: S1. Using the cDNA of Hyphantria cunea as a template, PCR amplification is performed using dsV-ATPase-D primers to obtain a V-ATPase D gene hpRNA fragment of Hyphantria cunea;

[0009] S2. The V-ATPase D gene hpRNA fragment of Hyphantria cunea is connected to a plasmid to construct an hpV-ATPaseD expression vector; or the V-ATPase D gene hpRNA fragment of Hyphantria cunea and the MS2 protein gene fragment are connected to a plasmid to construct an MS2+hpV-ATPaseD expression vector, and the plasmid maps of the hpV-ATPaseD expression vector and the MS2+hpV-ATPaseD expression vector are as shown in Figure 1

[0010] S3. The hpV-ATPaseD expression vector or the MS2+hpV-ATPaseD expression vector is introduced into a bacterial competent cell culture, IPTG induction culture is performed, and bacterial liquid is collected, which is a bacterial expression liquid.

[0011] Further, the dsV-ATPase-D primers in step S1 are dsV-ATPase-D-F and dsV-ATPase-D-R.

[0012] Further, the nucleotide sequence of the dsV-ATPase-D-F is shown in SEQ ID NO. 2.

[0013] Further, the nucleotide sequence of the dsV-ATPase-D-R is shown in SEQ ID NO. 3.

[0014] Further, the nucleotide sequence of the MS2 protein gene in step S2 is shown in SEQ ID NO. 4.

[0015] The bacterial expression liquid of any one of the above is applied to the prevention and control of Hyphantria cunea.

[0016] Further, the prevention and control of Hyphantria cunea is achieved by spraying or feeding the bacterial expression liquid.

[0017] Beneficial effects:

[0018] ​1. The important RNAi target gene V-ATPase D gene of Malacosoma americanum is screened in the application, and the hpV-ATPase D expression vector is constructed based on the hpRNA of the V-ATPase D gene of Malacosoma americanum by being connected to a recombinant plasmid, then the hpV-ATPase D expression vector is introduced into competent cells of Escherichia coli, and the hpRNA of the V-ATPase D gene of Malacosoma americanum is successfully expressed by IPTG induction, the bacterial expression liquid is obtained, the bacterial expression liquid is smeared on leaves to feed Malacosoma americanum, and the survival rate and the weight of larvae of Malacosoma americanum can be significantly reduced, so that the purpose of efficiently preventing and treating Malacosoma americanum is achieved.

[0019] 2. The MS2 protein gene is connected to the plasmid to construct the MS2+hpV-ATPase D expression vector while the hpRNA of the V-ATPase D gene of Malacosoma americanum is connected to the recombinant plasmid, then the MS2+hpV-ATPase D expression vector is introduced into competent cells of Escherichia coli, and the hpRNA of the V-ATPase D gene of Malacosoma americanum and the MS2 protein are successfully expressed by IPTG induction, because there is a high-activity nuclease which can degrade the hpRNA in the intestinal tract of Malacosoma americanum, and the internalization of the hpRNA into insect cells is low, so the hpRNA of the V-ATPase D gene of Malacosoma americanum contains a PAC site, can be wrapped in the hpRNA by the MS2 protein, and the MS2 protein is self-assembled into nanoparticles, so that the hpRNA of the V-ATPase D gene of Malacosoma americanum is effectively prevented from being degraded, and an effective RNAi reaction is caused in the cells of Malacosoma americanum.

[0020] 3. The method for preventing and treating Malacosoma americanum by using the bacterial expression liquid containing the hpRNA of the V-ATPase D gene of Malacosoma americanum has the advantages of strong practicability, convenient operation, high efficiency and sensitivity, high insecticidal efficiency, and is helpful to expand new reference ideas for the prevention and treatment method of Malacosoma americanum. BRIEF DESCRIPTION OF DRAWINGS

[0021] Figure 1 The plasmid maps of the hpV-ATPase D expression vector and the MS2+hpV-ATPase D expression vector are shown in the following figure;

[0022] Figure 2 The expression of the hpRNA of the V-ATPase D gene of Malacosoma americanum induced by IPTG in example 4 and example 5 is shown in the following figure;

[0023] Figure 3 The expression of the MS protein induced by IPTG in example 4 and example 5 is shown in the following figure;

[0024] Figure 4 The relative expression level of the V-ATPase D gene of Malacosoma americanum in example 4 and example 5 is shown in the following figure;

[0025] Figure 5Example 4 and Example 5 for Malacosoma neustria survival rate;

[0026] Figure 6 Example 4 and Example 5 for Malacosoma neustria larva weight;

[0027] Figure 7 Example 4 and Example 5 for Malacosoma neustria larva phenotype difference. DETAILED DESCRIPTION

[0028] The application will be further described in conjunction with examples below, and the following examples are an explanation of the application and the application is not limited to the following examples:

[0029] Example 1

[0030] Synthesis of Malacosoma neustria V-ATPase D gene hpRNA

[0031] Step 1. Taking Malacosoma neustria cDNA as a template, the Primer Premier 5 software is used to design specific primers for Malacosoma neustria V-ATPase D gene sequence and add T7 promoter sequence at both ends, wherein the dsV-ATPase-D primer is dsV-ATPase-D-F and dsV-ATPase-D-R, the nucleotide sequence of dsV-ATPase-D-F is TAATACGACTCACTA TAGGG TTGTGCTGCAGAACGTCACT; the nucleotide sequence of dsV-ATPase-D-R is TAATACGACTCACTATAGGG GGAGTTGCCTGGGTCTTGAG;

[0032] Step 2. The V-ATPase D gene is amplified from Malacosoma neustria cDNA by PCR, and ApexHF HS DNA polymerase premix-FS high-fidelity enzyme of Aikewei Company is used for PCR amplification reaction of the target gene; the reaction system (50 μL) is as shown in Table 1:

[0033] Table 1 Reaction system component composition

[0034] Component Name Addition Addition 2X Apex HFFS PCR Master Mix 1x 25 μL Template ≤ 200 ng - Primer F (10 μM) 0.2 μM 1 μL Primer R (10 μM) 0.2 μM 1 μL RNase free water - Upto 50 μL

[0035] The PCR amplification program is: 94℃ pre-denaturation for 1 min, 98℃ denaturation for 10 s, 55℃ annealing for 30 s, 72℃ extension for 1 min, 30 cycles are set, 72℃ thorough extension for 2 min; agarose gel electrophoresis and gel imaging system are used for detection to check whether there is a single band at the target position, and the agarose gel at the target band is cut off, and then the Novizhan Company gel recovery kit is used to recover the target gene DNA fragment;

[0036] Step 3. Then use T7 RiboMAX TM hpRNA in vitro synthesis was performed using the Express RNAi System (Promega) kit, including the following procedures:

[0037] ① Set up a proper size of reaction system for the target gene DNA fragment at room temperature, and the T7 reaction system is shown in Table 2;

[0038] Table 2 Composition of T7 reaction system

[0039]

[0040]

[0041] ② Gently mix and incubate at 37°C for 30 minutes;

[0042] ③ When annealing the RNA strand, first mix equal volumes of complementary RNA reaction solution, then incubate at 70°C for 10 min, and slowly cool to room temperature (about 20 min) to achieve annealing of double-stranded RNA;

[0043] ④ Add 1 μL RNase to 199 μL nuclease-free water to dilute the accompanying RNAse solution (1:200), for every 20 μL of reaction volume, add 1 μL of freshly diluted RNAse solution and 1 μL of RQ1 RNase-Free DNase, and incubate at 37°C for 30 min to remove all residual single RNA and DNA templates, leaving only double-stranded RNA;

[0044] ⑤ Add 0.1 volume of 3M sodium acetate (pH 5.2) and 1 volume of isopropanol, mix well and place on ice for 5 min;

[0045] ⑥ Place in a microcentrifuge and centrifuge at the highest speed for 10 min, carefully pour or pipette the supernatant, and wash the precipitate with 0.5 mL of 70% cold ethanol;

[0046] ⑦ Carefully pipette all the ethanol, place the precipitate at room temperature and air dry for 15 min, then resuspend the RNA sample in nuclease-free water and store at -80°C, thereby obtaining the hpRNA fragment of the V-ATPase D gene of Hyphantria cunea, the nucleotide sequence of which is shown as SEQ ID NO. 1.

[0047] Example 2

[0048] Construction of hpV-ATPase D expression vector

[0049] The hpRNA fragment of V-ATPase D gene of Malacosoma neustria synthesized in Example 1 was ligated to a plasmid to construct an hpV-ATPase D expression vector, as follows:

[0050] (1) pet28a was selected as the expression of hpV-ATPase D. Whether XhoI, BamHI and HindIII restriction enzyme sites were present on the sequence of V-ATPase D searched in SnapGene software, then the predicted gene fragment was redesigned with Primer Primer 5, and XhoI, BamHI and HindIII restriction enzyme site sequences were added to the primers;

[0051] (2) XhoI and BamHI enzyme sites were introduced into the single target sequence fragment by PCR, and the target sequence was connected with intron (intron sequence from GA2024) by overlap PCR, and BamHI and HindIII enzyme sites were introduced;

[0052] (3) The target sequence fragment and the target sequence+intron fragment with introduced corresponding enzyme sites were recovered by Novizen gel recovery kit;

[0053] (4) The recovered fragments were inserted into TA / Blunt-Zero cloning vector and transformed into E. coli. Bacterial liquid PCR and plasmid sequencing were used to screen the correct plasmid for subsequent experiments. The plasmid digestion system is shown in Table 3;

[0054] Table 3 Composition of plasmid digestion system of hpV-ATPase D expression vector in Example 2

[0055]

[0056]

[0057] After gentle mixing, transient centrifugation was performed at 37°C for 1h, and agarose gel electrophoresis was performed to detect whether the plasmid was completely cut. The target gene fragment and the vector fragment were recovered by cutting the gel, respectively;

[0058] (5) The double-digested target fragment and the vector pET-28a(+) gel recovery product were ligated with DNA Ligation Kit, and the ligation system is shown in Table 4,

[0059] Table 4 Composition of ligation system

[0060] Component Name Addition Solution I 9 μL Double digested pET-28a(+) 4 μL DNA fragment of interest 5 μL

[0061] After mixing, centrifuge briefly at 16°C for 30 min. After the reaction is completed, add 2 μL Solution III to improve the conversion efficiency, and transfer the reaction solution to HT115 (DE3) competent cells for plaque screening. Select the correct strain for subsequent use by sequencing.

[0062] Example 3

[0063] Construction of MS2+ hpV-ATPase D expression vector

[0064] The hpRNA fragment of the V-ATPase D gene of Hyphantria cunea synthesized in Example 1 and the MS2 protein gene fragment are linked to the plasmid to construct the MS2+ hpV-ATPase D expression vector, as follows:

[0065] (1) Select pMS2 as the vector for expressing hpV-ATPase D. Check whether the sequence of V-ATPase D in SnapGene software contains XhoI, BamHI, and HindIII restriction enzyme sites, then redesign the predicted gene fragment using Primer Primer 5, and add XhoI, BamHI, and HindIII restriction enzyme site sequences to the primer;

[0066] (2) Introduce XhoI and BamHI enzyme sites into the single target sequence fragment using PCR, and then use overlapping PCR to connect the target sequence to the intron (intron sequence from GA2024) and introduce BamHI and HindIII enzyme sites;

[0067] (3) Recover the target sequence fragment with the introduced enzyme site and the target sequence+intron fragment using the Novagen gel recovery kit;

[0068] (4) Insert the recovered fragments into the TA / Blunt-Zero cloning vector and transfer them into E. coli. Use bacterial liquid PCR and plasmid sequencing to screen the correct plasmid for subsequent experiments. The plasmid digestion system is shown in Table 5.

[0069] Table 5 Composition of plasmid digestion system for MS2+ hpV-ATPase D expression vector in Example 3

[0070] Component Name Addition 10X QuickCut Green Buffer 5 μL Plasmid 5 μL QuickCut BamHI 1 μL QuickCut XhoI / HindIII 1 μL Sterile water upto 50 μL

[0071] After gentle mixing, centrifuge briefly at 37°C for 1 h. Use agarose gel electrophoresis to detect whether the plasmid is completely cut, and recover the target gene fragment and the vector fragment by cutting the gel.

[0072] (5) The double-digested target fragment and the recovered product of the vector pET-28a(+) were connected by using a DNA Ligation Kit, and the connection system is shown in Table 6.

[0073] Table 6 Component composition of connection system

[0074] Component Name Addition Solution I 9 μL Double digested pET-28a(+) 4 μL DNA fragment of interest 5 μL

[0075] After mixing, centrifugation for a short time, reaction at 16℃ for 30min, after the reaction, 2μL Solution III was added to improve the transformation efficiency, the reaction solution was transformed into HT115(DE3) competent cells, and spot selection sequencing was performed to screen out the correct strain for subsequent use.

[0076] Example 4

[0077] A method for preparing a bacterial expression solution expressing hpRNA of the V-ATPase D gene of Hyphantria cunea, comprising the following steps:

[0078] S1. The hpV-ATPase D expression vector prepared in Example 2 was introduced into E. coli competent cells for culture to form a transformed colony,

[0079] S2. The transformed colony was cultured in LB medium containing 50μg / mL kanamycin, and was shaken at 37℃ and 200rpm for 16h to prepare a culture solution;

[0080] S3. 1mL of the culture solution was added to 100mL of fresh LB medium containing 50μg / mL kanamycin, and was shaken at 37℃ and 200rpm until the bacteria reached the exponential growth phase (i.e. OD 600 =0.6-0.8); then IPTG was added to a final concentration of 0.6mM for induction, and the culture was incubated at 37℃ for 5h, and the bacterial solution was collected as the bacterial expression solution, denoted as hpV-ATPase D.

[0081] Example 5

[0082] A method for preparing a bacterial expression solution expressing hpRNA of the V-ATPase D gene of Hyphantria cunea, comprising the following steps:

[0083] S1. The MS2+hpV-ATPase D expression vector prepared in Example 3 was introduced into E. coli competent cells for culture to form a transformed colony;

[0084] S2. The transformed colony was cultured in LB medium containing 50μg / mL kanamycin, and was shaken at 37℃ and 200rpm for 16h to prepare a culture solution;

[0085] S3. Add 1 mL of the culture into 100 mL of fresh LB medium containing 50 μg / mL kanamycin and incubate at 37 °C, 200 rpm, until the bacteria reach the exponential growth phase (i.e. OD 600 = 0.6-0.8); then add IPTG to a final concentration of 0.6 mM to induce and incubate at 37 °C for 6 h. Collect the bacterial culture to obtain the bacterial expression liquid, which is denoted as MS2+hpV-ATPase D.

[0086] Performance test

[0087] (1) Expression of hpRNA of the V-ATPase D gene of Malacosoma neustria in the expression vector induced by IPTG

[0088] Centrifuge the bacterial expression liquid prepared in Example 4 and Example 5 at 7000 g for 10 min to extract total RNA. Use TRNzol Universal Reagent to extract the total RNA according to the instructions. Treat the extracted RNA with RNase at 37 °C for 30 min to remove single-stranded RNA. Electrophorese the RNA on a 1% agarose gel to confirm the expression of hpRNA. Use real-time fluorescent quantitative PCR to detect the content of hpRNA in the bacterial expression liquid. Culture the bacteria without adding IPTG under the same conditions as the control group.

[0089] As shown in FIG. 2, the hpRNA of hpGFP, MS2+hpGFP, hpV-ATPase D and MS2+hpV-ATPase can be successfully induced and expressed after IPTG induction, and the fragment size is consistent with the expected size. Figure 2 The results show that the transformed colonies of Example 4 and Example 5 can successfully express hpRNA of the V-ATPase D gene of Malacosoma neustria in E. coli after IPTG induction.

[0090] (2) Expression of the MS2 protein gene in the expression vector induced by IPTG

[0091] Centrifuge the bacterial expression liquid prepared in Example 5 at 7000 g for 10 min to extract total protein. Use RIPA lysis buffer to extract the total protein according to the instructions. Add SDS-PAGE protein loading buffer to the extracted total protein and treat at 95 °C for 5 min to denature the protein. Confirm the expression of MS2 protein by SDS-PAGE. Culture the bacteria without adding IPTG under the same conditions as the control group.

[0092] As shown in FIG. 3, the MS2 protein can be successfully induced and expressed after IPTG induction. Figure 3It can be seen that, after IPTG induction, both bacterial cultures expressing MS2 and MS2+hpV-ATPase can be successfully induced to express MS2, and the fragment size is consistent with the expectation. However, bacterial cultures that have not been induced by IPTG and do not contain the MS2 expression cassette do not express MS2 protein. The results show that the transformed colonies in Example 5 successfully expressed MS2 virus protein in Escherichia coli after IPTG induction. (3) Verification test of the control effect of bacterial expression solution on fall webworm.

[0093] The efficacy of the bacterial expression solutions prepared in Examples 4 and 5 against the fall webworm was determined. A negative control group (denoted as hpGFP) and an MS2 group (denoted as MS2) were included. The specific method for preparing the hpGFP expression vector is as follows:

[0094] ① Pet28a was selected as the vector for expressing hpGFP. The SnapGene software was used to search for the presence of three restriction endonuclease sites, XhoI, BamHI and HindIII, on the green fluorescent protein (GFP) sequence. Then, primers were redesigned using Primer Primer 5 for the predicted gene fragments, and primers containing XhoI, BamHI and HindIII restriction endonuclease site sequences were added to the primers.

[0095] ② The two restriction sites, XhoI and BamHI, were introduced into a single target sequence fragment using PCR. Then, overlapping PCR was used to link the target sequence to an intron (an intron sequence from GA2024) and introduce the two restriction sites, BamHI and HindIII.

[0096] ③ The target sequence fragment and the target sequence + intron fragment with corresponding restriction sites were recovered using the Novizan gel recovery kit. The recovered fragments were inserted into the TA / Blunt-Zero cloning vector and transformed into E. coli. The correct plasmids were screened for subsequent experiments using bacterial PCR and plasmid sequencing.

[0097] ④ The fragments on the T vector and the backbone of pet28a were recovered by enzyme digestion. Then, the two gene fragments and the vector backbone fragment were ligated together using ligase. The mixture was then transformed, bacteria were selected, and sequencing was performed. The plasmid with the correct sequencing was selected and designated as the hpGFP expression vector. The nucleotide sequence of the hpGFP is shown in SEQ ID NO.5.

[0098] The expression vector for the MS2 protein in the MS2 group was the pMS2 vector that had been previously constructed in the laboratory.

[0099] Depend on Figure 4 It can be seen that when the bacterial concentration is 5×10 9The down-regulation of the target gene of the group fed with the bacterial solution expressing MS2+hpV-ATPase D is significantly higher than that of the treatment group fed with the bacterial solution expressing only hpV-ATPase D at the concentration of 5×10 Figure 5 It can be seen that the bacterial solution expressing MS2+hpV-ATPase D has better insecticidal effect than the bacterial solution expressing only hpV-ATPase D at the concentration of 5×10 9 It can be seen that the bacterial solution expressing MS2+hpV-ATPase D has better insecticidal effect than the bacterial solution expressing only hpV-ATPase D at the concentration of 5×10 Figure 6 and Figure 7 It can be seen that the bacterial solution expressing MS2+hpV-ATPase D has better insecticidal effect than the bacterial solution expressing only hpV-ATPase D at the concentration of 5×10 9 The weight of the larvae of the group fed with the bacterial solution expressing MS2+hpV-ATPase D is significantly lower than that of the treatment group fed with the bacterial solution expressing only hpV-ATPase D at the concentration of 5×10

[0100] The above is only the preferred embodiment of the present application, and does not limit the present application in any form. Any person skilled in the art can make many possible changes and modifications to the technical solutions of the present application, or modify equivalent embodiments, without departing from the spirit and technical solutions of the present application. Therefore, any simple modification, equivalent replacement, equivalent change and modification of the above embodiments according to the technical essence of the present application, which does not depart from the technical solutions of the present application, still belongs to the protection scope of the technical solutions of the present application.

Claims

1. A hpRNA of V-ATPase D gene of Malacosoma neustria, characterized in that, The nucleotide sequence of the hpRNA of the V-ATPase D gene of the American white moth is shown as SEQ ID NO.

1.

2. A method for preparing a bacterial expression liquid using Malacosoma neustria V-ATPase D gene hpRNA, characterized in that, The method comprises the following steps: S1. Using the cDNA of the American white moth as a template, PCR amplification is performed using dsV-ATPase-D primers to obtain the hpRNA fragment of the V-ATPase D gene of the American white moth according to claim 1; the dsV-ATPase-D primers are dsV-ATPase-D-F and dsV-ATPase-D-R; the nucleotide sequence of the dsV-ATPase-D-F is shown as SEQ ID NO. 2; the nucleotide sequence of the dsV-ATPase-D-R is shown as SEQ ID NO. 3; S2. The hpRNA fragment of the V-ATPase D gene of the American white moth is connected to a plasmid to construct an hpV-ATPaseD expression vector; or the hpRNA fragment of the V-ATPase D gene of the American white moth and a MS2 protein gene fragment are connected to a plasmid to construct an MS2+hpV-ATPaseD expression vector; S3. The hpV-ATPase D expression vector or the MS2+hpV-ATPase D expression vector is introduced into a bacterial competent cell culture, IPTG induction culture is performed, and bacterial liquid is collected, which is a bacterial expression liquid.

3. The method for preparing bacterial expression liquid by using the hpRNA of V-ATPase D gene of Hyphantria cunea according to claim 2, characterized in that: The nucleotide sequence of the MS2 protein gene in the step S2 is shown as SEQ ID NO.

4.

4. The application of the bacterial expression liquid prepared by the method according to any one of claims 2-3 in the prevention and control of the American white moth.

5. Use according to claim 4, characterized in that, The prevention and control of the American white moth is achieved by spraying or feeding the bacterial expression liquid. The prevention and control of the American white moth is achieved by spraying or feeding the bacterial expression liquid.

Citation Information

Patent Citations

  • Preparation method of virus-like particles for preventing and treating cotton bollworms, method for resisting cotton bollworms and application of virus-like particles

    CN111387213A

  • Hyphantria cunea vATPase A gene dsRNA and bacterial expression liquid and application thereof

    CN113430200A