Bacterial strain with anti-tumor effect and application thereof

Abstract

The invention discloses a bacterial strain with an anti-tumor effect and application of the bacterial strain, the bacterial strain is Lactobacillus paracasei Biohalo 27, the bacterial strain is preserved in the China General Microbiological Culture Collection Center (CGMCC), and the preservation number is CGMCC NO.34917; the preservation time is June 16, 2025; the screened strain with the anti-tumor effect has the effects of inhibiting proliferation and migration of rectal cancer cells and breast cancer cells, retarding the cell cycle and promoting cell apoptosis, so that the anti-tumor purpose is achieved, and the strain can be used as a potential application value of probiotic adjuvant therapy.

Description

Technical Field

[0001] This invention relates to the field of microbial technology, specifically to a strain with anti-tumor effects and its applications. Background Art

[0002] Colorectal cancer (CRC) is one of the most common malignant tumors worldwide, and its incidence and mortality rates have shown significant geographical differences and dynamic changes over the past few decades. In recent years, with changes in lifestyle, population aging, and the widespread adoption of screening technologies, the global prevalence of CRC has undergone significant changes. According to data from the International Agency for Research on Cancer (IARC) of the World Health Organization, the incidence and mortality rates of CRC globally have shown different trends over the past decade. In 2020, there were approximately 1.93 million new CRC cases worldwide, accounting for 10% of all new cancer cases, making it the third most common cancer globally. However, in recent years, the incidence of CRC has stabilized or slightly decreased in some developed countries, while it has shown an upward trend in developing countries. This difference is mainly attributed to the Westernization of lifestyles, changes in dietary structure, and the increasing aging of the population. Regarding mortality, the global colorectal cancer mortality rate has decreased over the past decade, mainly due to the widespread adoption of early screening technologies and improvements in treatment methods. Although screening technologies are widely used in developed countries, the mortality rate of colorectal cancer remains high in some developing countries, which is closely related to low screening coverage, delayed diagnosis, and insufficient treatment resources.

[0003] Chemotherapy and radiotherapy are the main treatments for colorectal cancer, but their destructive impact on the gut microbiota cannot be ignored. While chemotherapy drugs (such as 5-fluorouracil and oxaliplatin) and radiotherapy kill cancer cells, they also damage intestinal epithelial cells and symbiotic flora, leading to gut microbiota dysbiosis. Studies have shown that chemotherapy-induced dysbiosis may impair intestinal barrier function, increase the risk of pathogen translocation, and consequently trigger intestinal inflammation and immunosuppression. Furthermore, gut microbiota dysbiosis is closely related to the development of chemotherapy resistance. Certain intestinal bacteria (such as Fusobacterium nucleatum) can promote tumor cell resistance to chemotherapy drugs by activating the TLR4 / NF-κB signaling pathway. Radiotherapy, on the other hand, directly damages intestinal epithelial cells by inducing oxidative stress, causing mucositis, diarrhea, and intestinal barrier dysfunction, while simultaneously promoting an increase in the abundance of pro-inflammatory bacteria (such as Escherichia coli), further exacerbating the inflammatory response.

[0004] Immune checkpoint inhibitors can activate the host's anti-tumor immune response and induce immune memory, thereby producing durable therapeutic effects. Some patients can maintain long-term disease remission even after discontinuation of the drug, which contrasts sharply with the short-term effects of traditional chemotherapy. While immunotherapy, represented by PD-1 / PD-L1 inhibitors, significantly improves prognosis, its efficacy is significantly influenced by gut microbiota composition. Clinical data show that approximately 30% of patients experience insufficient immune response due to gut microbiota dysbiosis. Furthermore, immunotherapy may trigger immune-related adverse events (irAEs), with gut microbiota dysbiosis closely related to the efficacy and toxicity of immunotherapy. Studies have found that the composition of the gut microbiota can affect the response rate to immunotherapy. For example, the abundance of Bifidobacterium and Akkermansia is positively correlated with the efficacy of PD-1 inhibitors. Notably, the risk of serious irAEs is significantly increased in patients with a history of antibiotic use or gut microbiota depletion, suggesting that gut microbiota homeostasis is crucial for regulating the safety of immunotherapy.

[0005] Breast cancer is the most common malignant tumor among women worldwide, posing a serious threat to women's health. In recent years, increasing research has shown that the gut microbiota plays a crucial role in the occurrence, development, and treatment of cancer. In breast cancer, changes and characteristics of the gut microbiota are closely related to tumor development and progression; certain microorganisms may promote or inhibit tumor growth by influencing the host's immune system, metabolic pathways, or directly acting on cancer cells. Tumor bacterial therapy, due to its ability to overcome the limitations of traditional therapies in tumor targeting and the immunosuppressive microenvironment, has gradually become a research hotspot in the field of cancer treatment.

[0006] In view of this, the present invention is hereby proposed. Summary of the Invention

[0007] The purpose of this invention is to provide a strain with anti-tumor effects and its application. The strain of this invention has the effects of inhibiting the proliferation and migration of rectal cancer cells (HCT-8) and breast cancer cells, arresting the cell cycle, and promoting cell apoptosis, thereby achieving the purpose of anti-tumor.

[0008] In order to achieve the above-mentioned objectives of the present invention, the following technical solution is adopted: The first aspect of this invention provides a strain with anti-tumor effects, wherein the strain is Lacticaseibacillus paracasei Biohalo27, which is deposited at the China General Microbiological Culture Collection Center, with accession number CGMCC NO.34917; the deposit date is June 16, 2025.

[0009] A second aspect of the present invention provides a microbial agent containing the strain with antitumor effects.

[0010] Preferably, the microbial agent is obtained by inoculating the strain with anti-tumor effects into a culture medium and then culturing it.

[0011] A third aspect of the present invention provides the application of the strain with antitumor efficacy or the microbial agent in the preparation of antitumor products.

[0012] Preferably, the tumor includes breast cancer and rectal cancer.

[0013] Preferably, the product is a pharmaceutical or health product.

[0014] A fourth aspect of the present invention provides a product with anti-tumor properties, the product comprising the strain with anti-tumor efficacy or the microbial agent.

[0015] Preferably, the viable count of the strain with antitumor efficacy is not less than 1×10⁻⁶. 7 cfu / g.

[0016] Preferably, the number of cells in the microbial agent is not less than 1×10⁻⁶. 7 cells / g.

[0017] Compared with the prior art, the beneficial effects of the present invention include at least the following: The present invention screened a strain with anti-tumor effects. This strain can inhibit the proliferation and migration of HCT8 cells and breast cancer cells, arrest the cell cycle, and promote cell apoptosis, thereby achieving the purpose of anti-tumor treatment. It has potential application value as a probiotic adjuvant therapy. Attached Figure Description

[0018] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the accompanying drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. In all the drawings, similar elements or parts are generally identified by similar reference numerals. In the drawings, the elements or parts are not necessarily drawn to scale.

[0019] Figure 1 The morphological characteristics of Biohalo27 in Example 1 of the present invention are shown in (A) the colony morphology of Biohalo27; and (B) the morphology of Biohalo27 after staining under a light microscope.

[0020] Figure 2 This is the phylogenetic tree of Biohalo27 in Embodiment 1 of the present invention;

[0021] Figure 3The survival rates of HCT8 cells and NCM460 cells in Example 2 of this invention are as follows: (A) survival rate of HCT8, NCM460 and Biohalo27 after co-culturing for 12 h; (B) cell survival rate of HCT8, NCM460 and Biohalo27 after co-culturing for 24 h; (C) cell survival rate of HCT8, NCM460 and Biohalo27 after co-culturing for 48 h; (D) cell survival rate of HCT8 after co-culturing with Pg and Fn for 12 h; (E) cell survival rate of HCT8 after co-culturing with Pg and Fn for 24 h; (F) cell survival rate of HCT8 after co-culturing with Pg and Fn for 48 h; (G) cell survival rate of HCT8 cells treated with CFS for 24 h; and (H) cell survival rate of HCT8 cells treated with CBE for 24 h.

[0022] Figure 4 The morphology of HCT8 cells and NCM460 cells under a light microscope in Example 2 of this invention;

[0023] Figure 5 In Example 2 of this invention, Biohalo27 alters the surface morphology of HCT8 cells;

[0024] Figure 6 This is an example of how Biohalo27 alters the migration ability of HCT8 cells in Example 2 of the present invention. (A) Cell scratch imaging of HCT8 cells after co-culturing with Biohalo27, and (B) Relative migration rate of HCT8 cells after co-culturing with Biohalo27.

[0025] Figure 7 This invention relates to Example 2, which shows the effect of Biohalo27 on the HCT8 cell cycle, including (A) the effect of Biohalo27 on the HCT8 cell cycle, (B) quantitative analysis of the HCT8 cell cycle after co-culturing Biohalo27 and HCT8 for 12 h, and (C) quantitative analysis of the HCT8 cell cycle after co-culturing Biohalo27 and HCT8 for 24 h.

[0026] Figure 8 In Example 2 of this invention, Biohalo27 promotes HCT8 cell apoptosis, wherein (A) the effect of Biohalo27 on HCT8 cell apoptosis, and (B) quantitative analysis of HCT8 cell apoptosis.

[0027] Figure 9 In Example 2 of this invention, Biohalo27 promotes ROS expression in HCT8 cells;

[0028] Figure 10This is an example of the effect of Biohalo27 on the proliferation of breast cancer cells in Example 3 of the present invention. (AB) Statistical graphs of cell survival rates of Biohalo27 after 24 h, 48 h, and 72 h of treatment with MCF-7 and MCF-10A, respectively; (C) Statistical graphs of cell survival rates of MCF-7 at 50%, 100%, and 200% working concentrations of supernatant, respectively.

[0029] Figure 11 The effect of Biohalo27 on apoptosis of breast cancer cells in Example 3 of the present invention, wherein (AC) represents the time-dependent statistics, dose-dependent statistics, and low toxicity of Biohalo27 treatment of breast cancer cells, respectively.

[0030] Figure 12 The effect of Biohalo27 on the cell cycle of breast cancer cells in Example 3 of this invention;

[0031] Figure 13 The effect of Biohalo27 on the migration of breast cancer cells in Example 3 of this invention;

[0032] Figure 14 In Example 3 of this invention, Biohalo27 alters the morphology of breast cancer cells;

[0033] Figure 15 The following are the changes in breast cancer cell-related proteins and genes treated by Biohalo27 in Example 3 of this invention. (AB) represents the changes in the expression levels of breast cancer cell-related proteins treated by Biohalo27; (C) represents the changes in the Cyclin D1 gene in breast cancer cells treated by Biohalo27; (D) represents the changes in the MMP9 gene in breast cancer cells treated by Biohalo27; and (E) represents the changes in the Bcl-2 gene in breast cancer cells treated by Biohalo27. Detailed Implementation

[0034] The embodiments of the technical solution of the present invention will be described in detail below with reference to the examples. The following embodiments are only used to illustrate the technical solution of the present invention more clearly, and are therefore only examples, and should not be used to limit the scope of protection of the present invention.

[0035] It should be noted that, unless otherwise stated, the technical or scientific terms used in this application should have the ordinary meaning as understood by one of ordinary skill in the art to which this invention pertains.

[0036] This invention provides a strain with anti-tumor effects, namely Lacticaseibacillus paracasei Biohalo27, which is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO.34917 and deposit date of June 16, 2025.

[0037] The present invention screened a strain with anti-tumor effects. This strain can inhibit the proliferation and migration of HCT8 cells and breast cancer cells, arrest the cell cycle, and promote cell apoptosis, thereby achieving the purpose of anti-tumor treatment. It has potential application value as a probiotic adjuvant therapy.

[0038] Another embodiment of the present invention provides a microbial agent containing the strain with antitumor effects.

[0039] In one embodiment, the microbial agent is obtained by inoculating the strain with anti-tumor effects into a culture medium and then culturing it.

[0040] Another embodiment of the present invention provides the application of the strain with anti-tumor efficacy or the microbial agent in the preparation of anti-tumor products.

[0041] In one embodiment, the tumor includes breast cancer and rectal cancer.

[0042] In one embodiment, the product is a pharmaceutical or health product.

[0043] Another embodiment of the present invention provides a product with anti-tumor effects, the product comprising the strain with anti-tumor effects or the microbial agent.

[0044] In one embodiment, the viable count of the strain with antitumor efficacy is not less than 1 × 10⁻⁶. 7 cfu / g.

[0045] In one embodiment, the number of cells in the microbial agent is not less than 1×10⁻⁶. 7 cells / g.

[0046] The technical solution of the present invention will be further described in detail below through specific embodiments.

[0047] Example 1

[0048] This example describes the screening and identification of Lactobacillus paracasei Biohalo27 (abbreviated as Biohalo27); The *Lacticaseibacillus paracasei* Biohalo27 strain of this invention was screened and deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO.34917; the deposit date was June 16, 2025.

[0049] 1. Bacterial identification

[0050] (1) Morphological identification: Take a clean glass slide, take a small amount of bacterial suspension with a sterile inoculation loop, and spread it evenly on the slide to form a thin layer. Let the slide air dry naturally, or gently heat it with an alcohol lamp flame to accelerate drying. Pass the dried slide through an alcohol lamp flame 2-3 times to fix the bacteria on the slide. Be careful not to overheat it to avoid destroying the bacterial morphology. Add crystal violet solution to the slide, covering the entire slide, let it stand for 1 minute, and gently rinse with distilled water to remove excess staining solution. Add iodine solution, cover the slide, let it stand for 1 minute, and rinse with distilled water to remove excess iodine solution. Add 95% ethanol, gently shake the slide until no more purple dye flows out (usually about 10-30 s). Rinse immediately with distilled water to stop the decolorization process. Add safranin solution, cover the slide, and let it stand for 1 min. Rinse with distilled water to remove excess staining solution. Gently blot the slide dry with absorbent paper or allow it to air dry. Add a drop of cedarwood oil to the slide and observe using an oil immersion microscope (100x objective). Record the morphology, arrangement, and staining characteristics of the bacteria.

[0051] (2) Molecular biological identification: The 16S rRNA and pheS gene sequences of the strain were sequenced.

[0052] 2. Results

[0053] 1) Morphological identification results of the fungal strain, such as Figure 1 As shown, Figure 1 In the image, (A) the colony morphology of Biohalo27 and (B) the morphology of Biohalo27 after staining under a light microscope;

[0054] Depend on Figure 1 As can be seen, the colony characteristics are mainly round, smooth, and milky white. Under a microscope, they are rod-shaped, arranged singly, in pairs, or in short chains, and appear purple. Based on this, Biohalo27 can be identified as a Gram-positive bacterium.

[0055] 2) Molecular biological identification of bacterial strains

[0056] The Biohalo27 strain was sent to the Institute of Microbiology, Chinese Academy of Sciences for 16S rRNA and pheS gene sequencing. The identification result was "Lactobacillus spuracusei (100.00%)". The 16S rRNA gene sequence of Biohalo27 is shown in SEQ ID NO:1. pheS gene sequence as SEQ ID NO: 2 is shown, specifically CAGACAGTCCAATGCAGGCGCGGACAATGGAAAAGCACGACTTTACCAAAGGACCGCTGAAAATGATTAGCCCTGGGGTGGTTTATCGACGTGATGACGACGATGCTACTCATAGCCATCAGTTTCACCAGATGGAAGGACTCGTCATTGACAAGCATATAACCATGGCTGATCTAAAGGGAACCTTGTTGGCCATGTGCCAACAC GTGTTTGGTAAAGATCGGACAATTCGCTTGCGGCCAAGTTATTTTCCATTTACGGAGCCATCCGTTGAAGTTGATGTTTCCTGTTTTCGTTGCGGCGGTAAAGGTTGCCCGGTTTGCAAATATACCGGTTGGATTGAAGTGTTAGGTGCCGGCATGGTGCATCCCAATGTGCTACGGGCAGCGAACATTGATGCTGACGTATACGGCGGCTTTGC.

[0057] 3) Phylogenetic tree analysis

[0058] The obtained sequencing sequences were compared with sequences with high similarity selected from the NCBI database using BLAST, and a phylogenetic tree was constructed using MEGA11.0 (e.g., Figure 2 As shown in the figure, strain Biohalo27 is on the same branch as Lactobacillu spuracuseisubsp. and has 100% homology, so the strain is named Lactobacillu spuracusei Biohalo27.

[0059] Example 2

[0060] This embodiment is a study of the effect of Lacticaseibacillus paracasei Biohalo27 on rectal cancer cells according to the present invention:

[0061] 1. Strains and cell lines:

[0062] Cell lines included the human colorectal cancer cell line HCT8 and the normal human intestinal epithelial cell line NCM460. *Lactobacillus paracasei* Biohalo27 was screened and preserved by our research team at the Laboratory of Infection, Immunology and Tumor Microenvironment, School of Medicine, Wuhan University of Science and Technology. *Porphyromonas gingivalis* (P.g.) ATCC33277 and *Fusobacterium nucleatum* (F.n.) ATCC51191 were purchased from the Shanghai Bacteriological Collection Center, China.

[0063] 2. Preparation of cell-free bacterial supernatant

[0064] Following the method described by Luo Mingyue (Molecular Mechanism of Probiotic Inhibition of HT29 Cells Based on Tumor Biology Research [D]. Kunming: Kunming University of Science and Technology, 2020), Biohalo27 cells in the logarithmic growth phase were centrifuged at 4000 rpm for 10 min, and the supernatant was collected. The supernatant was then filtered through a 0.22 μm filter membrane, and the process was repeated twice. The filtered cell-free supernatant (CFS) was stored at -20℃ overnight, then placed in a vacuum freeze dryer. After 24 h, it was dried into lyophilized powder, collected, weighed, and dissolved in serum-free 1640 medium to a concentration of 0.5 g / mL. Finally, it was aliquoted and stored at -80℃.

[0065] 3. Preparation of cell-free bacterial extract

[0066] Following the method described by Zhang Hui (Screening of hypoglycemic lactic acid bacteria, hypoglycemic mechanism and application research. Zhenjiang: Jiangsu University, 2023), Biohalo27 bacteria in the logarithmic growth phase were centrifuged at 4000 rpm for 10 min, the supernatant was discarded, the bacterial pellet was collected, resuspended in PBS, and centrifuged again at 4000 rpm for 10 min. The pellet was then collected for ultrasonic disruption. Ultrasonic disruption conditions: power 45%, with a cycle of 3 s sonication followed by a 3 s pause, for a total sonication time of 30 min. After sonication, the pellet was centrifuged at 10000 r / min for 15 min in a low-temperature high-speed centrifuge. The supernatant was retained and filtered through a 0.22 μm filter membrane to obtain cell-free bacterial extract (CBE), and protein concentration was determined.

[0067] 4. Protein concentration determination

[0068] (1) Plotting the standard curve: Preparation of protein standards: Take 1.2 mL of protein standard preparation solution and add it to a tube of protein standard (30 mg BSA). After thorough dissolution, prepare a 25 mg / mL protein standard solution. It can be used immediately after preparation or stored at -20℃ for a long time. Take an appropriate amount of 25 mg / mL protein standard and dilute it to a final concentration of 0.5 mg / mL. Add the standard to the wells of a 96-well plate at concentrations of 0, 1, 2, 4, 8, 12, 16, and 20 μL, and add standard diluent to make up to 20 μL. This corresponds to standard concentrations of 0, 0.025, 0.05, 0.1, 0.2, 0.3, 0.4, and 0.5 mg / mL, respectively. Then add 200 μL of BCA working solution to each well and incubate at 37℃ for 20-30 min. The absorbance at a wavelength of 570 nm was measured using an ELISA reader. The regression curve equation was calculated based on the absorbance and the corresponding concentration of the standard, and a standard curve was plotted.

[0069] (2) Protein concentration determination: Add an appropriate volume of sample to the wells of a 96-well plate. If the sample volume is less than 20 μL, add standard diluent to bring the total to 20 μL. Add 200 μL of BCA working solution to each well and incubate at 37°C for 20-30 min. Measure the absorbance at 570 nm using a microplate reader. Calculate the protein concentration of the sample based on the standard curve and the sample volume used.

[0070] 5. Establish a bacterial-cell co-culture system

[0071] (1) Bacterial quantification: Colony counting was performed using the plate count method. Biohalo27 cells in the logarithmic growth phase were taken and diluted sequentially to a concentration of 10 using sterile physiological saline. -1 10 -2 10 -3 10 -4 10 -5 10 -6 10 -7 10 -8 10 -9 Choose 10 -6 10 -7 10 -8 10 -9 For each of the four bacterial concentrations, 50 μL was transferred to the center of an agar plate and spread using a sterile spreader. The plates were then incubated in a constant temperature incubator for 24 hours. Colonies within the range of 30-300 were counted, yielding a final colony count of 1 × 10⁻⁶. 8 CFU / mL.

[0072] (2) Cell quantification: Collect cells in the logarithmic growth phase, digest them with trypsin, add complete culture medium to stop digestion, 1200 rpm, 3 min, discard the supernatant, resuspend the cell pellet with fresh culture medium, take a portion of the cell suspension and dilute it tenfold, and count the cells under a microscope using a hemocytometer.

[0073] (3) Bacterial-cell co-culture: Co-culture was carried out in 96-well plates at a cell density of 5 × 10⁶ cells / well. 5 Add 200 μL of cell suspension per well to each 96-well plate and incubate overnight. The next day, remove the plate, discard the old culture medium, and add bacteria at a ratio of 1, 10, and 100 (Multiplicity of Infection (MOI)). Incubate the plate for the required experimental time. Alternatively, co-culture can be performed in 6-well plates. Seeds of cells in the logarithmic growth phase and in good condition are seeded into the 6-well plates and incubated overnight. After incubation, discard the old culture medium and add bacteria at a ratio of 1, 10, and 100 (MOI). Incubate the plate for the required experimental time.

[0074] 6. CCK8 assay for cell proliferation

[0075] The CCK8 kit works by converting WST-8 into orange-yellow formazan within cells using mitochondrial reductase. This product is water-soluble, and this process is closely related to cell viability. The more viable cells there are, the higher the amount of formazan produced. Therefore, cell viability and proliferation can be assessed by measuring absorbance.

[0076] After bacterial-cell co-culture in 96-well plates according to the method described in section 5 above, cell proliferation was detected using the CCK8 reagent kit. The 96-well plates were removed from the cell culture incubator, the old culture medium was discarded, and 200 μL of PBS was added for washing twice, being careful to gently add the solution without touching the bottom of the wells. 100 μL of 1640 culture medium was added, followed by 10 μL of CCK8 reagent. The plates were incubated in a cell culture incubator for 2-3 hours in the dark. The absorbance at 450 nm was then measured using a multi-mode microplate reader, and the cell viability of each group was calculated. In the experiment measuring the CFS and CBE activity of Biohalo27 cells against HCT8 cells, HCT8 cells in the logarithmic growth phase were collected and cultured at a cell density of 5 × 10⁶ cells / well. 5Cells / mL were added to each well with 100 μL of cell suspension, and the cells were incubated overnight. The next day, the cells were removed and ready for drug addition. Cell-free supernatant and cell-free bacterial extract were diluted to the required concentration and added to the wells sequentially. The cells were then incubated for 24 hours. The old culture medium was discarded, and the cells were washed twice with 200 μL of PBS, being careful not to touch the bottom of the well. 100 μL of 1640 medium and 10 μL of CCK8 reagent were added. The cells were incubated in the dark for 2-3 hours. The absorbance at 450 nm was measured using a multi-mode microplate reader, and the cell viability of each group was calculated.

[0077] 7. Scanning electron microscopy examination of the cell membrane surface

[0078] After co-culturing bacteria and cells in an electron microscopy dish for 24 hours using the method described in section 5 above, centrifuge at 4000 rpm for 10 min, discard the supernatant, and transfer 300 µL of pre-cooled glutaraldehyde fixative to the dish. Place the dish in an incubator for fixation. After 1.5 hours, remove the dish, centrifuge at 4000 rpm for 10 min, discard the supernatant, and wash twice with pre-cooled PBS at 4 °C, centrifuging at 4000 rpm for 10 min each time, discarding the supernatant. Perform gradient dehydration with 50%, 70%, 80%, 90%, and 100% ethanol, 15 min each time, followed by overnight freeze-drying. Gently remove the bottom slide of the freeze-dried dish, carefully attach it to a conductive slide using carbon conductive tape, and sputter-coated with gold. Then observe the cell morphology using a scanning electron microscope and photograph the cells for preservation.

[0079] 8. Transfer Experiment

[0080] Draw three horizontal lines on the back of each well of a six-well plate using a marker. Collect cells in the logarithmic growth phase, digest with trypsin, terminate digestion with complete culture medium, centrifuge at 1200 rpm for 3 min, discard the supernatant, resuspend the cells in fresh culture medium to obtain a cell suspension, and count the cells at a ratio of 3 × 10⁶ cells / well. 6Cells were seeded at a density of 100 cells / mL and cultured overnight in a cell culture incubator. The next day, after observing under a microscope that the cells had reached 100% confluence, a scratch was prepared. Using a 200 µL pipette tip, a vertical line was drawn perpendicular to the bottom of the well plate. The old culture medium was discarded, and sterile PBS was injected along the well wall. After gentle agitation and two rinses, fresh serum-free 1640 medium was added. Biohalo27 was then added to the six-well plate following the method described in section 5 above, and co-cultured for 12 and 24 hours as required by the experiment. The scratch area was then observed under a microscope, and photographs were taken for record-keeping. The scratch width was measured using ImageJ software. The width at 0 h was recorded as M0, and the widths at 12 and 24 h were recorded as M1. The relative migration rate was calculated as (100%) = (1 - M1 / M0) × 100%.

[0081] 9. Flow cytometry for cell cycle detection

[0082] Propidium iodide (PI) is a commonly used nucleic acid dye. PI itself does not fluoresce, but after binding to nucleic acids, it emits red fluorescence when excited by a 488 nm laser. Based on the specific binding of PI to DNA, the fluorescence signal reflects the DNA content at each stage of the cell cycle, and it is widely used in flow cytometry to detect the cell cycle.

[0083] After co-culturing the cells in a six-well plate according to the method described in section 5 above, discard the old culture medium, add trypsin for digestion, then add complete culture medium to terminate the digestion. Collect the cell suspension, centrifuge at 1200 rpm for 3 min, discard the supernatant, wash twice with pre-cooled PBS (4 ℃), resuspend in pre-cooled 70% ethanol, and fix overnight at 4 ℃. The next day, prepare the PI staining solution: each sample requires 0.5 mL of staining buffer, 25 µL of PI staining solution, and 10 µL of RNase A. Remove the EP tubes from the refrigerator, centrifuge at 1000 rpm for 8 min, discard the supernatant, wash twice with pre-cooled PBS, add 350 µL of the pre-prepared PI staining solution, incubate at room temperature in the dark for 0.5 h, then transfer to flow cytometry tubes. Use flow cytometry to determine the cell cycle distribution and analyze using FlowJo software.

[0084] 10. Flow cytometry detection of cell apoptosis

[0085] Annexin V labeled with fluorescein isothiocyanate (FITC-Annexin V) has a high affinity for phosphatidylserine. Annexin V / PI double staining can effectively distinguish between live cells, early apoptotic cells, late apoptotic cells, and necrotic cells by detecting phosphatidylserine eversion and cell membrane integrity.

[0086] After co-culturing the cells in a six-well plate as described in section 7 above, discard the old culture medium, add trypsin for digestion, then add complete culture medium to terminate the digestion. Collect the cell suspension, centrifuge at 1200 rpm for 3 min, discard the supernatant, wash twice with PBS pre-cooled to 4 ℃, resuspend the cells in 300 mL of binding buffer and transfer them to flow cytometry tubes. Add 5 μL each of FITC-Annexin V and PI working solution to each tube, incubate at room temperature in the dark for 15 min, and then quickly perform flow cytometry to detect cell apoptosis. After detection, analyze the cells using FlowJo software.

[0087] 11. Flow cytometry detection of reactive oxygen species expression

[0088] Intracellularly, DCFH-DA itself does not spontaneously emit fluorescent signals; it requires oxidation by reactive oxygen species (ROS) to be converted into a strongly fluorescent product, dichlorofluorescein. After co-culturing in six-well plates as described in section 5 above, cells were collected, and DCFH-DA was diluted 1:1000 with PBS to a final concentration of 10 µM / L. The collected cells were then suspended in the diluted DCFH-DA and incubated at 37ºC for 20 min. The cells were inverted and mixed every 3-5 min to ensure adequate contact between the probe and cells. The cells were washed three times with serum-free cell culture medium to thoroughly remove any unextracted DCFH-DA. The cells were then transferred to flow cytometry tubes and immediately analyzed using flow cytometry software.

[0089] 12. Results

[0090] 1) Biohalo27 inhibits HCT8 cell proliferation.

[0091] A bacterial-cell co-culture system was established, and the cell viability after co-culture was detected using the CCK8 reagent. The results are as follows: Figure 3 As shown, Figure 3In the study, the cell viability of HCT8, NCM460, and Biohalo27 cells after co-culturing for 12 h was calculated as follows: (A) cell viability of HCT8, NCM460, and Biohalo27 cells after co-culturing for 24 h; (B) cell viability of HCT8, NCM460, and Biohalo27 cells after co-culturing for 48 h; (C) cell viability of HCT8 cells after co-culturing with Pg and Fn cells after 12 h; (D) cell viability of HCT8 cells after co-culturing with Pg and Fn cells after 12 h; (E) cell viability of HCT8 cells after co-culturing with Pg and Fn cells after 24 h; (F) cell viability of HCT8 cells after co-culturing with Pg and Fn cells after 48 h; (G) cell viability of HCT8 cells after treatment with CFS cells for 24 h; and (H) cell viability of HCT8 cells after treatment with CBE cells for 24 h. *: P < 0.05, **: P < 0.01, ***: P < 0.001.

[0092] Depend on Figure 3 It can be seen that after co-culturing Biohalo27 and HCT8 cells for 12, 24, and 48 h, the CCK8 assay results showed that at 12 and 48 h, when MOI = 100, the HCT8 cell viability was significantly reduced (P < 0.01), and at 24 h, when MOI = 10, the HCT8 cell viability was significantly reduced (P < 0.001). After co-culturing Biohalo27 with NCM460 cells for 12, 24, and 48 hours, cell viability was not inhibited in all treatment groups except the MOI=1000 group. However, the positive control experiment results for Biohalo27 showed that after co-culturing Pg with HCT8 for 12 hours (MOI=1000 group) and 24 hours (MOI=100 and 1000 groups), the growth activity of HCT8 cells was inhibited, while the cell viability in other treatment groups was not inhibited. After co-culturing Fn with HCT8 for 12, 24, and 48 hours, HCT8 activity was not inhibited and even significantly increased. These findings suggest that Biohalo27 has potential anti-cancer activity and is safe. In addition, CCK8 also measured the CFS and CBE activities of Biohalo27 on the proliferation of HCT8 cells. The results showed that CFS at a concentration of 30 mg / mL significantly inhibited the activity of HCT8 cells (P < 0.001), and CBE at a concentration of 20 µg / mL significantly inhibited the activity of HCT8 cells (P < 0.05). This indicates that both intracellular and extracellular substances of Biohalo27 have potential anticancer effects.

[0093] 2) Effects of Biohalo27 on the morphology of HCT8 and NCM460 cells

[0094] To analyze the effects of Biohalo27 on the morphology of HCT8 and NCM460 cells, an inverted microscope was used for observation, and the results are shown in Figure 4. Under a 20× objective lens, it was observed that in HCT8 cells, morphological changes became increasingly apparent with increasing infection indices. At MOI=100, blurred cell boundaries and loose cell arrangement were observed. In contrast, in NCM460 cells, no significant morphological changes were observed after co-culturing with Biohalo27 at different infection indices; the cells remained tightly packed with clear boundaries.

[0095] 3) Biohalo27 damages the surface structure of the HCT8 cell membrane.

[0096] To further observe the effect of Biohalo27 on the morphology of HCT8 cells, Biohalo27 cells with an MOI of 100 were co-cultured with HCT8 cells for 24 hours. After gold sputtering and conductivity testing, the ultrastructure of the cell surface was observed using scanning electron microscopy. The results are as follows: Figure 5 As shown, normally cultured HCT8 cells exhibited intact morphology, smooth surfaces, and clear cell boundaries. However, at 25,000x magnification, compared to the control group, HCT8 cells in the Biohalo27 group showed significant changes: blurred boundaries, disrupted cell membrane integrity, and pores on the membrane surface. This indicates that Biohalo27 can damage the morphology of HCT8 cells, thereby affecting their proliferation and leading to cell death.

[0097] 4) Biohalo27 inhibits the migration ability of HCT8 cells.

[0098] After establishing a co-culture system of Biohalo27 and HCT8 cells, the effect of Biohalo27 on HCT8 cell proliferation was investigated, followed by an analysis of the effect of Biohalo27 on HCT8 cell migration ability at different time points. Biohalo27 with an MOI of 100 was co-cultured with HCT8 cells for 12 and 24 hours. Figure 6As shown in the image (A is a scratch imaging image of HCT8 cells co-cultured with Biohalo27, B is the relative migration rate of HCT8 cells co-cultured with Biohalo27), at 12 h, microscopic observation revealed a reduction in the scratch area of ​​the control group. At 24 h, the scratch area of ​​the control group was significantly reduced, while the scratch area of ​​the Biohalo27 group showed little change. Subsequent analysis and quantification using ImageJ software revealed that the relative migration rates of the Biohalo27 group at 12 and 24 h were 4.66% and 9.62%, respectively, while the relative migration rates of the control group at 12 and 24 h were 13.87% and 41%, respectively. This indicates that Biohalo27 can inhibit the migration ability of HCT8 cells.

[0099] 5) Biohalo27 alters the HCT8 cell cycle.

[0100] Biohalo27 and HCT8 cells were co-cultured at MOIs of 10 and 100 for 12 and 24 hours, respectively, followed by flow cytometry analysis of the cell cycle. Results are as follows: Figure 7 As shown in Figure 1 (A shows the effect of Biohalo27 on the HCT8 cell cycle, and B shows the quantitative analysis of the HCT8 cell cycle), the cell cycle exhibits a certain trend change with increasing co-culture time and infection index. Compared with the control group, the Biohalo27 group showed a decrease in the number of cells in G1 phase and an increase in the number of cells in G2 and S phases. This indicates that Biohalo27 can alter the HCT8 cell cycle.

[0101] 6) Biohalo27 promotes HCT8 cell apoptosis.

[0102] HCT8 cells were co-cultured with Biohalo27 at MOI=100 for 12 and 24 hours, followed by flow cytometry to detect cell apoptosis. The results are shown in Figure 8 (A shows the effect of Biohalo27 on HCT8 cell apoptosis, and B shows the quantitative analysis of HCT8 cell apoptosis). Compared with the control group, HCT8 cells co-cultured with Biohalo27 for 12 and 24 hours showed significantly increased apoptosis. This indicates that Biohalo27 can significantly increase HCT8 cell apoptosis, and this increase is positively correlated with co-culture time.

[0103] 7) Biohalo27 promotes ROS expression in HCT8 cells.

[0104] Biohalo27 and HCT8 cells were co-cultured at MOI=100 for 24 h, and the expression level of ROS in the cells was then detected by flow cytometry. The results are as follows: Figure 9 As shown, compared with the control group, HCT8 cells treated with Biohalo27 exhibited higher fluorescence intensity and the FITC-A channel shifted significantly to the right, indicating that HCT8 cells in the Biohalo27 group produced more ROS.

[0105] Example 3

[0106] This example illustrates the effect of Biohalo27 on breast cancer cells:

[0107] 1. CCK8 assay for cell proliferation

[0108] MCF-7 and MCF-10A cells in logarithmic growth phase were rinsed twice with PBS, then digested with 0.5 mL of 0.25% trypsin and centrifuged. 1 mL of complete culture medium was added to stop the centrifugation. The cells were centrifuged at 1200 rpm for 3 minutes, the supernatant was discarded, and the cells were resuspended in 1 mL of complete culture medium and mixed thoroughly. In a separate centrifuge tube, 100 μL of the cell suspension was diluted tenfold, mixed thoroughly, and 10 μL was used for cell counting using a cell counting chamber. The total cell suspension density was adjusted to 100,000 cells / mL. 100 μL of the above cell suspension was added to each well of a 96-well plate, and 100 μL of PBS was added to each well around the perimeter to prevent edge effects. The plates were incubated overnight. After cell attachment, the culture medium in the wells was carefully aspirated and discarded. Different concentrations of bacterial culture medium were prepared and added to the wells according to a concentration gradient. Each well was repeated at least three times. A blank control without bacterial culture was used as a negative control, and DOX was used as a positive control. After culturing for 24, 48, and 72 hours, the old culture medium was aspirated, and each well was thoroughly rinsed 2-3 times with PBS to remove bacterial precipitate. Then, complete culture medium containing 10% CCK8 assay reagent was added to each well. The environment should be dark to avoid affecting the chemical properties of the drug. After incubation in an incubator for 4 hours, the absorbance of each well was measured using a multi-mode microplate reader at OD450 nm.

[0109] 2. Flow cytometry detection of apoptosis

[0110] After co-culturing, collect the original culture medium from the 6-well plate, centrifuge and wash to collect the pellet into EP tubes. Simultaneously, add 2 mL of PBS to the culture dish, avoiding direct contact with the cells. Gently shake the dish to wash the cells, discard the PBS, and repeat this process twice. Add trypsin to the washed culture dish, place the dish in a 37°C incubator for static sterilization, and remove the cells. Add complete culture medium to stop digestion, and gently pipette to detach the cells completely from the 6-well plate. Aliquot the cell suspension into EP tubes, centrifuge at 1200 rpm for 3 minutes, discard the supernatant, add 1 mL of PBS to the EP tube, and gently pipette to resuspend the cells. Repeat this process 2-3 times. Finally, retain the cell pellet and combine it with the pellet from the original culture medium in one tube. Process according to the Annexin-V-FITC / PI apoptosis kit instructions, adding 500 μL of 1×Binding Buffer (diluted 10×Binding Buffer 1:9 with distilled water) to the cell pellet. Add 5 μL Annexin-V-FITC, then add 10 μL PI, and gently vortex to mix. Incubate at room temperature in the dark for 15-20 minutes, then add 400 μL of 1×Binding Buffer to mix the sample before analysis.

[0111] 3. Flow cytometry for cell cycle detection

[0112] Cells were seeded into sterile 6-well plates and incubated at 37°C. After 12 hours of cell adhesion, the old culture medium was discarded. The drugs to be added and serum-free culture medium were prepared at experimental concentration gradients and added to the 6-well plates for co-culturing. The control group was treated with blank serum-free culture medium. After 48 hours of co-culturing, the old culture medium was aspirated from each well for each cell concentration, and the cells were washed three times with pre-chilled PBS. The cells were then trypsinized and collected into EP tubes. 1 mL of pre-chilled 70% ethanol was added and mixed well. The cells were fixed at 4°C for at least 12 hours. After fixation, the cells were centrifuged at 1200 rpm for 3-5 minutes, the supernatant was carefully aspirated, and the cells were resuspended in 1 mL of PBS. The cells were centrifuged again to precipitate the cells, and the supernatant was aspirated. For each cell sample, the staining solution was prepared as follows: 0.5 mL staining buffer, 25 μL propidium iodide staining solution (20X), and 10 μL RNase A (50X). After adding staining solution to each tube of cells, slowly and thoroughly resuspend the cell pellet and incubate at 37°C in the dark for 30 minutes. Then, store at 4°C or on ice in the dark. Perform flow cytometry analysis within 24 hours of staining.

[0113] 4. Scratch test

[0114] Select cells in the logarithmic growth phase, discard the old culture medium, digest them, and then add complete culture medium to terminate the digestion.

[0115] Centrifuge at 1200 rpm for 3 minutes, discard the supernatant, and resuspend the cells in 1 mL of complete culture medium, gently pipetting to mix. Dilute the cell suspension tenfold, mix well by pipetting, and take 10 μL for cell counting using a cell counting chamber. Adjust the suspension to 2 × 10⁻⁶. 5 After vortexing and mixing, add 2 mL of cell suspension to each well of a six-well plate and incubate. After 24 hours of adhesion (80% confluence), make three cuts per well using a 200 μL pipette tip, using the same tip for each well, keeping the cuts as straight as possible. After cutting, discard the old culture medium, wash slowly three times with PBS, and then add diluted bacterial suspension (diluted with 1% serum culture medium). Take photos under a microscope at 0, 24, and 48 hours, and perform calculations using ImageJ software.

[0116] 5. Cell morphology detection

[0117] Collect cells in the logarithmic growth phase, wash twice with PBS, digest with 0.5 mL of 0.25% trypsin, centrifuge, and stop by adding 1 mL of complete culture medium. Centrifuge at 1200 rpm for 3 minutes, discard the supernatant, and resuspend the cells in 1 mL of complete culture medium. Dilute, count, and adjust the suspension to 2 × 10⁻⁶ cells / mL. 5 After vortexing and mixing, 2 mL of cell suspension was added to each well of the electron microscopy culture dish and incubated overnight. Once adhered, the prepared bacterial suspension was added, along with a blank control group. After 48 hours of incubation, the old culture medium was aspirated from the wells, and the samples were gently rinsed 2-3 times with PBS. 300 μL of glutaraldehyde fixative, pre-cooled to 4°C, was added, and the samples were fixed at 4°C for 2 hours. After fixation, the fixative was aspirated and discarded. The samples were rinsed twice with PBS buffer, pre-cooled to 4°C, for 20 minutes each time. Subsequently, the samples were dehydrated sequentially with progressively increasing ethanol solutions (50%-70%-80%-90%-100%), each dehydration lasting 15 minutes. The samples were then placed in a vacuum freeze-drying system for overnight low-temperature drying. After separating the dried culture dish slides, low-resistivity carbon adhesive was used to attach them to a dedicated conductive substrate, followed by gold particle sputtering. Surface morphology analysis was then performed at multiple observation sites using scanning electron microscopy.

[0118] 6. Experimental Results

[0119] 1) Biohalo27 inhibits the proliferation of breast cancer cells.

[0120] Biohalo27 exhibited concentration- and time-dependent inhibition of MCF-7 breast cancer cell proliferation. For example... Figure 10In MCF-7 cells, CCK-8 assay showed that after 24 hours of incubation, treatment with a high concentration of Biohalo27 (107 CFU / mL) significantly inhibited cell viability, reducing the survival rate to (39.56 ± 1.73)%. However, the toxic effect on normal MCF-10A mammary cells was weaker, with a survival rate of (91.15 ± 1.31)% after treatment under the same conditions. Figure 10 As shown in Figure B), this suggests its selective inhibitory effect on cancer cells. Figure 10 According to data from China A, as the action time is extended to 72 hours, Biohalo27 in 10 5 -10 7 The inhibition rate of MCF-7 was enhanced within the CFU / mL concentration range and significantly lower than that of the positive control DOX (set to 1 μM). Notably, MCF-7 showed improved inhibition rate after 10... 7 CFU / mL Biohalo27 treatment for 72 hours showed an antiproliferative effect close to that of a positive drug, with a survival rate of (27.62±4.36)% vs. (38.75±1.46)%. However, the cell survival rate of MCF-10A remained at (82.32±1.51)% under the same bacterial concentration and treatment time, indicating that Biohalo27 toxicity was significantly lower than that of traditional chemotherapy drugs. Meanwhile, from the following... Figure 10 As can be seen from Figure C, the extracted Biohalo27 supernatant (Biohalo27 in the logarithmic growth phase, with a concentration adjusted to 1×10⁻⁶) 7 (CFU / mL, centrifuged at 4000 rpm for 10 minutes to separate bacterial cells from supernatant) The inhibitory effect of MCF-7 treatment at low (50%), medium (100%), and high (200%) concentrations was significantly lower than that of the control group treated with live bacteria. The high concentration at 72 h showed (43.65±2.69)% vs. (27.62±4.36)%. This suggests that the inhibitory effect of Biohalo27 on breast cancer cells is a dynamic process, hence the slightly weaker effect of the supernatant. Future experiments will focus on the effect of live bacteria treatment. These data indicate that Biohalo27 inhibits breast cancer cell proliferation while exhibiting low toxicity to normal cells, providing crucial experimental evidence for future research and clinical applications.

[0121] 2) Biohalo27 induces apoptosis in breast cancer cells.

[0122] Annexin V-FITC / PI double staining assay revealed that Biohalo27 significantly induced apoptosis in MCF-7 breast cancer cells in a dose- and time-dependent manner. Figure 11 In the timeliness analysis shown in Figure A, MCF-7 10 7The apoptosis rate in the CFU / mL Biohalo27 24-hour treatment group was significantly lower than that in the 48-hour and 72-hour treatment groups (16.99±1.77)% vs. (22.78±2.23)% vs. (33.47±1.70)%), indicating the continuous activation of the apoptosis signaling pathway. Figure 11 According to B, after 72 hours of co-culture, the proportion of apoptotic cells in the high-concentration Biohalo27 treatment group reached (33.47±1.70)%, significantly higher than that in the 0-concentration control group (8.93±1.73)%. It is noteworthy that this strain exhibited extremely weak apoptosis-inducing effect on normal MCF-10A mammary cells. Figure 11 As shown in Figure C, the toxicity was significantly lower than that of the DOX treatment group at the same treatment time, (4.86±0.72)% vs. (58.76±4.72)%, further indicating that it may have a targeted killing effect.

[0123] 3) Biohalo27 arrests the cell cycle in breast cancer.

[0124] Cell cycle analysis based on propidium iodide (PI) staining combined with flow cytometry showed that Biohalo27 significantly arrested the cell cycle progression of MCF-7 breast cancer cells. Figure 12 As shown, after 48 hours of treatment with MCF-7, the proportion of cells in the G0 / G1 phase increased from (37.43±0.97)% to (50.16±2.12)% in the high-concentration Biohalo27 group, indicating G0 / G1 phase arrest. Consistent with the apoptosis data, Biohalo27 did not significantly interfere with the cell cycle of normal MCF-10A mammary cells (G0 / G1 phase ratio change <5%), while the same concentration of DOX caused non-selective G2 / M phase arrest in both MCF-7 and MCF-10A cells.

[0125] 4) Biohalo27 reduces the migration rate of breast cancer cells.

[0126] like Figure 13 As shown in the standardized scratch assay, Biohalo27 inhibited the migration ability of MCF-7 cells. However, because MCF-7 cells themselves have weak migration ability, the inhibitory effect was relatively weak. Under 1% low serum conditions, after 24 hours of treatment with high-concentration Biohalo27, the migration rate was only (5.06±2.00)%, lower than that of the 0-concentration control group (13.31±2.39)%, P<0.001. Concentration gradient experiments showed a dose-dependent inhibitory trend in migration rate.

[0127] 5) Biohalo27 alters the morphology of breast cancer cells.

[0128] like Figure 14 As shown, scanning electron microscopy (SEM) analysis revealed that Biohalo27 treatment induced significant and irreversible morphological changes in MCF-7 breast cancer cells. After treatment with 10⁷ CFU / mL Biohalo27 for 48 hours, cancer cells transformed from the typical epithelial paving adherent morphology of the control group (plump, smooth surface, and uniformly distributed microvilli) to wrinkled, vesicular, and pseudopodia-retracted cells. Therefore, Biohalo27 can damage the cell morphology of MCF-7 cells, leading to cell death.

[0129] 6) Biohalo27's effects on breast cancer cell-related protein and gene changes.

[0130] like Figure 15 As shown in Figure AB, Western blot analysis revealed that Biohalo27 significantly altered the expression profiles of apoptosis, proliferation, and metastasis-related proteins in MCF-7 breast cancer cells. The concentration was 10... 7 After 48 hours of treatment with CFU / mL, the expression of the anti-apoptotic protein Bcl-2 decreased, while the pro-apoptotic protein Bax was upregulated, leading to a decrease in the Bcl-2 / Bax ratio; the activity fragment of the apoptosis-executing protein Cleaved Caspase-3 increased. Simultaneously, the expression of the cycle regulator Cyclin D1 decreased, consistent with G1 phase arrest data. Among metastasis-related markers, the expression levels of N-cadherin and MMP-9 both decreased, indicating that they inhibit invasion by reversing the EMT process. Figure 15 As shown in Figure CE, the changes in the relevant genes were verified by qPCR.

[0131] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features therein. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention, and they should all be covered within the scope of the claims and specification of the present invention.

Claims

1. A bacterial strain with antitumor effects, characterized in that, The strain is Lacticaseibacillus paracasei Biohalo27, deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO.34917; the deposit date is June 16, 2025.

2. A microbial agent containing the strain with antitumor efficacy as described in claim 1.

3. The microbial agent according to claim 2, characterized in that, The microbial agent is obtained by inoculating the strain with anti-tumor effects into a culture medium and then culturing it.

4. The use of the antitumor strain of claim 1 or the microbial agent of any one of claims 2 to 3 in the preparation of antitumor products, wherein the tumor includes breast cancer and rectal cancer.

5. The application according to claim 4, characterized in that, The product in question is a pharmaceutical or health supplement.

6. A product with anti-tumor properties, characterized in that, It includes the strain with anti-tumor efficacy as described in claim 1 or the microbial agent as described in any one of claims 2 to 3.

7. The product according to claim 6, characterized in that, The viable count of the strain with anti-tumor effects is not less than 1×10⁻⁶. 7 cfu / g.

8. The product according to claim 6, characterized in that, The cell count in the microbial agent is not less than 1×10⁻⁶. 7 cells / g.

Images