Application of moxidectin in preparation of medicine for resisting akabane virus

Abstract

The invention belongs to the technical field of biology, and particularly discloses application of moxidectin in preparation of drugs for resisting akabane viruses, it is found that the moxidectin is free of cytotoxicity on MDBK cells by determining the cytotoxicity after AKAV infection, it is found that the moxidectin can serve as an AKAV inhibitor through RT-qPCR, WB and IFA, and the application of the moxidectin in preparation of the drugs for resisting the akabane viruses in preparation of the drugs for resisting the akabane viruses in preparation of the drugs for resisting the akabane viruses in preparation of the drugs for resisting the akabane viruses is achieved. According to the present invention, the akabane virus growth can be inhibited and / or the akabane virus GC protein expression quantity can be reduced, the good inhibition effect on the AKAV virus can be provided when the concentration is 1.25-10 [mu] M, and the new candidate drug is provided for the prevention and treatment of the AKAV virus infection.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, in particular to application of moxidectin in preparing medicines for resisting Akabane virus. Background Art

[0002] Moxidectin, chemically known as [6R,23E,25S(E)]-5-O-demethyl-28-deoxy-25-(1,3-dimethyl-1-butenyl)-6,28-epoxy-23-(methoxyimino)milbemycin, was developed collaboratively by Wyeth (a subsidiary of Pfizer) and the World Health Organization (WHO). It is a macrolide anthelmintic antibiotic approved for the treatment of human onchocerciasis. Moxidectin exhibits significant antiparasitic efficacy and has been shown to be effective against strongyloidiasis, filariasis, soil-transmitted helminthiasis, trichinosis, and scabies. Furthermore, studies have shown that moxidectin exhibits antiviral activity against some viruses, such as influenza H9. Overall, moxidectin has considerable antiviral potential.

[0003] Akabane virus (AKAV) is a member of the Orthobunyavirus genus of the Peribunyaviridae family. It is a single-stranded, negative-sense RNA virus. Its genome consists of three segments: the L segment, which encodes transcription and replication enzymes; the M segment, which encodes two glycoproteins (GC and GN) and a nonstructural protein (NSm); and the S segment, which encodes the nucleocapsid protein (N) and nonstructural protein (NSs). AKAV infection can cause a polymorphic infectious disease characterized by abortion, premature birth, stillbirth, congenital arthrogryposis, hydrocephalus, and encephalomyelitis in cattle and sheep. However, no drugs are currently available for AKAV, and the development of an effective and viable drug based on moxidectin is urgently needed. Summary of the Invention

[0004] In order to solve the above technical problems, the present invention provides the use of moxidectin in the preparation of anti-Akabane virus drugs, anti-Akabane virus: inhibiting the growth of Akabane virus and / or reducing the titer of Akabane virus, inhibiting the growth of Akabane virus and / or reducing the expression of Akabane virus protein, wherein the Akabane virus protein is Akabane virus GC protein.

[0005] To achieve the above object, the present invention is implemented according to the following technical solutions: One of the objects of the present invention is to provide the use of moxidectin as the sole active ingredient in the preparation of a drug against Akabane virus.

[0006] A second object of the present invention is to provide an anti-Akabane virus drug comprising moxidectin.

[0007] Furthermore, the anti-Akabane virus drug also contains a pharmaceutically acceptable carrier and / or excipient.

[0008] Furthermore, the dosage form of the drug is one of tablets, sprays, granules, capsules, oral solutions, injections, and suspensions.

[0009] Compared with the prior art, the present invention determines the cytotoxicity of moxidectin after AKAV virus infection and finds that moxidectin has no cytotoxicity on MDBK cells. RT-qPCR, WB, and IFA reveal that moxidectin can act as an inhibitor of AKAV virus, inhibiting the growth of Akabane virus and / or reducing the expression of Akabane virus GC protein. The invention exhibits a good inhibitory effect on AKAV virus at a concentration of 1.25 to 10 μM, thus providing a new candidate drug for the prevention and treatment of AKAV virus infection. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] Figure 1 is the toxicity of moxidectin in MDBK cells; Figure 2 The inhibitory effect of moxidectin on the AKAV viral genome copy number; Figure 3 The inhibitory effect of moxidectin on the expression of AKAV virus GC protein; Figure 4 This is the immunofluorescence observation result of moxidectin inhibiting Akabane virus. DETAILED DESCRIPTION

[0011] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the embodiments. The specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0012] The bovine kidney (MDBK) cells used in the following examples are maintained by the Guangdong Key Laboratory of Animal Molecular Design and Precision Breeding. MDBK cells are a cell line derived from the kidneys of adult cattle. They can spontaneously differentiate into an epithelial-like monolayer and are an optimal in vitro model for studying anti-Akabane virus drugs. Vero cells are also maintained by the Guangdong Key Laboratory of Animal Molecular Design and Precision Breeding. Vero cells are African green monkey kidney cells, a type of aneuploid cell derived from macaque kidney cells. Like the well-known HeLa cell line and canine kidney cells (MDCK cells), they are commonly used cell lines. All other relevant reagents used, unless otherwise specified, are commercially available. All methods used, unless otherwise specified, are well-known methods.

[0013] The compound used, moxidectin, was purchased from MedChemExpress, and its chemical molecular structure is shown below.

[0014] .

[0015] The Akabane virus strain used was Akabane virus AKAV_FS202301, deposited with CCTCC NO: V2024119, sequence number: PQ567126-PQ567128, subcultured on Vero cells, and the experiment was performed on MDBK cells.

[0016] In order to verify whether moxidectin can be used as the sole active ingredient to prepare drugs against Akabane virus, the following experiments were conducted: 1. Cytotoxicity of moxidectin in MDBK cells A 10 mM moxidectin solution dissolved in 30 μL of dimethyl sulfoxide (DMSO) was serially diluted with basal DMEM medium to obtain moxidectin dilutions with concentrations ranging from 12.5 to 200 μM.

[0017] MDBK cells were cultured at a rate of 1 × 10 5 Cells / well were plated in a 96-well cell plate (culture medium was DMEM medium containing 20% ​​FBS) to obtain a cell plate containing MDBK. The cytotoxicity of moxidectin was tested as follows: The experimental wells were set up as follows: moxidectin solution with final concentrations of 1.25 μM, 2.5 μM, 5 μM, and 10 μM was added to a 96-well culture plate containing MDBK cells, and 8 replicate wells (one column in the 96-well plate) were set up for each concentration of moxidectin solution; the blank wells were set up as: containing only culture medium, recorded as the cell group; the experimental wells were set up as: containing cells, culture medium and moxidectin solution treatment; the control wells were set up as: not treated with moxidectin solution.

[0018] After 24 hours of cell culture (37°C, 5% CO2), 10 μL of CCK-8 solution was added to each well. After incubation in the incubator for 4 hours, the absorbance at 450 nm was measured using a microplate reader, and the cell viability (%) was calculated according to Formula I.

[0019] Formula I: Cell viability (%) = [(OD value of experimental well - OD value of blank well) / (OD value of control well - OD value of blank well)] × 100.

[0020] The cytotoxicity results of moxidectin in MDBK cells are shown in Figure 2. Figure 1 As shown, moxidectin had no cytotoxicity in MDBK cells at concentrations ranging from 1.25 to 10 μM.

[0021] 2. Effect of moxidectin treatment on Akabane virus infection in MDBK cells (1) Effect on the copy number of Akabane virus in MDBK cells MDBK cells (2 × 10 cells / well) were cultured in DMEM medium containing 10% FBS in 12-well plates. 6 Cells were inoculated with AKAV virus (MOI = 1) and treated with moxidectin at varying concentrations (1.25 μM, 2.5 μM, 5 μM, and 10 μM) in the experimental group. The infection control group was treated with AKAV virus (MOI = 1) mixed with DMSO. A blank control group was treated with culture medium without AKAV virus. The cell plates were incubated at 37°C and 5% CO₂ for 24 h. Total cellular RNA was then extracted using the Trozil method and reverse transcribed into cDNA. Finally, viral genome copy number was determined by quantitative PCR targeting the AKAV NSs gene. The total reaction volume was 20 μL, consisting of 10 μL of SYBR Green I, 0.4 μL of upstream and downstream primers, 2 μL of template, and sterile deionized water to 20 μL. The upstream primer sequence was TAAGACGCCACAACCAAGTGT, and the downstream primer sequence was CCGAAATGCGATGGAGCGTA.

[0022] After AKAV virus infection, MDBK cells were treated with moxidectin at different concentrations (1 μM, 1.25 μM, 2.5 μM, 5 μM, and 10 μM). The viral copy number was calculated as follows: Figure 2 The results showed that in MDBK cells, the AKAV viral genome copy number gradually decreased with increasing moxidectin concentration compared to the control group. These results indicate that moxidectin can inhibit AKAV viral replication in a dose-dependent manner.

[0023] (2) Effects on the expression of GC protein of Akabane virus in cells The cell culture, Akabane virus inoculation, and moxidectin treatment methods were the same as described in (1). The specific sample processing method is as follows: discard the cell culture supernatant, rinse three times with PBS, add 1× SDS-PAGE loading buffer and perform protein denaturation treatment (100 ℃, 10 min), then centrifuge for 10 min (12000 r / min), homogenize the protein sample and add it to the sample tank of the gel, electrophoresis (120 V, 30 min), after the bromophenol blue dye drops to the edge of the gel, transfer to a 0.2 μm nitrocellulose membrane (NC membrane) (100 V, 1 h), block with 5% skim milk powder (1 h), discard the skim milk powder and wash the NC membrane with 1× TBST, add the primary antibody and place it in a refrigerator at 4 ℃ overnight, wash the NC membrane with 1× TBST (5 times / 5 min), add the corresponding secondary antibody (incubate for 1 h), wash with 1× TBST (5 times / 5 min), and finally expose with ECL luminescent solution to detect the expression of Akabane virus GC protein.

[0024] After MDBK cells were infected with Akabane virus and treated with different concentrations of moxidectin, the expression of Akabane virus GC protein was as follows: Figure 3 shown.

[0025] The results showed that in MDBK cells, the expression of Akabane virus GC protein gradually decreased with increasing moxidectin concentration compared with the control group. This result indicates that moxidectin can inhibit the replication of Akabane virus.

[0026] (3) Effects on immunofluorescence of ovine Akabane virus in cells The cell culture, Akabane virus inoculation, and moxidectin treatment methods were the same as described in (1). The specific sample processing method is as follows: discard the cell culture supernatant, rinse with PBS three times, and fix with 4% formaldehyde for 30 minutes. Then treat with 0.3% Triton for 10 minutes for permeabilization. Blocking: Block with 5% BSA at room temperature for 1 hour. Then discard the blocking solution and directly add the primary antibody dilution solution (Akabane virus N monoclonal antibody, 1:200 dilution) prepared with 5% BSA, and incubate at 4°C overnight (protect from light). Then, incubate with fluorescent secondary antibody labeled with fluorescein isothiocyanate (FITC) / DPAI staining solution at 37°C for 1 hour. After incubation, discard the antibody, wash three times with PBST, and observe under an inverted fluorescence microscope.

[0027] After MDBK cells were infected with Akabane virus and treated with different concentrations of moxidectin, the results of viral fluorescence observation were as follows: Figure 4As shown, the DAPI group used DPAI staining solution to stain the MDBK cell nuclei; the Anti-N group used fluorescein isothiocyanate (FITC) to label the N protein; the Merge group was a composite image of the DAPI group and the Anti-N group.

[0028] The results showed that in MDBK cells, the fluorescence of Akabane virus decreased significantly with increasing moxidectin concentration compared with the control group. This result indicates that moxidectin can inhibit the replication of Akabane virus.

[0029] In summary, moxidectin can be used as the sole active ingredient to prepare a drug against Akabane virus. Of course, the prepared drug contains moxidectin and also contains a pharmaceutically acceptable carrier and / or excipient; the dosage form of the drug is one of tablets, sprays, granules, capsules, oral solutions, injections, and suspensions.

[0030] The technical solution of the present invention is not limited to the above-mentioned specific embodiments. Any technical variations made according to the technical solution of the present invention fall within the protection scope of the present invention.

Claims

1. The use of moxidectin as the sole active ingredient in the preparation of drugs against Akabane virus.

Images