SNP molecular marker related to luffa pericarp color and application thereof
By developing SNP molecular markers and their primer sets related to the color of loofah peel, and using PCR amplification and fluorescence detection technology, the problem of difficulty in quickly and accurately determining the color of loofah peel in existing technologies has been solved, enabling rapid and accurate identification at the seedling stage and improving breeding efficiency.
Patent Information
- Application Number
- CN202510754965.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-06
- Publication Date
- 2026-05-15
- Estimated Expiration
- 2045-06-06
AI Technical Summary
Existing technologies make it difficult to quickly and accurately determine the color of loofah peel, resulting in a long breeding cycle and susceptibility to environmental influences.
We developed SNP molecular markers and their primer sets related to the color of loofah peel, and achieved rapid and accurate identification of loofah peel color through PCR amplification and fluorescence detection technology.
This technology enables rapid and accurate identification of loofah fruit peel color during the seedling stage, improving breeding efficiency, reducing manpower, material resources, and financial resources required for later planting, and shortening the breeding process.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of molecular biology and crop breeding technology, specifically relating to SNP molecular markers related to the color of loofah peel and their applications. Background Technology
[0002] Luffa is an important multifunctional vegetable. Its fruit is rich in vitamins, amino acids, trace elements, and antioxidants, and has the effects of clearing heat and relieving summer heat, stopping bleeding, and reducing inflammation. It is a multifunctional vegetable that can be used both as food and medicine. In recent years, with people's increasing emphasis on nutrition and health, the planting area of luffa has been increasing year by year, and luffa has become one of the important daily consumed vegetables.
[0003] The color of the loofah peel is the most direct evaluation criterion influencing consumer choice; therefore, peel color is one of the important appearance qualities of loofah fruit and a crucial direction for loofah variety improvement. Due to the long cycle, high difficulty, and susceptibility to environmental influences of conventional loofah breeding methods, targeted improvement of loofah fruit color through molecular marker-assisted breeding is particularly critical and has significant application value. Summary of the Invention
[0004] The present invention aims to discover the key genes associated with the formation of the light green peel of loofah and develop linked molecular markers, thereby enabling rapid and accurate determination of loofah peel color from a genotypic perspective.
[0005] The first aspect of the present invention is to provide SNP molecular markers related to the color of loofah peel.
[0006] A second aspect of the present invention is to provide a primer set for amplifying the SNP molecular markers of the first aspect of the present invention.
[0007] A third aspect of the present invention is to provide a reagent or kit.
[0008] The fourth aspect of this invention aims to provide the application of the SNP molecular marker of the first aspect of this invention, the primer set of the second aspect of this invention, or the reagent or kit of the third aspect of this invention.
[0009] The fifth aspect of this invention is to provide a method for identifying the color of loofah peel.
[0010] To achieve the above objectives, the technical solution adopted by the present invention is as follows:
[0011] In a first aspect, the invention provides SNP molecular markers related to the color of loofah peel.
[0012] In some embodiments of the present invention, the SNP molecular marker site is located at position 1266 from the 5' end of the nucleotide sequence shown in SEQ ID NO:1, and its polymorphism is G / A.
[0013] In some embodiments of the present invention, the SNP molecular marker site is located in the coding region of the Lac02g017260 (LacAPRR2) gene.
[0014] In some embodiments of the present invention, when the genotype of the SNP molecular marker is GG, the corresponding color of the loofah peel is dark green, and when the genotype of the SNP molecular marker is AA, the corresponding color of the loofah peel is light green.
[0015] A second aspect of the invention provides a primer set for amplifying the SNP molecular marker of claim 1 or 2, comprising primer set 1 or primer set 2;
[0016] The nucleotide sequence of primer set 1 is shown below:
[0017] F: AAGAAAACAAAGGTGGACTGGA;
[0018] R: CTGAAACATGCTGAGGATATGAAA;
[0019] The nucleotide sequence of primer set 2 is shown below:
[0020] Primer1: GAAGGTGACCAAGTTCATGCTGCCCGGTTATCGCCATTGG;
[0021] Primer2: GAAGGTCGGAGTCAACGGATTGCCCGGTTATCGCCATTGA;
[0022] PrimerCommon: TGAATAGAAAAGGTTACCCCTGCA.
[0023] In some embodiments of the present invention, Primer1 and Primer2 in primer set 2 contain fluorescent tag sequences, and the fluorescent groups of Primer1 and Primer2 are different.
[0024] In some embodiments of the present invention, the fluorescent group is selected from any one of FAM, HEX, VIC, TAMRA, ROX, Texas-Red, CY5, MGB, BHQ1, BHQ2 and BHQ3.
[0025] In some embodiments of the present invention, the tag sequence of the fluorescent group is located at the 5' end of the Primer1 and Primer2.
[0026] In some embodiments of the present invention, the 5' end of the Primer1 is modified with a FAM fluorescent group.
[0027] In some embodiments of the present invention, the 5' end of the Primer2 is modified with a HEX fluorescent group.
[0028] A third aspect of the present invention provides a reagent or kit comprising the primer set of the second aspect of the present invention.
[0029] In some embodiments of the present invention, the reagent or kit further contains DNA polymerase, dNTPs, and MgCl2.
[0030] A third aspect of the present invention provides the application of the SNP molecular marker of the first aspect of the present invention, the primer set of the second aspect of the present invention, and the reagent or kit of the third aspect of the present invention in any of the following aspects:
[0031] (1) Assisted selection or breeding of loofah;
[0032] (2) To prepare products for the auxiliary selection or breeding of loofah;
[0033] (3) Identification of the color of the loofah peel;
[0034] (4) Prepare products for identifying the color of loofah peel.
[0035] In some embodiments of the present invention, the breeding or assisted breeding includes at least one of assisted major gene selection, molecular assisted breeding, whole genome selection breeding, loofah peel color identification, genetic map construction, gene localization, species evolution analysis, and germplasm resource identification.
[0036] A fifth aspect of the present invention provides a method for identifying the color of a loofah peel, comprising the step of detecting SNP molecular markers of the first aspect of the present invention in the genome of the loofah to be tested using the primer set of the second aspect of the present invention and the reagents or kits of the third aspect of the present invention.
[0037] In some embodiments of the present invention, the method includes the following steps:
[0038] (a1) Extract the genome from the loofah sample to be tested;
[0039] (a2) Using the genome as a template, PCR amplification was performed using primer set 1 from the second aspect of the present invention;
[0040] (a3) Perform agarose electrophoresis on the products obtained by PCR amplification, and determine the peel color of the loofah sample to be tested based on the size of the amplified bands.
[0041] In some embodiments of the present invention, when the loofah sample to be tested can amplify a 496bp fragment (nucleotide sequence as shown in SEQ ID NO:4), the peel color of the loofah sample to be tested is dark green; if the 496bp fragment cannot be amplified, the peel color of the loofah sample to be tested is light green.
[0042] In some embodiments of the present invention, the method includes the following steps:
[0043] (b1) Extract the genome from the loofah sample to be tested;
[0044] (b2) Using the genome as a template, PCR amplification was performed using primer set 2 from the first aspect of the present invention;
[0045] (b3) After the PCR reaction is completed, the fluorescence data is read and analyzed to obtain the genotype of the loofah sample to be tested. The peel color of the loofah sample to be tested is determined based on the genotype.
[0046] In some embodiments of the present invention, the PCR amplification described in (b2) is Touchdown PCR, and the Touchdown PCR amplification program is as follows: 94℃ for 15 min; 94℃ for 20 s, 65℃ to 57℃ for 60 s, 10 cycles, with the annealing extension temperature decreasing by 0.88℃ in each cycle; 94℃ for 20 s, 57℃ for 60 s, 30 cycles.
[0047] The beneficial effects of this invention are:
[0048] This invention utilizes a marker-assisted bioassay (BSA-Seq) method to locate a single-NP molecular marker controlling the seed coat color of loofah, and subsequently develops primers (including KASP primers) for amplifying this SNP. The SNP molecular marker of this invention is universal and accurate. Based on the SNP molecular marker and amplification primers, it can be directly used to identify the seed coat color and corresponding genotype of loofah. This allows for rapid and accurate determination of the loofah seed coat color trait from the genotype at the seedling stage, improving work efficiency and providing effective technical support for molecular breeding of loofah, thus possessing significant application value. Attached Figure Description
[0049] Figure 1 The phenotype of the parent material.
[0050] Figure 2 Locating the ql trait gene for light green-skinned loofah.
[0051] Figure 3 This represents the SNP frequency distribution.
[0052] Figure 4 For SNP variation analysis.
[0053] Figure 5 The PCR amplification bands are for loofah with dark green and light green peels.
[0054] Figure 6 The image shows the results of the KASP primer set for identifying the pericarp color trait of F2. Detailed Implementation
[0055] The present invention will be further described in detail below through specific embodiments.
[0056] It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.
[0057] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.
[0058] The features and performance of the present invention will be further described in detail below with reference to embodiments.
[0059] Example 1
[0060] Experimental materials: The dark green-skinned loofah S304, bred and preserved by the Vegetable Research Institute of Guangdong Academy of Agricultural Sciences, and light green-skinned loofah ql obtained through EMS mutagenesis (ql acquisition process: After germination of S304 for 2 days, the loofah seeds showed white sprouts, were treated with 0.9% EMS solution for 5 hours, planted in the field, and self-pollinated for 6 generations to obtain light green-skinned loofah ql). Figure 1 Using these as parental materials, hybridization yielded F1, and self-pollination of F1 resulted in the F2 segregating population. Eighteen sponge gourd germplasm resources (including sponge gourd S2023-2, S2023-3, S2023-4, S2023-5, S2023-6, S2023-8, S2023-9, S2023-10, S2023-11, S2023-12, S2023-16, S2024-2, S2024-5, S2024-6, S2024-9, S2024-13, S2024-214, and S2024-215) were breeding materials created by the Vegetable Research Institute of the Guangdong Academy of Agricultural Sciences.
[0061] The specific steps for the preliminary mapping of the gene in the white fruit of loofah:
[0062] F2 populations were constructed using parental materials, and the fruit peel color was investigated. In the F2 population of 321 plants, 82 had light green fruit peels, and 239 had dark green fruit peels. From the F2 populations, 20 plants each with light green and dark green fruit peels were selected to construct mixed pools for dark green and light green fruit peels, respectively. DNA libraries were constructed using the TruSeq DNA LT Sample Prep Kit (Illumina), and sequencing was performed using Illumina HiSeq2000.
[0063] Calculate the difference ΔSNP-index between the two pooled SNP-indexes, and locate the gene for white skin of the loofah fruit in the interval of 46.2Mb-50.7Mb on chromosome 2. Figure 2 Analysis of SNP variation within the interval revealed that the SNP located at Chr02:49299241 had a frequency of 1 in the light green peel mixed pool, and was completely correlated with the light green peel trait. Figure 3 Analysis revealed that this SNP is located in the coding region of the Lac02g017260 gene (encoding the APRR2 protein), where a change from G to A causes premature termination of Lac02g017260 coding. Figure 4 ).
[0064] Specifically, the above SNP is located at position 1266 of the cDNA sequence (SEQ ID NO:1) of the APRR2 gene, with a base polymorphism of G / A. The bolded part in SEQ ID NO:1 contains the mutant base A within parentheses.
[0065]
[0066] cDNA was further extracted from the dark green pericarp S304 and the light green pericarp ql. Primers (F: 5'-AAGAAAACAAAGGTGGACTGGA-3' (SEQ ID NO:2); R: 5'-CTGAAACATGCTGAGGATATGAAA-3' (SEQ ID NO:3)) were designed for amplification. The PCR reaction system was as follows: ddH2O 20.4 μL, 10×Buffer 2.5 μL, dNTPs (10 mM) 0.5 μL, Taq enzyme (5 U / μL) 0.2 μL, forward and reverse primers (10 μM) 0.2 μL each, template (approximately 100 ng / μL concentration) 1 μL, total system volume 25 μL. The PCR program was: 94℃ pre-denaturation for 3 min, 94℃ denaturation for 45 s, 57℃ annealing for 45 s, 72℃ extension for 30 s, for a total of 35 cycles, followed by a 72℃ extension for 10 min. The results showed that a 496 bp fragment (sequence shown in SEQ ID NO:4) could be amplified from the dark green peel loofah S304, but not from the light green peel ql. Similarly, amplification in the dark green and light green extreme pools revealed that the 496 bp fragment could be amplified from all dark green fruit cDNA, but not from any light green peel cDNA. Figure 5 Furthermore, in the 18 germplasm resources created using light green pericarp (ql) as material, none of the light green pericarp materials could amplify bands, while the dark green pericarp materials could amplify bands (Table 1). This suggests that the SNP marker can accurately distinguish between dark green and light green pericarp loofah, and is fast and accurate, thus it can be used for marker-assisted selection breeding.
[0067] AAGAAAACAAAGGTGGACTGGACACCACAGCTACATAGAAAGTTCGTTCAGGCAGTCGAACAGTTAGGCATAGATCATGCAATTCCTTCCAAAATACTTGAGCTGATGAAAGTTGAAGGTTTGACAAGGTTGCAAGTCATCTCCAGAAGTACAGGATGCAAAAGAAACATGTTACGCACAGAGAAGAAAATCCAAGGTGGTCACATCCAAGATGTTCAATACAAACCAATCACTTGAAACCTA TCATAGCTTACCCTTCTTATCATCCTAGCTGTGGAGTATCAATGTCTGCTGTTTATCCAACATGGAGACAGACCAATGGCCATCCAGCTAATGCCAACATATGGGGTCCGCCCGGTTATCGCCAT TGGCCGCAACCAGGAATTCAGCCATGGAATTCCTATGCAGGGGTGCAAGCTGATGCATGGGGTTGCCCTGTGATGCTGCCTTCCCATGCTCCATATTTTTCATATCCTCAGCATGTTTCAG(SEQ ID NO:4).
[0068] Table 1 Phenotypic and Genotypic Analysis of 18 Germplasm Resources
[0069]
[0070] Example 2
[0071] A set of KASP primers was developed and designed based on the SNP sites in Example 1. The primer sequences are as follows:
[0072] Primer 1: 5'-GAAGGTGACCAAGTTCATGCTGCCCGGTTATCGCCATTGG-3' (SEQ ID NO: 5), with a FAM fluorescent group at the 5' end;
[0073] Primer2: 5'-GAAGGTCGGAGTCAACGGATTGCCCGGTTATCGCCATTGA-3' (SEQ ID NO: 6), with a HEX fluorescent group at the 5' end;
[0074] PrimerCommon: 5'-TGAATAGAAAAGGTTACCCCTGCA-3' (SEQ ID NO: 7).
[0075] The marker designed based on the KASP reaction principle and the single-base difference between dark green and light green rind loofah can perform high-throughput gene detection on loofah samples. If only FAM fluorescence (blue) is detected in the sample, the base of the sample is G (i.e., dark green rind loofah); if only HEX fluorescence (green) is detected, the base of the sample is A (i.e., light green rind loofah); if both fluorescence (red) are detected at the same time, the base at that site is in a heterozygous state.
[0076] Further identification of green-skinned loofah S304, light green-skinned loofah ql, and 321 F2 plants was carried out using the above-mentioned KASP primer set: Genomic DNA was extracted from loofah, and PCR amplification was performed using the primer set with the genomic DNA as a template. The amplification reaction system is shown in Table 2, and the reaction conditions are shown in Table 3. After PCR, the fluorescence signal was read using a TECAN Infinite M1000 microplate reader, and then the fluorescence signal was analyzed and converted using the online software snpdecoder (http: / / www.snpway.com / snpdecoder / ) to obtain a clear and intuitive genotyping diagram, and the genotype results were output according to the different colors.
[0077] Table 2 Amplification reaction system
[0078]
[0079] Table 3 Amplification reaction conditions
[0080]
[0081] The results are as follows: the fluorescence signal of the amplified product of green-peeled loofah S304 is blue, the fluorescence signal of the amplified product of light green-peeled loofah ql is green, and the fluorescence signal of the amplified product of 100% green-peeled loofah in the F2 population is blue or red; the fluorescence signal of the amplified product of 100% light green-peeled loofah is blue. Figure 6 ).
[0082] Further testing of 18 types of germplasm resources using the aforementioned primers revealed that the fluorescence signal of the dark green-skinned loofah was blue, while that of the light green-skinned loofah was green (Table 1).
[0083] The above results show that the SNP molecular markers of the present invention have universality and accuracy, and can be used to predict, identify and screen the seed coat color trait of loofah. Screening can be carried out effectively in the seedling stage, which improves work efficiency, reduces the manpower, material resources and financial resources in the later planting stage, and can accelerate the breeding process.
[0084] The embodiments of the present invention have been described in detail above with reference to the accompanying drawings. However, the present invention is not limited to the above embodiments, and various changes can be made within the scope of knowledge possessed by those skilled in the art without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof can be combined with each other unless otherwise specified.
Claims
1. Primers or kits for detecting SNP molecular markers related to the color of loofah peel can be used in any of the following ways: (1) Identification of the color of the loofah peel; (2) Prepare a product for identifying the color of loofah peel; The SNP molecular marker site is located at position 1266 from the 5' end of the nucleotide sequence shown in SEQ ID NO:1, and its polymorphism is G / A; When the genotype of the SNP molecular marker in the genome of the loofah to be tested is GG, the peel color of the loofah to be tested is dark green; when the genotype of the SNP molecular marker in the genome of the loofah to be tested is AA, the peel color of the loofah to be tested is light green. The kit contains the primers; The primers include primer set 2; in, The nucleotide sequence of primer set 2 is shown below: Primer1: GAAGGTGACCAAGTTCATGCTGCCCGGTTATCGCCATTGG; Primer2: GAAGGTCGGAGTCAACGGATTGCCCGGTTATCGCCATTGA; PrimerCommon: TGAATAGAAAAGGTTACCCCTGCA.
2. The application according to claim 1, characterized in that, Primer set 2 contains fluorescent tag sequences in Primer1 and Primer2, and the fluorescent groups of Primer1 and Primer2 are different.
3. The application according to claim 2, characterized in that, The fluorescent group is selected from any one of FAM, HEX, VIC, TAMRA, ROX, Texas-Red, CY5, MGB, BHQ1, BHQ2 and BHQ3.
4. A method for identifying the color of a loofah peel, comprising the step of detecting the SNP molecular markers of any one of claims 1 to 3 in the genome of the loofah to be tested using the primers or kits described in any one of claims 1 to 3.
5. The method according to claim 4, characterized in that, The method includes the following steps: (b1) Extract the genome from the loofah sample to be tested; (b2) Using the genome as a template, perform PCR amplification using primer set 2 as described in any one of claims 1 to 3; (b3) After the PCR reaction is completed, the fluorescence data is read and analyzed to obtain the genotype of the loofah sample to be tested. The peel color of the loofah sample to be tested is determined based on the genotype.