Bifidobacterium bifidum for improving acute liver injury induced by acetaminophen and application of bifidobacterium bifidum

Abstract

The invention discloses bifidobacterium bifidum for improving acute liver injury induced by acetaminophen and application of the bifidobacterium bifidum, and belongs to the technical field of microorganisms. The invention provides bifidobacterium bifidum for improving acute liver injury induced by acetaminophen, and the preservation number of the strain is CGMCC No.29545. Animal experiments prove that the bifidobacterium bifidum subspecies can improve the serum liver enzyme level and large-area liver necrosis of mice with acute liver injury caused by acetaminophen, and can improve the acute liver injury caused by acetaminophen. Oxidative stress caused by mitochondrial damage is relieved, and apoptosis and inflammatory response of cells are reduced. The traditional Chinese medicine composition can safely and obviously improve the acute liver injury, and has certain significance for clinically promoting probiotic treatment.

Description

Technical Field

[0001] This invention belongs to the field of microbial technology, specifically relating to a Bifidobacterium bifidum that improves acute liver injury induced by acetaminophen and its application. Background Technology

[0002] Acute liver failure (ALF) can manifest as various immune and metabolic disorders, but the main cause of ALF is drug-induced liver injury (DILI). Acetaminophen (APAP) is a widely used antipyretic and analgesic anti-inflammatory drug in clinical practice. APAP overdose is a leading cause of acute liver failure worldwide, and its incidence continues to rise. At therapeutic doses, approximately 90% of APAP is converted into non-toxic glucuronidated and sulfonated metabolites under the catalysis of UDP-glucuronyltransferase and sulfotransferase, which are excreted in the urine. Approximately 2% of APAP is excreted in the urine without any metabolism. Cytochrome P450 enzyme 2E1 (CYP2E1) catalyzes the conversion of up to 10% of APAP into the toxic metabolite N-acetyl-p-benzoquinone imine (NAPQI). NAPQI is rapidly detoxified by binding to glutathione (GSH), generating non-toxic thiouric acid, which is then excreted through the urinary system. In cases of APAP overdose, excess NAPQI accumulates in the liver and rapidly depletes GSH. When GSH is depleted, excess NAPQI covalently binds to the sulfhydryl groups of mitochondrial proteins, triggering mitochondrial oxidative stress, increasing mitochondrial permeability, inducing DNA fragmentation in the cell nucleus, and ultimately leading to hepatocyte necrosis. The rupture of necrotic cells releases damage-associated molecular patterns (DAMPs), which mainly bind to macrophages, leading to transcriptional activation of cytokine and chemokine genes, releasing large amounts of inflammatory factors and chemokines, generating an inflammatory response, and further exacerbating liver damage.

[0003] Over the past few decades, the role of the gut microbiota in regulating human health and disease pathology has become increasingly recognized. Evidence suggests that the gut microbiota is crucial to the severity and clinical outcomes of acute arterial disease (AILI). Various factors, including antibiotic treatment, gut microbiota dysbiosis, intestinal barrier dysfunction, and intestinal inflammation, have been shown to exacerbate the severity of AILI. On the other hand, some studies have confirmed the role of certain gut microbes in reducing the severity of AILI. Bifidobacteria are an important component of the human and animal gut microbiota. As beneficial bacteria, they play a variety of important physiological roles in human health, such as biological barrier function, nutritional function, anti-tumor effects, immune enhancement, improvement of gastrointestinal function, and anti-aging. Bifidobacterium bifidum can alleviate non-alcoholic fatty liver disease (NAFLD) by regulating lipid metabolism and intestinal permeability to inhibit liver inflammation and fat accumulation; improve metabolism by inhibiting palmitic acid-induced oxidative stress and ferroptosis in hepatocyte dysfunction-related fatty liver; improve NAFLD by reducing inhibitory molecules in NK cells and restoring damaged NK cell function; improve necrotizing colitis by reducing apoptosis and mucosal damage through COX-2-dependent substances, maintaining intestinal integrity; and improve the inflammatory response to the hepatotoxic antifungal drug voriconazole by increasing the abundance of Bifidobacterium. These results indicate that Bifidobacterium bifidum is a promising probiotic for improving liver function, but there is a lack of research on its application in improving acetaminophen-induced acute liver injury and its underlying mechanisms. Summary of the Invention

[0004] To address the problems existing in the prior art, the purpose of this invention is to design and provide a technical solution for improving Bifidobacterium bifidum-induced acute liver injury caused by acetaminophen and its application.

[0005] The present invention is implemented using the following technical solutions: This invention relates to a type of Bifidobacterium bifidum (Bifidobacterium bifidum). Bifidobacterium bifidum Depository institution: China General Microbiological Culture Collection Center (CGMCC), Address: No. 1, Beichen West Road, Chaoyang District, Beijing, Accession number: CGMCC NO.29545, Deposit date: January 8, 2024, Suggested name: Bifidobacterium bifidum Bifidobacterium bifidum.

[0006] The first aspect of this invention provides the use of Bifidobacterium bifidum in the preparation of a drug for improving liver injury, wherein the Bifidobacterium bifidum is deposited under the accession number CGMCC No. 29545.

[0007] The second aspect of the present invention provides the use of Bifidobacterium bifidum in the preparation of a medicament for improving acute liver injury induced by acetaminophen, wherein the Bifidobacterium bifidum is deposited under the accession number CGMCC No. 29545.

[0008] The third aspect of the present invention provides a drug for improving liver damage, the drug containing Bifidobacterium bifidum, the preservation number of which is CGMCC No. 29545.

[0009] Furthermore, the drug also includes a carrier and / or pharmaceutical excipients.

[0010] Furthermore, the number of viable Bifidobacterium bifidum in the drug is not less than 1×10⁻⁶. 7 CFU / mL or 1×10 7 CFU / g.

[0011] Furthermore, the dosage form of the drug is powder, granules, capsules, tablets, pills, or oral liquid.

[0012] This invention isolates a strain of Bifidobacterium bifidum from infant feces. This strain is acid-resistant, bile-salt-resistant, and free from antibiotic resistance. Animal experiments have demonstrated that this Bifidobacterium bifidum can improve serum liver enzyme levels and extensive liver necrosis in mice with acute liver injury induced by excessive APAP intake, reduce oxidative stress caused by liver injury, and decrease cell apoptosis and inflammatory damage. This invention can safely and significantly improve acute liver injury and has certain significance for advancing probiotic therapy in clinical practice. Attached Figure Description

[0013] Figure 1 This is a culture diagram of Bifidobacterium bifidum according to the present invention.

[0014] Figure 2 This is the gene phylogenetic tree of Bifidobacterium bifidum of the present invention.

[0015] Figure 3 This is a circulated genome diagram of the Bifidobacterium bifidum of the present invention.

[0016] Figure 4 This is a genomic analysis diagram of Bifidobacterium bifidum according to the present invention.

[0017] Figure 5 This is a schematic diagram showing the osmotic pressure resistance results of Bifidobacterium bifidum in this invention.

[0018] Figure 6 This is a schematic diagram showing the sensitivity results of Bifidobacterium bifidum to antibiotics according to the present invention.

[0019] Figure 7 The present invention relates to the effects of Bifidobacterium bifidum on serum biochemistry and liver pathological damage in mice with acute liver injury.

[0020] Figure 8 The present invention relates to the effect of Bifidobacterium bifidum on oxidative stress-related proteins in mice with acute liver injury.

[0021] Figure 9 This invention relates to the effect of Bifidobacterium bifidum on oxidative stress-related genes in mice with acute liver injury.

[0022] Figure 10 The present invention relates to the effect of Bifidobacterium bifidum on apoptotic liver cells in mice with acute liver injury.

[0023] Figure 11 This invention relates to the effect of Bifidobacterium bifidum on inflammation-related genes in mice with acute liver injury. Detailed Implementation

[0024] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. The following description of at least one exemplary embodiment is merely illustrative and is in no way intended to limit the present invention or its application or use. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0025] Example 1: Screening, identification, culture, observation and preservation of Bifidobacterium bifidum 1. Sample collection: The sample source is feces from healthy infants and young children.

[0026] During collection, use a swab to collect the feces from the center, place it in COPAN anaerobic transfer medium, cover it with an anaerobic bag, and dilute and culture the collected sample within four hours as follows.

[0027] 2. Sample dilution The procedure was performed in an anaerobic workstation. L-cysteine ​​hydrochloride / PBS at a concentration of 0.05 g / 100 ml was added to the fecal sample. The amount of L-cysteine ​​hydrochloride / PBS added was 10 times the weight of the fecal sample. The sample was then centrifuged at 1000 rpm for 1 min. The supernatant was then diluted to a final concentration of 10. -6 10 -7 10 -8 Three concentration gradients.

[0028] 3. Coating culture Take 10 μL of the sample after centrifugation in step 2. -6 10 -7 10 -8Three concentration gradients of fecal dilution were evenly spread in 100 μL onto MRS solid medium and incubated upside down at 37°C in an anaerobic workstation for 48 h.

[0029] 4. Purification culture (1) Preparation of MRS liquid culture medium: 10.0 g peptone, 8.0 g beef extract powder, 4.0 g yeast extract, 20.0 g glucose, 1 mL anhydrous sorbitan monooleate, 2.0 g dipotassium hydrogen phosphate, 5.0 g sodium acetate trihydrate, 2.0 g triammonium citrate, 0.2 g magnesium sulfate heptahydrate, 0.05 g manganese sulfate tetrahydrate, adjust the pH of MRS liquid culture medium to 6.2±0.2, and autoclave at 121℃ for 15 min; (2) Preparation of MRS solid culture medium: Add 15.0 g of agar to the MRS liquid culture medium in (1), adjust the pH to 6.2±0.2, and autoclave at 121℃ for 15 min; (3) Cultivation: Select single colonies with a colony count of less than 50 from the plate, streak them again on the MRS solid medium prepared in (2), and then anaerobically incubate at 37°C for 48 h to obtain single colonies. The colony size is usually 1~2 mm, milky white, moist, with a smooth and slightly glossy surface and neat edges. Inoculate the single colonies into the MRS liquid medium prepared in (1), and anaerobically incubate at 37°C for 12 h to obtain the purified culture medium. Figure 1 This is a colony diagram of Bifidobacterium bifidum culture.

[0030] 5. Strain identification DNA was extracted from the screened single colonies and amplified and sequenced using Bifidobacterium-specific primers BIF-D-9F5'-CTTACTTCGCCTTCTTTGCTCCATAC-3' (SEQ ID NO.1) and BIF-D-9R5'-AGAAGTCCAAGACTTTGGCCCTGA-3' (SEQ ID NO.2). The strain sequence is shown in SEQ ID NO.3. 16S F: AAGGTTAGATCCTGTCTTGCGGTCCTTGAACCCTGGGTATCGAGCGCGCCACGCACGATGTGGTAACGCACACCCGGCAGATCCTTGACACGGCCGCCGCGCACGAGCACGATGGAGTGCTCCTGCAGATTGTGGCCTTCGCCCGGGATGT AGGCGGTGACTTCGATGCCCGAGGACAGGCGCACACGAGCGACCTTACGCAGAGCCGAGTTCGGCTTCTTCGGGGTGGTGGTGTAGACACGGGTGCACACGCCGCGGCGCAGCGGGCTGCCCTTCAGGGCCAAAGTCTTGGACTTCTAAA.

[0031] 6. Preservation of microbial strains: S1: Measure the OD value of the purified culture medium obtained in step 4. When the OD value is between 0.6 and 0.8, centrifuge at 3000 rpm / min for 8 min. S2: Discard the supernatant of the centrifuged bacterial culture in S1, add sterile defibrinated sheep blood to the remaining product, mix thoroughly by pipetting, dispense into cryovials, and transfer to liquid nitrogen to obtain the preserved Bifidobacterium strain. Figure 2 This is a phylogenetic tree of Bifidobacterium bifidum.

[0032] The above-mentioned *Bifidobacterium bifidum* was deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC NO. 29545, on January 8, 2024. Suggested naming: Bifidobacterium bifidum.

[0033] Example 2: Genomic analysis of Bifidobacterium bifidum like Figure 3 The diagram shown is a genomic circle of Bifidobacterium bifidum in this invention. The genomic circle can comprehensively display the characteristics of the genome. The information corresponding to the genomic circle from the inside out is the genome size, gene information on the positive and negative strands, ncRNA, GC content, GC-Skew, etc.

[0034] like Figure 4 Figure A shows the number of genes annotated for each category of carbohydrate-active enzymes. Carbohydrates play a vital role in biological functions, and studying them can yield a wealth of meaningful biological information. Carbohydrate-active enzymes are classified into glycoside hydrolases, glycosyltransferases, polysaccharide lyases, and glycoesterases, which have functions of degrading, modifying, and forming glycosidic bonds.

[0035] like Figure 4 As shown in Figure B, this represents the relative proportion of genes in the secondary classification of virulence factors of Bifidobacterium bifidum in this invention. Virulence molecules are substances derived from microorganisms that promote microbial infection and cause specific host diseases. Virulence molecules mainly include bacterial toxins, cell surface proteins that regulate bacterial adhesion, proteins that protect bacteria, cell surface carbohydrates, and hydrolytic enzymes that have bacterial pathogenicity.

[0036] like Figure 4 As shown in Figure C, the information on drug resistance genes contained in each genome of Bifidobacterium bifidum was obtained through annotation from the CARD database, and the relative proportion of genes in each pharmacological classification was determined.

[0037] like Figure 4 As shown in Figure D, genes mediating antibiotic resistance were found in the DNA sequence of Bifidobacterium bifidum, mainly tetracycline and Pseudomonas acid.

[0038] Example 3: Osmotic pressure resistance of Bifidobacterium bifidum S1: Preparation of bacterial suspension (1) Take the strain preserved in this invention, dip an appropriate amount of the strain into a sterile inoculation loop, streak it in sections on MRS solid medium, and culture it in an anaerobic workstation for 48 hours; (2) Pick a smooth, moderately sized white single colony from the last area of ​​(1) and place it in MRS liquid medium. After culturing to the logarithmic growth phase, inoculate it into MRS liquid medium at a 4% inoculum. After culturing at 37°C for 12 hours in an anaerobic workstation, centrifuge at 3000 rpm for 10 minutes, discard the supernatant, wash the bacterial sludge twice with sterile PBS (pre-cooled at 4°C), resuspend the bacterial sludge in PBS, measure the OD value, and adjust the bacterial suspension concentration to the required concentration.

[0039] S2: (1) Prepare sodium chloride solutions of 0, 6 g / L, 15 g / L, 24 g / L, 33 g / L and 42 g / L.

[0040] (2) After activating and culturing the preserved strain prepared in this technical solution, prepare a bacterial suspension according to the method in S1. After growing to the logarithmic phase, inoculate it at a 4% inoculum into MRS-NaCl medium with different sodium chloride concentrations (0, 6 g / L, 15 g / L, 24 g / L, 33 g / L, 42 g / L), and incubate at 37°C for 24 h. Measure the OD value of the bacterial suspension at a wavelength of 600 nm.

[0041] Results: The addition of 3 g / L of sodium chloride increased the osmotic pressure of the culture medium by an average of 100 mOsm / kg. Figure 5 As shown, Bifidobacterium bifidum was promoted to grow at sodium chloride concentrations of 6 g / L, 15 g / L, and 24 g / L, but was completely inhibited at sodium chloride concentrations of 33 g / L and higher.

[0042] Example 4: Antibiotic susceptibility of Bifidobacterium bifidum (1) After activating and culturing the strain preserved in this invention, prepare a bacterial suspension according to the above method, and adjust the bacterial concentration to 3×10⁻⁶ using MRS liquid culture medium. 8 The initial inoculum was prepared using CFU / mL (OD625 nm is approximately 0.16-0.2), and the initial inoculum was diluted 1:500 using the broth dilution method.

[0043] (2) Add 50 μL of the diluted inoculum and 50 μL of different double-strength concentrations of antibiotics to a 96-well plate (at this time the bacterial concentration is approximately 3 × 10⁻⁶). 5 CFU / mL, which means approximately 3 × 10⁻⁶ CFU / mL per well. 4 After sealing, the wells were incubated at 37°C for 24 hours. The OD600 value of each well was measured using an ELISA reader to determine the sensitivity to various antibiotics.

[0044] The results are as follows Figure 6 As shown, Bifidobacterium bifidum is resistant to tetracycline and ciprofloxacin, but sensitive to other antibiotics such as erythromycin, clindamycin, chloramphenicol, ampicillin, vancomycin, and linezolid.

[0045] Example 5: The effect of Bifidobacterium bifidum on improving acute liver injury in mice S1: Take 2 × 10⁻⁶ of the strain preserved in this invention. 9 CFU; Reference strain: Bifidobacterium longum BAA999 2×10 9 CFU; APAP (acetaminophen, 300 mg / kg), a drug used to model acute liver injury; SPF-grade C57BL / 6J male mice.

[0046] S2: Forty mice were randomly divided into a normal group, a Bifidobacterium bifidum group, a model group, a model + Bifidobacterium bifidum group, and a model + Bifidobacterium longum group, with eight mice in each group undergoing adaptive feeding for seven days.

[0047] S3: Seven days later, all mice were given free access to food and water, while the probiotic group was administered 2×10⁻⁶ mice by gavage. 9 CFU-containing Bifidobacterium bifidum, normal group and model group were gavaged with an equal volume of PBS solution. The normal group, Bifidobacterium bifidum group, model group, model + Bifidobacterium bifidum group and model + Bifidobacterium longum group were fed continuously for 7 days. On the 8th day, APAP was injected intraperitoneally to establish the model. Two hours before the model was established, probiotics were gavaged again. The sample was collected 6 hours after the model was established.

[0048] S4: The samples from S3 were subjected to H&E staining for histopathological analysis; Western blot was used to verify proteins in oxidative stress and inflammation-related pathways; and qRT-PCR was used to verify gene transcription levels.

[0049] Results: 1. Effects of Bifidobacterium bifidum on serum biochemistry and liver H&E staining in mice with acute liver injury. The results showed that, Figure 7 China A Figure 7 B, Figure 7 C, Figure 7 As shown in Figure D, compared with the normal group, the levels of aspartate aminotransferase (AST), alanine aminotransferase (ALT), AST / ALT ratio, and alkaline phosphatase (ALP) in the Bifidobacterium bifidum group were not significantly different from those in the normal group; the levels of AST, ALT, AST / ALT ratio, and ALP in the model + Bifidobacterium bifidum group were significantly lower than those in the model group. P <0.01). For example... Figure 7 The image in Figure E shows the liver H&E staining. The results show that, compared with the normal group, the model group had large areas of necrosis in the central lobules of the liver and inflammatory infiltration. Compared with the model group, the model + Bifidobacterium group had a significantly reduced area of ​​necrosis in the central lobules of the liver and reduced inflammation.

[0050] 2. Effects of Bifidobacterium bifidum on oxidative stress-related proteins in mice with acute liver injury The results are as follows Figure 8 As shown, compared with the normal group, the protein expression levels of Kelch-like ECH-associated protein 1 (keap1) and 4-hydroxynonenal (4-HNE) were significantly increased, and their protein expression was significantly reduced after treatment with Bifidobacterium bifidum. P <0.05); Compared with the normal group, the protein expression levels of NAD(P)Hquinone oxidoreductase 1 (NQO1), nucleoerythrocyte 2-related factor 2 (nrf2), and heme oxygenase 1 (HO1) were significantly reduced, while the protein expression levels were significantly restored after treatment with Bifidobacterium bifidum. P <0.05).

[0051] 3. Effects of Bifidobacterium bifidum on oxidative stress-related genes in mice with acute liver injury The results are as follows Figure 9 As shown, compared with the normal group, the model group had a higher superoxide dismutase 1 (SOD1) concentration. Sod1 ), superoxide dismutase 2 ( Sod2 ), superoxide dismutase 3 ( Sod3 ), glutathione S-transferase mu1 ( Gstm1 ), glutathione peroxidase 1 ( Gpx1 ), catalase ( Cat The level of nicotinamide adenine dinucleotide phosphate oxidase 2 (NAP2) was significantly reduced in the model group, but recovered significantly after treatment with Bifidobacterium bifidum; compared with the normal group, the level of NAP2 in the model group was significantly reduced. Nox2 The expression of ) was significantly increased, and significantly decreased after administration of Bifidobacterium bifidum. P <0.05).

[0052] 4. Effects of Bifidobacterium bifidum on hepatocyte apoptosis in mice with acute liver injury The results showed that, Figure 10 As shown, compared with the normal group, the model group showed DNA breaks in the cell nuclei and a large number of apoptosis; after treatment with Bifidobacterium bifidum, DNA breaks in the cell nuclei were significantly reduced and apoptosis was reduced.

[0053] 5. Effects of Bifidobacterium bifidum on hepatocyte inflammation in mice with acute liver injury The results are as follows Figure 11 As shown, compared with the normal group, the model group had a higher concentration of monocyte differentiation antigen CD14 (CD14). Cd14 ), CXC motif chemokine ligand 1 ( Cxcl1 ), chemokine CCL7 ( Ccl7 ), bimodal protein ( Areg Epidermal regulatory hormone ( Ereg ), nuclear factor κB ( Relb S100 calcium-binding protein A8 ( S100a8 S100 calcium-binding protein A9 ( S100a9 The transcription levels of genes such as ) were significantly increased, and significantly decreased after administration of Bifidobacterium bifidum. P <0.05).

[0054] 6. The above results indicate that *Bifidobacterium bifidum* subsp. can improve serum liver enzyme levels and extensive liver necrosis in mice with acute liver injury induced by APAP, reduce oxidative stress caused by hepatotoxicity, and thus reduce hepatocyte apoptosis and inflammatory response. This invention can safely and significantly improve acute liver injury and has certain significance for promoting probiotic therapy in clinical practice.

[0055] The above description is only a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any equivalent substitutions or modifications made by those skilled in the art within the scope of the technology disclosed in the present invention, based on the technical solution and inventive concept of the present invention, should be covered within the scope of protection of the present invention.

Claims

1. The application of Bifidobacterium bifidum in the preparation of drugs for improving liver injury, wherein the preservation number of Bifidobacterium bifidum is CGMCC No. 29545.

2. The use of Bifidobacterium bifidum in the preparation of a drug for improving acute liver injury induced by acetaminophen, wherein the preservation number of Bifidobacterium bifidum is CGMCC No. 29545.

3. A drug for improving liver damage, characterized in that, The drug contains Bifidobacterium bifidum, whose preservation number is CGMCC No. 29545.

4. The drug for improving liver injury as described in claim 3, characterized in that, The drug also includes a carrier and / or pharmaceutical excipients.

5. A drug for improving liver injury as described in claim 3, characterized in that, The number of viable Bifidobacterium bifidum in this drug is not less than 1×10⁻⁶. 7 CFU / mL or 1×10 7 CFU / g.

6. A medicament for improving liver injury as described in any one of claims 3-5, characterized in that, The drug is available in the form of powder, granules, capsules, tablets, pills, or oral liquid.

Images