Spirochete-like multiplex nucleic acid detection kit and matched artificial chromosome engineering bacterium quality control product

Abstract

The invention discloses a spirochete-like multiplex nucleic acid detection kit and a matched artificial chromosome engineering bacterium quality control product, and belongs to the field of molecular biology. The kit comprises a leptospira specific primer probe group, a hot-regressive spirospira specific primer probe group, a borrelia burgdorferi specific primer probe group and other PCR reaction system components, and can realize high-specificity, high-sensitivity and high-accuracy quantitative detection of target genes of the leptospira, the hot-regressive spirospira and the borrelia burgdorferi. The standard requirements of fluorescent PCR and digital PCR multi-gradient standard curve establishment, nucleic acid extraction kit performance verification and clinical diagnosis are met. According to the quality control product, target gene consistency sequences of leptospira, retro-hot spirospira and borrelia burgdorferi are integrated into an escherichia coli artificial chromosome through a homologous recombination technology, the extraction characteristic of a cell structure simulation sample is reserved, the copy number is calibrated through digital PCR, and the quality control product has nuclease degradation resistance.

Description

Technical Field

[0001] This invention belongs to the fields of virology, biotechnology and molecular biology. More specifically, it relates to a spirochete multiplex nucleic acid detection kit and a matching quality control product for engineered bacteria with artificial chromosomes. Background Technology

[0002] The genus *Spirochaeta* includes pathogens such as *Leptospira interrogans* (Lep), *Borrelia* (relapsing fever spirochete), and *Borrelia burgdorferi*. Diseases caused by these species, such as leptospirosis, relapsing fever, and Lyme disease, are significant zoonotic diseases posing a global threat to public health. Leptospirosis is seasonally prevalent in tropical and subtropical regions. According to statistics from the World Health Organization (WHO), there are approximately one million clinical cases globally each year, with a mortality rate of 10%-20% for severe cases. *Borrelia burgdorferi*, the causative agent of Lyme disease, is widely distributed in temperate regions of Europe and America. Data from the US Centers for Disease Control and Prevention (CDC) shows that it reports over 30,000 cases annually, and due to overlapping clinical manifestations with various other diseases, the misdiagnosis rate is as high as 30%-40%. *Borrelia burgdorferi* is transmitted through vectors such as lice and ticks, and sporadic outbreaks still occur in parts of Africa and Asia. Its periodic high fever symptoms often make clinical differentiation difficult.

[0003] Currently, the detection of spirochetal pathogens mainly relies on nucleic acid amplification techniques (such as PCR). However, due to the complex sequence polymorphisms in the genomes of different spirochetal species, and the lack of standardized quality control systems in existing detection methods, the specificity and reproducibility of test results are difficult to guarantee. Literature reports indicate that single-pathogen nucleic acid detection has a high false-positive rate in multi-infection samples, while traditional plasmid-based quality controls, lacking a chromosome-level sequence environment, cannot realistically simulate the presence of pathogen nucleic acids in clinical samples, severely impacting the effective validation of detection methods and the quality control of clinical application reliability.

[0004] Patent searches indicate that existing patents related to spirochetal detection (such as CN119824111A, CN109097438A, CN105628918A, etc.) mostly focus on primer design or kit construction for single pathogens. No publicly reported quality control systems for multiplex detection of Leptospira, Relapsing Thermospira, and Borrelia burgdorferi have been found. Engineered bacteria technology can precisely integrate conserved sequences of target pathogens (such as the Leptospira 16S rRNA gene, the Borrelia burgdorferi fLA gene, and the Relapsing Thermospira flaB gene, etc.) through artificial chromosomes and stably express characteristic nucleic acid templates. Engineered bacteria with artificial chromosomes retain cell structure mimicking samples, are resistant to nuclease degradation, and have controllable copy numbers. The recombinant artificial chromosome exists stably in engineered bacteria at a low copy number, with each engineered bacterium carrying only 1-2 copies of the artificial chromosome. This results in good batch-to-batch consistency, overcoming the variability of natural pathogen culture and the instability of synthesized fragments. Compared to the hundreds of copies of general plasmids, it offers better accuracy and reliability, and can meet the needs of large-scale production and multi-scenario applications.

[0005] Therefore, developing engineered bacterial nucleic acid quality control products covering Leptospira, Relapsing Thermospira, and Borrelia burgdorferi can not only provide standardized positive control references for multiplex nucleic acid detection methods and solve the technical problem that existing quality control products cannot simulate complex genomic environments, but also significantly improve the sensitivity of the detection system through multi-scenario detection verification (including clinical sample screening, epidemiological surveys, and reagent kit quality evaluation). This has important scientific significance and application value for promoting the accurate diagnosis and public health prevention and control of spirochetal-related diseases. Summary of the Invention

[0006] The present invention aims to provide a spirochete multiplex nucleic acid detection kit and a matching quality control product for engineered bacteria with artificial chromosomes.

[0007] Therefore, the present invention adopts the following technical solution:

[0008] This invention provides a multiplex nucleic acid detection kit for spirochetes and a matching quality control kit for engineered bacteria with artificial chromosomes. The kit contains specific primer and probe sets for Leptospira (upstream primer: SEQ ID NO:4, probe: SEQ ID NO:5, downstream primer: SEQ ID NO:6), specific primer and probe sets for Borrelia relapsingii (upstream primer: SEQ ID NO:13, probe: SEQ ID NO:14, downstream primer: SEQ ID NO:15), specific primer and probe sets for Borrelia burgdorferi (upstream primer: SEQ ID NO:22, probe: SEQ ID NO:23, downstream primer: SEQ ID NO:24), and an internal standard RNase-P gene detection kit (upstream primer: SEQ ID NO:31, probe: SEQ ID NO:32, downstream primer: SEQ ID NO:33).

[0009] The primer and probe set has been rigorously screened to ensure high specificity (no cross-reactivity), high sensitivity (detection limit <500 copies / mL), and amplification efficiency meeting standards (90%-110%). The kit also includes PCR premix (containing hot-start DNA polymerase, UNG enzyme, dNTPs, MgCl2, and an optimized buffer system, supporting simultaneous detection of FAM / VIC / ROX / CY5 quadruple fluorescence channels) and accompanying quality control materials.

[0010] Using the shuttle plasmid vector pBac-N-EGFP (Beyotime, catalog number D2805) and DH10Bac competent cells (Beyotime, catalog number D0346) system from Beyotime Biotechnology, artificial chromosomes were constructed via Tn7 transposon-mediated homologous recombination. The original application of this system was to transfer recombinant artificial chromosomes into insect cells and package them to produce recombinant baculoviruses. However, this invention only involves generating recombinant artificial chromosomes carrying the target gene through shuttle plasmid-mediated homologous recombination, representing another application of this system. It should be noted that the construction of recombinant artificial chromosomes in this invention is not limited to using the shuttle plasmid vector pBac-N-EGFP and DH10Bac competent cells; other shuttle plasmids and artificial chromosome systems can also achieve this technical objective. The specific steps for constructing the recombinant artificial chromosome are as follows: First, the shuttle plasmid pBac-N-EGFP vector was digested with EcoRI / HindIII. Then, the target fragments (SEQ ID NO: 1-3) of the target genes of Leptospira, Treponema relapsingii, and Borrelia burgdorferi were amplified by PCR. The fragments were then ligated and transformed using In-Fusion HD enzyme for identification, and the recombinant shuttle plasmid was constructed. The resulting recombinant shuttle plasmid was transformed into DH10Bac competent cells. Positive clones carrying the target genes were obtained through blue-white screening on a medium containing kanamycin / tetracycline / gentamicin / X-Gal / IPTG. The engineered bacterial strain was then identified by PCR amplification and sequencing.

[0011] The quality control preparation process includes: heat inactivation after culturing engineered bacteria, followed by adjustment to five 10-fold concentration gradients using phosphate buffered saline, while maintaining the integrity of the cell structure. DNA was extracted from the engineered bacteria quality control samples using a nucleic acid extraction kit, and the nucleic acid copy number was accurately determined by digital PCR.

[0012] When the kit and quality control products are used together, the detection process includes: nucleic acid extraction (the sample to be tested is treated with a DNA / RNA purification kit), PCR amplification (reaction system: 20 μL premixed solution + 5 μL nucleic acid extraction solution; cycling conditions: 50℃ C2min → 95℃ 5min → 40 cycles (95℃ 10s → 60℃ 20s)), and the results are interpreted based on the Ct values ​​of the FAM / VIC / ROX / CY5 channels and the amplification curve. The core function of the quality control products includes establishing a fluorescent PCR standard curve (meeting R...). 2 >0.99, amplification efficiency E=0.9~1.1 (standard), and full-process quality control (verifying the performance of nucleic acid extraction kits, monitoring PCR accuracy and precision).

[0013] The main technical advantages of this invention are: 1) The spirochetal multiplex fluorescent PCR nucleic acid detection kit detects spirochetes simultaneously with multiple targets, avoiding missed detections and improving throughput and efficiency; 2) The engineered bacterial quality control retains cell structure, mimics the nucleic acid extraction characteristics of the sample, resists nuclease degradation, and has controllable copy number; 3) The recombinant artificial chromosome exists stably in engineered bacteria at a low copy number, with each engineered bacterium carrying only 1-2 copies of the artificial chromosome, resulting in good batch-to-batch consistency and overcoming the variability of natural pathogen culture and the instability of synthesized fragments. Compared to the hundreds of copies of general plasmids, it has better accuracy and higher reliability; 4) After heat inactivation and buffer dilution, it has the ability to resist nuclease degradation and has good storage stability; 5) The copy number of the artificial chromosome is accurately calibrated by digital PCR, ensuring the controllability and traceability of concentration gradients (≥6 10-fold gradients); 6) The synergistic design of the kit and quality control achieves standardized quality control throughout the entire process. The quality control is used to establish a fluorescent PCR standard curve, covering error monitoring throughout the entire process from nucleic acid extraction to PCR amplification. 7) The combined system can validate the performance of nucleic acid extraction kits (such as extraction efficiency and inhibitor tolerance) and be used for accuracy and precision quality control of fluorescent PCR and digital PCR. It can also provide standardized and reproducible detection tools for the clinical diagnosis of spirochetes, promoting inter-laboratory result recognition. Attached Figure Description

[0014] Figure 1 The figure shows the experimental verification results of cross-reactivity and competitive interference of the spirochetal multiplex detection kit in Example 6 of this invention.

[0015] Figure 2 The results show the linearity and amplification efficiency of Leptospira in the multiplex detection kit for Leptospira in Example 7 of this invention.

[0016] Figure 3 The results show the linearity and amplification efficiency of the regression thermal spirochetes in the spirochetes multiplex detection kit of Example 7 of this invention.

[0017] Figure 4 The results show the linearity and amplification efficiency of *Borrelia burgdorferi* in the multiplex detection kit for spirochetes in Example 7 of this invention.

[0018] Figure 5 The image shows the pBac-Lep-16S-M plasmid vector constructed in Example 8 of this invention, with only elements relevant to this application labeled.

[0019] Figure 6 The image shows the pBac-Bore-flaB-M plasmid vector constructed in Example 8 of this invention, with only elements relevant to this application labeled.

[0020] Figure 7The image shows the pBac-Bob-fla-M plasmid vector constructed in Example 8 of this invention, with only elements relevant to this application labeled.

[0021] Figure 8 The results of spirochete quality control and plasmid nuclease treatment in Example 12 of this invention are shown. The results show that the Ct values ​​of the quality control were not significantly different before and after nuclease treatment; however, the Ct values ​​of the plasmid changed significantly after nuclease treatment. Figure 9 This document presents the verification results of the extraction and monitoring capabilities of the spirochete quality control sample and plasmid (E6 copies / mL) in Example 13 of this invention. The results show that the Ct value of the quality control sample differed significantly before and after extraction; however, there was no significant difference in the Ct value between plasmid extraction and non-extraction conditions.

[0022] Figure 10 The Ct values ​​of the spirochete quality control sample in Example 14 of this invention are statistically analyzed under storage conditions of 4°C, 25°C, and 37°C. The results show that the Ct values ​​of the quality control sample did not differ significantly at the three storage temperatures. Figure 11 The results of repeatability testing of engineered spirochetal bacteria quality control samples using the spirochetal multiplex detection kit in Example 15 of this invention are shown. The results indicate that the amplification curves highly overlap, suggesting good repeatability. Detailed Implementation

[0023] The specific embodiments of the present invention are described below to enable those skilled in the art to understand the present invention. However, it should be understood that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, various changes are obvious as long as they are within the spirit and scope of the present invention as defined and determined by the appended claims. All inventions utilizing the concept of the present invention are protected.

[0024] definition

[0025] In this invention, the range of values ​​represented by “value A ~ value B” or “value A - value B” refers to the range that includes the endpoint values ​​A and B.

[0026] In this invention, the numerical range indicated by "above" or "below" refers to the numerical range that includes the stated number.

[0027] In this invention, the word "may" has both the meaning of performing a certain process and the meaning of not performing a certain process. In this specification, "optional" or "optionally" means that the event or situation described below may or may not occur, and the description includes both the case where the event occurs and the case where the event does not occur.

[0028] In this invention, the terms "a", "an", or "the" may refer to "one", "one or more", "at least one", or "one or more".

[0029] In this invention, the terms "comprising," "having," "including," or "containing" can mean included or open-ended, and do not exclude additional, uncited elements or method steps. At the same time, "comprising," "having," "including," or "containing" can also mean closed-ended, excluding additional, uncited elements or method steps.

[0030] In this invention, the term "about" can mean that a value includes the standard deviation of the error of the apparatus or method used to determine that value. The numerical ranges and parameters used to define the present invention are approximate values, and the relevant values ​​in the specific embodiments have been presented as precisely as possible. However, any value inevitably contains a standard deviation due to the aforementioned testing apparatus or method. Therefore, unless explicitly stated otherwise, it should be understood that all ranges, quantities, values, and percentages used in this invention are modified with "about". Here, "about" generally means that the actual value is within ±10%, ±5%, ±1%, or ±0.5% of a particular value or range.

[0031] In this invention, "target gene" refers to the gene targeted by nucleic acid detection. For example, when nucleic acid detection is performed using PCR, the target gene includes the gene fragment to be amplified by PCR.

[0032] In this invention, a "vector" is a replicon, such as a plasmid, bacteriophage, virus, artificial chromosome, or granule, to which another DNA segment (i.e., an "insertion") may be attached to the replicon to induce replication of the attached segment in the cell. Further, the vector may include, for example, a collection of genetic elements that regulate gene expression, such as promoters and enhancers; (2) a structural or coding sequence transcribed into mRNA and translated into protein; and (3) a transcriptional subunit containing appropriate transcription and translation initiation and termination sequences.

[0033] In this invention, the shuttle plasmid vector pBac-N-EGFP (from Beyotime Biotechnology, catalog number D2805) is originally used to transfer recombinant artificial chromosomes into insect cells to package and produce recombinant baculoviruses. However, this application only involves generating recombinant artificial chromosomes carrying the target gene through homologous recombination mediated by the shuttle plasmid, representing another application of this system. It should be noted that the construction of recombinant artificial chromosomes in this invention is not limited to using the shuttle plasmid vector pBac-N-EGFP and DH10Bac competent cells; other shuttle plasmids and artificial chromosome systems can also achieve this technical objective. This vector possesses an E. coli replication origin and selection marker, enabling it to survive and replicate in E. coli. Furthermore, "engineered bacteria carrying artificial chromosomes" refers to engineered E. coli bacteria carrying the identical sequences of Leptospira 16S rRNA, Treponema relapsingis flaB gene, and Borrelia burgdorferi fla gene.

[0034] In this invention, "consistent sequence," "optimized sequence," or "consistent optimized sequence" refers to a representative nucleotide sequence generated by performing site-specific statistical analysis on a set of functional or evolutionarily related nucleotide sequences using multiple sequence alignment (MSA) technology.

[0035] In this invention, a "standard curve conforming to the requirements of quantitative PCR detection specifications" refers to a linear relationship curve between the cycle threshold (Ct value) and the logarithm of the initial template concentration, established after serially diluting a standard of known concentration (such as plasmid DNA or purified PCR product) and amplifying it by fluorescent PCR. This standard curve must meet the requirements of the specification "Performance Evaluation Requirements for Biotechnology Nucleic Acid Target Sequence Quantification Methods: qPCR and dPCR" (GB / T42077-2022), namely, a linear correlation coefficient (R²). 2 The amplification efficiency (E) was greater than 0.99 and within the range of 0.9 to 1.1, to verify the accuracy, sensitivity and quantitative reliability of the detection system.

[0036] Unless otherwise defined, other technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0037] The 16S rRNA gene sequence of Leptospira (Lep) in this application is: SEQ ID NO:1.

[0038] The flaB gene sequence of *Bore* regressor: SEQ ID NO:2.

[0039] The fla gene sequence of Borrelia burgdorferi (Bob): SEQ ID NO:3.

[0040] Upstream primer sequence for Leptospira fluorescent PCR: SEQ ID NO:4.

[0041] Leptospira fluorescent PCR probe sequence: SEQ ID NO:5.

[0042] Reverse primer sequence for Leptospira fluorescent PCR: SEQ ID NO:6.

[0043] Upstream primer sequence for fluorescent PCR of Regression Thermospira: SEQ ID NO:13.

[0044] Regression of the heat spirochete fluorescent PCR probe sequence: SEQ ID NO:14.

[0045] Regression of the heat spirochete fluorescent PCR downstream primer sequence: SEQ ID NO:15.

[0046] Upstream primer sequence for fluorescent PCR of Borrelia burgdorferi: SEQ ID NO:22.

[0047] Borrelia burgdorferi fluorescent PCR probe sequence: SEQ ID NO:23.

[0048] Downstream primer sequence for fluorescent PCR of Borrelia burgdorferi: SEQ ID NO:24.

[0049] Nucleotide sequence of primer Lep-16S-F: SEQ ID NO:34.

[0050] Nucleotide sequence of primer Lep-16S-R: SEQ ID NO:35.

[0051] Nucleotide sequence of primer Bore-flaB-F: SEQ ID NO:36.

[0052] Nucleotide sequence of primer Bore-flaB-R: SEQ ID NO:37.

[0053] Nucleotide sequence of primer Bob-fla-F: SEQ ID NO:38.

[0054] Nucleotide sequence of primer Bob-fla-R: SEQ ID NO:39.

[0055] pUC / M13-F primer sequence: SEQ ID NO:40.

[0056] pUC / M13-R primer sequence: SEQ ID NO:41.

[0057] The method for preparing artificial chromosomes of engineered bacteria is as follows:

[0058] 1. Sequence acquisition and vector digestion and recovery

[0059] - Synthesized identical sequences (SEQ ID NO:1-3) of Leptospira 16S rRNA gene, Leptospira relapsingii flaB gene, and Leptospira burgdorferi fla gene, with lengths of 1514 bp, 10 bp, and 584 bp, respectively.

[0060] - The fragment was amplified using specific primer pairs (SEQ ID NO: 34-39) and Q5 enzyme (NEB, catalog number M0493L).

[0061] - The pBac-N-EGFP vector was digested with EcoRI / HindIII. The reaction mixture consisted of 5 μL of 10×M buffer, 1 μL of each restriction enzyme, 1.5 μg of plasmid, and ddH2O to a final volume of 50 μL. The mixture was then incubated at 37°C for 3 h.

[0062] - Gel recovery and purification of amplified fragments and linear vectors.

[0063] 2. Seamlessly connect and construct recombinant plasmids

[0064] - The target fragment was ligated to the pBac linear vector. The system consisted of 2 μL of 5×In-FusionHDEnzymePremix, 2 μL of vector, 2 μL of fragment, and 4 μL of ddH2O. The reaction was carried out at 50 °C for 15 min.

[0065] -Recombinant plasmids pBac-Lep-16S-M, pBac-Bore-flaB-M, and pBac-Bob-fla-M were obtained.

[0066] 3. Plasmid transformation and positive clone screening

[0067] - The ligation product was transformed into DH5α competent cells (Takara, catalog number 9057), plated on ampicillin-resistant LB plates, and cultured overnight at 32-37°C.

[0068] - Plasmids were extracted using the alkaline lysis method, purified by column chromatography, and positive clones were identified by PCR and verified by sequencing.

[0069] 4. Construction of engineered bacteria for artificial chromosomes

[0070] - The recombinant plasmid was transferred into DH10Bac competent cells (Beyotime, D0346) containing the bMON14272 vector and helper plasmid, and an artificial chromosome was formed through mini-Tn7 transposition.

[0071] - White clones were selected using blue-white screening (LB medium containing kanamycin / tetracycline / gentamicin / X-Gal / IPTG).

[0072] - Positive colonies were inoculated into liquid LB medium (containing the same antibiotic) and cultured at 37°C to obtain engineered bacteria.

[0073] -The DNA of the engineered bacteria was extracted using a nucleic acid extraction kit (Omega, catalog number D2156), and verified by PCR and sequencing using pUC / M13-F / R primers (SEQ ID NO:40 / 41). The qualified bacterial strain was then preserved.

[0074] The embodiments of the present invention will be described in detail below with reference to examples. However, those skilled in the art will understand that the following examples are for illustrative purposes only and should not be considered as limiting the scope of the invention. Unless otherwise specified, specific conditions in the examples are performed under conventional conditions or conditions recommended by the manufacturer. Unless otherwise specified, all materials and instruments used are conventional products that can be purchased.

[0075] Example 1: Optimization of Helical Sequence

[0076] 1.1 Target sequence selection design for Leptospira, Borrelia relapsingii, and Borrelia burgdorferi: First, bioinformatics methods were used to obtain Leptospira, Borrelia relapsingii, and Borrelia burgdorferi sequences from the authoritative NCBI database. Multiple sequence alignment tools MAFFT and ClustalOmega software were used to perform multiple alignments on the selected sequences, eliminating obvious insertion and deletion regions to ensure the accuracy and consistency of the alignment. Attention was paid to avoiding crossover with host or other non-target pathogen sequences in characteristic conserved regions.

[0077] 1.2 Synthesis of Consensus Sequences: Following sequence alignment of Lep, Bore, and Bob, the final full-length concordance sequences of the Lep 16S rRNA gene, Bore flaB gene, and Bob fla gene were obtained, abbreviated as Lep-16S-M, Bore-flaB-M, and Bob-fla-M, respectively. Genome assembly was performed according to the start and end sites of the gene sequences, resulting in sequences of 1514 bp, 1008 bp, and 1011 bp in length (as shown in Table 1, SEQ ID NO: 1-3). These sequences were sent to GenScript Biotech Co., Ltd. for synthesis, yielding conventional pUC plasmids containing the helical concordance sequence target fragment (named pUC57-Lep-16S-M, pUC57-Bore-flaB-M, and pUC57-Bob-fla-M). The target sequences shown in Table 1 were ultimately obtained.

[0078] Table 1. Spirochete Consistency Sequence

[0079]

[0080]

[0081]

[0082] Example 2: Design of primer and probe sets for multiplex nucleic acid detection of spirochetes

[0083] Sequences of the *Leptospira* 16S rRNA gene, *Treponema pallidum* flaB gene, and *Breponema burgdorferi* fla gene were obtained from the NCBI database. Highly conserved and specific regions were selected as target sequences to ensure that primers and probes could specifically recognize *Leptospira*, *Breponema burgdorferi*, and *Treponema pallidum*. Preliminary primer and probe designs were performed on the target sequences using professional primer design software (Oligo 7.0). The software automatically generates a large number of candidate primer and probe sequences based on the input sequence. The initially generated candidate sequences were then screened according to design principles. Specific screening criteria are as follows:

[0084] PCR product size: Select primer pairs that can amplify products of 50-150 bp. This product size helps improve reaction sensitivity and amplification efficiency.

[0085] GC content: Screen primer and probe sequences with GC content between 30% and 80%. Appropriate GC content ensures the stability of primer and probe binding to the template.

[0086] Repeated sequences: Primers and probes containing more than four consecutive G repeats were removed. Consecutive G repeats may cause primers or probes to form secondary structures, affecting amplification efficiency.

[0087] TM value: Select sequences with a probe TM value of 68-70℃ and a primer TM value of 58-60℃. An appropriate range of TM values ​​helps ensure specific binding of primers and probes in the PCR reaction.

[0088] Length requirements: Select probe sequences with a length of 13-30 bp and primer sequences with a length of approximately 20 bp. Appropriate lengths ensure the specificity and binding ability of the primers and probes.

[0089] Base distribution:

[0090] The probe should avoid six consecutive A's, and the 5' end should not start with a G. The number of G's in the first four sequences of the 3' end of the probe should not exceed three.

[0091] After the above screening process, primer and probe combinations for nucleic acid detection of Leptospira, Relapsing Thermospira, and Borrelia burgdorferi were obtained (see Tables 2.1, 2.2, and 2.3).

[0092] Table 2.1 Primer and probe combinations for Leptospira nucleic acid detection

[0093]

[0094] Table 2.2 Primer and probe combinations for detecting Treponema pallidum nucleic acid

[0095]

[0096] Table 2.3 Primer and probe combinations for the detection of Borrelia burgdorferi nucleic acid

[0097]

[0098] Table 2.4 Primers and probes for internal standard RNase-P gene nucleic acid detection

[0099]

[0100]

[0101] Example 3: Screening of primer and probe sets for multiplex nucleic acid detection of spirochetes

[0102] To screen specific primer-probe combinations for Leptospira, Borrelia burgdorferi, and Treponema pallidum, and to establish a highly sensitive, cross-reactive multiplex fluorescent PCR detection system, four primer-probe combinations were designed for fluorescent PCR performance screening. The optimal combination was determined by evaluating amplification efficiency (acceptable range 90%-110%), Ct value, whether the amplification curve was S-shaped, fluorescence signal increment (greater than 1000), whether the blank control showed a line, cross-reactivity (testing Leptospira, Borrelia burgdorferi, Treponema pallidum, and the human genome), competitive interference (testing Leptospira, Borrelia burgdorferi, Treponema pallidum, and the internal standard), and sensitivity (limit of detection lower than 500 copies / ml).

[0103] Leptospira primer-probe combination 1 met all performance indicators. Combinations 2 and 3 were excluded due to the blank control showing a line. The results are shown in Table 3.1. Therefore, Leptospira primer-probe combination 1 was selected as the primer-probe combination for the Leptospira multiplex nucleic acid detection system. Its sequence will be directly applied to the construction of the detection kit in the claims.

[0104] Table 3.1 Results of Leptospira primer and probe screening

[0105]

[0106]

[0107] The recurrent heat spirochete primer-probe combination 1 met all performance indicators. Combination 2 was excluded because the fluorescence PCR signal value was less than 1000. Although combination 3 met the performance indicators such as amplification efficiency, fluorescence signal increment value and S-shaped amplification curve, it was excluded due to competitive interference. The results are shown in Table 3.2. Therefore, the recurrent heat spirochete primer-probe combination 1 was selected as the primer-probe combination for the spirochete multiplex nucleic acid detection system. Its sequence will be directly used in the construction of the detection kit in the claims.

[0108] Table 3.2 Results of primer and probe screening for Regression Thermospiror

[0109]

[0110] Borrelia burgdorferi primer-probe combination 1 met all performance indicators. Although combinations 2 and 3 met the performance indicators such as amplification efficiency, fluorescence signal increment, and S-shaped amplification curve, they were excluded due to competitive interference. The results are shown in Table 3.2. Therefore, Borrelia burgdorferi primer-probe combination 1 was selected as the primer-probe combination for the spirochete multiplex nucleic acid detection system, and its sequence will be directly used in the construction of the detection kit in the claims.

[0111] Table 3.2 Results of primer and probe screening for Borrelia burgdorferi

[0112]

[0113]

[0114] Example 4: Kit for multiplex nucleic acid detection of spirochetes

[0115] This embodiment provides a kit for multiplex nucleic acid detection of spirochetes. The kit consists of a PCR premix (containing hot-start DNA polymerase, UNG, PCR buffer, MgCl2, dNTPs, and the primer and probe set screened in Example 3), a positive control, and a negative control; wherein the PCR reaction solution is composed of 2xFastAmpliPremix-UNGIV (Probe qPCR) (12.5μL), Lep-16S-F1 (10μM, 0.1μL), Lep-16S-R1 (10μM, 0.5μL), Lep-16S-PB1 (10μM, 0.25μL), Bore-flaB-F1 (10μM, 0.5μL), Bore-flaB-R1 (10μM, 0.5μL), Bore-flaB-PB1 (10μM, 0.25μL), Bob-fla-F1 (10μM, 0.5μL), Bob-fla-R1 (10μM, 0.5μL), Bob-fla-PB1 (10μM, 0.25μL) and DNase / RNase-freeWater.

[0116] The positive control consists of a plasmid containing the detection targets of Leptospira, Relapsing Thermospira, and Borrelia burgdorferi. The specific preparation method is as follows: take a plasmid stock solution with an initial concentration of 1 ng / μL, and dilute it 10-fold in four steps to obtain the positive control working solution.

[0117] The negative control was DNase / RNase-free Water.

[0118] Example 5: A method for detecting multiplex nucleic acids of spirochetes

[0119] This embodiment provides a method for detecting spirochetes and spirochetal multiplex nucleic acids. The method uses the kit from Example 4 and includes the following steps:

[0120] Step 1: Extract the nucleic acid from the sample using a viral DNA / RNA purification kit to obtain the nucleic acid extract;

[0121] Step 2: Mix 5 μL of nucleic acid extract, 5 μL of negative control, and 5 μL of positive control with 20 μL of PCR premix, and perform fluorescent PCR using a fluorescent PCR instrument (reaction system and conditions are shown in Tables 5.1 and 5.2). Select the FAM, ROX, and CY5 channels to collect fluorescence signals. Based on the collected fluorescence signals, refer to the positive and negative controls to determine whether there is spirochetal infection in the sample to be tested (when analyzing the results, the baseline fluorescence signal is taken as 3-10 or 6-15 cycles, and the threshold is set so that the threshold line just exceeds the highest point of the amplification curve of the normal negative control). The normal results of the positive and negative controls are shown in Table 5.3, and the criteria for judging whether there is spirochetal infection in the sample to be tested are shown in Table 5.4.

[0122] Table 5.1 PCR reaction system

[0123] Components Added amount PCR premix 20μL sample 5μL

[0124] Table 5.2 PCR reaction conditions

[0125]

[0126] Table 5.3 Normal results for positive and negative controls

[0127] Group aisle Normal result negative control FAM, ROX, CY5 No numerical value Positive control FAM, ROX, CY5 CT≤35 and has an S-shaped amplification curve

[0128] Table 5.4 Criteria for Judging Treponema Multiplex Nucleic Acid Detection

[0129]

[0130]

[0131] Example 6: Cross-reactivity validation of the spirochetal multiplex detection kit

[0132] This experiment aimed to verify the specificity of the kit for Leptospira, Treponema relapsingii, and Borrelia burgdorferi targets, ensuring no cross-reactivity in the multichannel (FAM / ROX / CY5). Experimental materials included: plasmid pUC57-Lep-16S-M (SEQ ID NO:1) containing the Leptospira target sequence, plasmid pUC57-Bore-flaB-M (SEQ ID NO:2) containing the Treponema relapsingii target gene sequence, plasmid pUC57-Bob-fla-M (SEQ ID NO:3) containing the Borrelia burgdorferi target gene sequence, and the multiplex detection kit constructed in Example 4 (containing primer and probe sets SEQ ID NO:4-6, 13-15, and 22-24) and a negative control (DNase / RNase-free Water). Target plasmids (concentration 1×10⁻⁶) were directly used. 6Samples were taken in duplicate (copies / μL) and tested according to the Q-PCR system (Table 5.1) and conditions (Table 5.2) of Example 5: the FAM channel used the Borrelia burgdorferi probe (SEQ ID NO:5), the ROX channel used the Relapsing Thermospira probe (SEQ ID NO:14), and the CY5 channel used the Leptospira probe (SEQ ID NO:23). Each sample was repeated twice. The results are shown in Table 6 and... Figure 1 As shown, Leptospira plasmids were specifically detected in the CY5 channel, with no signal in other channels; Relapsing fever spirochetes plasmids were specifically detected in the ROX channel, with no signal in other channels; Borrelia burgdorferi plasmids were specifically detected in the FAM channel, with no signal in other channels; the negative control showed no detection in any of the three channels. The conclusion indicates that the spirochetes multiplex kit of the present invention has been verified to have no cross-reactivity and meets the clinical specificity criteria (based on the screening criteria of Example 3 and the judgment threshold Ct≤35 of Example 5).

[0133] Table 10. Cross-reactivity validation results of the spirochetal multiplex detection kit

[0134]

[0135]

[0136] Example 7: Amplification efficiency and linearity of the spirochetal multiplex detection kit

[0137] The engineered bacterial quality control sample was serially diluted 10-fold at an initial concentration of 1.0E+07 copies / mL five times to obtain a series of serially diluted products. After nucleic acid extraction, the products were detected by q-PCR using the spirochetal multiplex detection kit of this invention (qPCR reaction conditions were the same as in Example 5), with two replicates for each concentration. The results are shown in Table 7. Figure 2-4 As shown, according to the "Performance Evaluation Requirements for Biotechnology Nucleic Acid Target Sequence Quantification Methods: qPCR and dPCR" (GB / T42077-2022), the linear correlation coefficient and amplification efficiency of the engineered bacteria quality control samples both met the standards (R0). 2 >0.99, amplification efficiency E in the range of 90%-110%. This shows that the Spirochete Multiplex Detection Kit of the present invention has good linearity and amplification efficiency.

[0138] Table 9.1 Amplification efficiency and linearity test results of the Spirochete Multiplex Detection Kit

[0139]

[0140] Example 8: Construction of pBac-Lep-16S-M, pBac-Bore-flaB-M, and pBac-Bob-fla-M plasmid vectors containing helices

[0141] 8.1 PCR amplification and purification recovery of spirochete homologous sequences

[0142] Table 8.1 Nucleotide sequences of amplification primers for the designed sequences

[0143]

[0144]

[0145] Specific primer pairs (SEQ ID NO:34-39) were designed for plasmid vector construction, as shown in Table 8.1. PCR amplification was performed using the primers in Table 8.1 to synthesize fragments with lengths of approximately 1500 bp, 1008 bp, and 1011 bp, as shown in SEQ ID NO:1-3. The PCR reaction system is shown in Table 8.2 below.

[0146] Table 8.2 PCR reaction system

[0147]

[0148] The PCR reaction procedure is shown in Table 8.3 below.

[0149] Table 8.3 PCR reaction procedure

[0150]

[0151] After the reaction was completed, the amplification product was subjected to agarose gel electrophoresis, and the target fragment was purified and recovered using a Takara gel recovery kit.

[0152] 8.2 Preparation of the linear vector pBac-N-EGFP for plasmids

[0153] The plasmid pBac-N-EGFP was double-digested with the restriction endonucleases HindIII and EcoRI. The digestion reaction system is shown in Table 8.4 below.

[0154] Table 8.4 Enzyme digestion reaction system

[0155]

[0156]

[0157] The enzyme digestion reaction procedure is shown in Table 8.5 below.

[0158] Table 8.5 Enzyme digestion reaction procedure

[0159] temperature time 37℃ 3h

[0160] The linear vector pBac-N-EGFP was purified and recovered using a Takara gel recovery kit and used for fragment ligation.

[0161] 8.3 Ligation of Linear Vectors with Target Fragments

[0162] Using Takara's homologous recombination kit In- HD Cloning Plus seamlessly ligates the target fragment Lep-16S-M (SEQ ID NO:1), Bore-flaB-M (SEQ ID NO:2), or Bob-fla-M (SEQ ID NO:3) into the linear vector pBac-N-EGFP. The 10 μL reaction mixture is shown in Table 8.6 below, and ligation is performed at 50°C for 15 minutes.

[0163] Table 8.6 Connection Reaction System

[0164] Components Added amount 5×In-FusionHDEnzymePremix 2μL Target fragment: Lep-16S-M, Bore-flaB-M, or Bob-fla-M 50-100ng linear vector pBac-N-EGFP 50-100ng

[0165] 8.4 Transformation

[0166] The ligation product was added to Takara competent E. coli DH5α competent cells and mixed gently. After incubating on ice for 10-30 minutes, the cells were placed in a 42°C water bath for 30-60 seconds, then immediately removed and placed on ice for 2-5 minutes. 700 μL of SOC medium (pre-incubated at 37°C) was added, and the cells were incubated at 37°C with shaking for 1 hour (180 rpm). An appropriate amount was then spread onto LB solid medium (ampicillin, Amp, final concentration 100 μg / mL), and the plates were incubated upside down at 37°C overnight.

[0167] 8.5 Identification of positive plasmids

[0168] Four monoclonal bacteria were selected for culture PCR. The primers are shown in Table 8.7 below:

[0169] Table 8.7 Primer Sequences

[0170]

[0171] The PCR reaction system is shown in Table 8.8 below:

[0172] Table 8.8 PCR Reaction System

[0173]

[0174] The PCR reaction procedure is shown in Table 8.9 below:

[0175] Table 8.9 PCR Reaction Procedure

[0176]

[0177] After the reaction, a small amount of amplification product was taken for agarose gel electrophoresis. The results showed that all four single clones produced the corresponding target bands. Sequencing analysis identified the sequences in the positive clones that matched Lep-16S-M (SEQ ID NO:1), Bore-flaB-M (SEQ ID NO:2), or Bob-fla-M (SEQ ID NO:3), and these were named pBac-Lep-16S-M, pBac-Bore-flaB-M, and pBac-Bob-fla-M plasmid vectors, respectively. The chromatograms are shown below. Figure 5 , Figure 6 and Figure 7 As shown.

[0178] Example 9: Construction and PCR Verification of Engineered Bacteria Carrying Artificial Chromosomes

[0179] 9.1 Construction of engineered bacteria carrying artificial chromosomes:

[0180] Add 100 ng of pBac-Lep-16S-M, pBac-Bore-flaB-M, or pBac-Bob-fla-M plasmids to competent DH10Bac cells and place on ice for 30 min. Heat shock in a 42℃ water bath for 50-100 s, then immediately place on ice for 2-5 min. Add 700 μL of LB medium and incubate at 37℃ with a shaker at 200 rpm for 2-4 h. Spread 200 μL of the cultured bacterial solution evenly onto LB fixation medium containing 50 μg / mL kanamycin, 7 μg / mL tetracycline, 10 μg / mL gentamicin, 40 μg / mL X-Gal, and 40 μg / mL IPTG. Invert the plates and incubate at 37℃ for 24-72 h.

[0181] Select positive white monoclonal colonies and place them into 3-5 mL of LB liquid medium containing 50 μg / mL kanamycin, 7 μg / mL tetracycline, and 10 μg / mL gentamicin. Incubate at 37°C and 200 rpm for 20-30 h. Extract artificial chromosome DNA from the engineered bacteria using the OmegaBAC / PAC large basic plasmid extraction kit.

[0182] 9.2 PCR verification of engineered bacteria using artificial chromosomes:

[0183] Using 1 μg of engineered bacterial artificial chromosome DNA as a template, PCR verification and sequencing were performed using pUC / M13-F (CCCAGTCACGACGTTGTAAAACG) (SEQ ID NO:40) and pUC / M13-R (AGCGGATAACAATTTCACACAGG) (SEQ ID NO:41) as primers. After confirming the PCR identification and sequencing alignment were correct, the next step of the experiment was performed. The PCR verification system was as follows: 25 μL of 2×T5 buffer, 23 μL of ddH2O, 1 μL each of 10 μmol / L pUC / M13 upstream primer, and 1 μg of artificial chromosome DNA.

[0184] The PCR amplification reaction conditions are shown in Table 9.1 below:

[0185] Table 9.1 PCR reaction conditions

[0186]

[0187] The PCR verification results of the engineered bacteria's artificial chromosome DNA were correct, containing the target gene and part of the vector linker region sequence. The PCR product was sequenced and identified; the sequence was consistent with Lep-16S-M (SEQ ID NO:1), Bore-flaB-M (SEQ ID NO:2), or Bob-fla-M (SEQ ID NO:3), indicating that the engineered bacteria carrying the artificial chromosome were successfully constructed.

[0188] Example 10: Preservation and Use of Engineered Bacterial Strains Carrying Artificial Chromosomes

[0189] 10.1 Preservation of engineered bacterial strains carrying artificial chromosomes:

[0190] First, prepare the bacterial culture preservation solution: aliquot and sterilize glycerol and LB liquid medium to prepare LB medium with a final concentration of 50 μg / mL kanamycin, 7 μg / mL tetracycline, and 10 μg / mL gentamicin, and use it to dilute the glycerol (ratio 1:1); take 500 μL of the bacterial culture for preservation, add 500 μL of diluted glycerol, mix well, place in a 1.5 mL EP tube, and label with the strain number, strain name, preservation date, operator, and other information; then store the glycerol culture backup in a -80℃ freezer.

[0191] 10.2 Instructions for using engineered bacteria carrying artificial chromosomes:

[0192] Remove the glycerol bacteria and rewarm them at room temperature or 2–8°C until thawed. Spread a small amount of the bacterial suspension onto a plate and incubate it in LB broth containing 50 μg / mL kanamycin, 7 μg / mL tetracycline, 10 μg / mL gentamicin, 40 μg / mL X-Gal, and 40 μg / mL IPTG. Invert the plate and incubate at 37°C for 24–48 hours. Pick positive white monoclonal colonies and transfer them to 3–5 mL of LB liquid broth containing 50 μg / mL kanamycin, 7 μg / mL tetracycline, and 10 μg / mL gentamicin. Incubate at 37°C and 200 rpm for 20–30 hours. The bacterial suspension is used to extract artificial chromosome DNA for subsequent quality control testing.

[0193] Example 11: Preparation and Production of Raw Materials and Finished Products for Engineered Microorganism Quality Control Products

[0194] 11.1 Heat inactivation of engineered bacterial cultures carrying artificial chromosomes

[0195] Place the centrifuge tubes containing the engineered bacterial culture into a 60°C water bath. Ensure a tight seal to prevent leakage during heating. After heating for 1 hour, remove the inactivated culture as raw material for quality control of the engineered bacteria.

[0196] 11.2 Extraction and preparation of bacterial artificial chromosome DNA

[0197] The engineered bacterial control samples were serially diluted with phosphate-buffered saline to obtain sufficient concentrations of engineered bacteria. Nucleic acid was extracted from the engineered bacterial control samples at different concentrations using the MagaBioplus Viral DNA / RNA Purification Kit (Hangzhou Bori Technology Co., Ltd., catalog number BSC86S1E). Following the kit instructions, purified nucleic acid solutions were finally obtained.

[0198] 11.3 Digital PCR (ddPCR) Assay

[0199] Using the extracted nucleic acid as a template, prepare a reaction system containing the nucleic acid template, ddPCR reaction premix, primers, and probes, referring to the finished kit, ensuring accurate proportions of each component. Transfer the prepared reaction system to a digital PCR instrument for testing (ddPCR reaction system and conditions are shown in Tables 11.1 and 11.2) to directly obtain the absolute concentration of the target nucleic acid in the sample, thereby calculating the nucleic acid concentration in the engineered bacterial quality control sample.

[0200] Table 11.1 ddPCR reaction system

[0201] Components Added amount PCR reaction solution 19μL enzyme mixture 1μL sample 5μL

[0202] Table 11.2 ddPCR reaction conditions

[0203]

[0204] 11.4 Preparation of engineered microbial quality control products

[0205] The raw materials of engineered spirochetes of known concentration were mixed and diluted according to the set values ​​to obtain the finished engineered spirochetes of different concentrations.

[0206] Example 12: Verification of nuclease tolerance in engineered bacterial quality control samples

[0207] The engineered bacterial control samples prepared in Example 11 and the conventional plasmids from Example 1 (hereinafter referred to as plasmids) (both E8 copies / mL) were digested with Thermo#EN0521 DNase I at 37°C for 30 min (working concentration: 0.1 U per ng of nucleic acid), followed by inactivation at 70°C for 10 min. A control group without any treatment was also included. Each group was tested in duplicate. The samples were then cumulatively diluted 100-fold and subjected to Q-PCR detection using the Spirochete Multiplex Detection Kit of this invention (QPCR reaction conditions were the same as in Example 5). Each sample was tested twice. The results are as follows: Figure 8 As shown in Tables 12.1-12.3, there was no difference in the Q-PCR results of the engineered bacteria quality control samples before and after DNaseI digestion, while the results of the plasmids before and after DNaseI digestion were very different. This indicates that the engineered spirochetes quality control samples prepared in this invention have superior nuclease tolerance, which is much higher than that of conventional plasmids.

[0208] Table 12.1 Data on the quality control samples and plasmid nuclease treatment results of Borrelia burgdorferi

[0209]

[0210] Note: NoCt was not detected; C T An increase in the value indicates that the template has been degraded by nucleases.

[0211] Table 12.2 Data on the quality control of regressive heat spirochetes and the results of plasmid nuclease treatment

[0212]

[0213] Note: NoCt was not detected; C T An increase in the value indicates that the template has been degraded by nucleases.

[0214] Table 12.3 Data on Leptospira quality control samples and plasmid nuclease treatment results

[0215]

[0216] Note: NoCt was not detected; C T An increase in the value indicates that the template has been degraded by nucleases.

[0217] Example 13: Verification of the ability of engineered bacterial quality control samples to monitor nucleic acid extraction

[0218] Using the spirochetal multiplex detection kit of the present invention, nucleic acid extraction and non-extraction comparison tests were performed on engineered spirochetal bacteria quality control samples with concentrations of 5.00E+06 copies / mL and 5.00E+03 copies / mL and their corresponding plasmids, respectively (qPCR reaction conditions were the same as in Example 5). The results are shown in Tables 13.1-13.3. Figure 9 As shown, the quality control product of engineered spirochetes must undergo nucleic acid extraction to be detected; without nucleic acid extraction, it cannot be detected normally. However, plasmids can be detected regardless of whether nucleic acid extraction has been performed, and the Ct values ​​are not different. This indicates that the quality control product of engineered spirochetes prepared in this invention can effectively monitor the nucleic acid extraction process, which is not possible with conventional plasmids.

[0219] Table 13.1 Data Table of Quality Control Samples and Plasmid Extraction Monitoring Capability Validation Results for Engineered Borrelia burgdorferi

[0220]

[0221] Note: NoCt was not detected.

[0222] Table 13.2 Data Table of Quality Control Samples and Plasmid Extraction Monitoring Capability Validation Results for Regression Thermospirensis Engineered Bacteria

[0223]

[0224] Note: NoCt was not detected.

[0225] Table 13.3 Data Table of Quality Control Samples and Plasmid Extraction Monitoring Capability Validation Results for Leptospira Engineered Bacteria

[0226]

[0227] Note: NoCt was not detected.

[0228] Example 14: Stability test of engineered microbial quality control samples

[0229] Referring to standard JJF1343-2022 "Assignment and Homogeneity and Stability Assessment of Standard Reference Materials", stability was assessed by storing the sample at three different temperatures (4℃, 25℃, and 37℃) at two time points: 0 days and 3 days. Two units were sampled from each temperature at each time point, and qPCR was used for detection (qPCR reaction conditions were the same as in Example 6). Each unit was tested twice. The test results are shown in Tables 14.1-14.3 and... Figure 10As shown, the test results of the engineered spirochetes quality control samples showed no significant differences after storage at different temperatures; however, the Ct of the plasmid decreased after storage at 4℃, and gradually increased after storage at 25℃ and 37℃. This indicates that the engineered spirochetes quality control samples prepared in this invention have outstanding and excellent stability, while conventional plasmids have poor stability.

[0230] Table 14.1 Statistical results of Ct values ​​for the storage stability of engineered Borrelia burgdorferi strains at 4℃, 25℃, and 37℃.

[0231]

[0232] Table 14.2 Statistical results of Ct values ​​for the storage stability of engineered *Treponema pallidum* strains at 4℃, 25℃, and 37℃.

[0233]

[0234] Table 14.2 Statistical results of Ct values ​​for the storage stability of Leptospira engineered bacterial quality control samples at 4℃, 25℃ and 37℃.

[0235]

[0236] Example 15: Repeatability Validation of the Spirochete Multiplex Nucleic Acid Detection Kit

[0237] Nucleic acid was extracted from the engineered spirochetal bacteria quality control sample at a concentration of 5.00E+03 copies / mL, and then 16 replicates were performed using a spirochetal multiplex nucleic acid detection kit. The results are shown in Table 15. Figure 11 The results of repeated testing of the quality control samples of each spirochete were consistent, and the coefficient of variation (CV) of the Ct values ​​of the repeated tests was no greater than 5%, indicating that the kit developed in this invention can be accurately and effectively used for the detection of Leptospira, Borrelia burgdorferi and Relapsing Thermospira, with good repeatability.

[0238] Table 15. Repeatability validation results of the Treponema multiplex nucleic acid detection kit

[0239]

[0240]

Claims

1. A primer for spirochete multiplex fluorescent PCR nucleic acid detection, characterized in that: The primers used for multiplex fluorescent PCR nucleic acid detection of spirochetes include Leptospira primers, Relapsing Thermospira primers, and Borrelia burgdorferi primers; When the primers for the multiplex fluorescent PCR nucleic acid detection of spirochetes are Leptospira primers, the Leptospira primers include: an upstream primer with a nucleotide sequence as shown in SEQ ID NO:4 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO:6; The probe sequence used for amplifying the Leptospira primer is SEQ ID NO:5; When the primers for the multiplex fluorescent PCR nucleic acid detection of spirochetes are relapsing spirochetes primers, the relapsing spirochetes primers include: an upstream primer with a nucleotide sequence as shown in SEQ ID NO:13 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO:15; The probe sequence used for the amplification fragment of the regressive thermospirochete primer is SEQ ID NO:14; When the primers for the multiplex fluorescent PCR nucleic acid detection of spirochetes are Borrelia burgdorferi primers, the Borrelia burgdorferi primers include: an upstream primer with a nucleotide sequence as shown in SEQ ID NO:22 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO:24; The probe sequence used for amplifying the primer fragment of Borrelia burgdorferi is SEQ ID NO:

23.

2. The primers for spirochete multiplex fluorescent PCR nucleic acid detection as described in claim 1, characterized in that: The 5' ends of the probes used for the amplification fragments of the Leptospira primers, the amplification fragments of the Relapsing Thermospira primers, and the amplification fragments of the Borrelia burgdorferi primers all contain fluorescent labels.

3. A spirochete-based multiplex fluorescent PCR nucleic acid detection kit, characterized in that: The spirochete multiplex fluorescent PCR nucleic acid detection kit includes the primers for spirochete multiplex fluorescent PCR nucleic acid detection as described in claim 1.

4. The application of the spirochete multiplex fluorescent PCR nucleic acid detection kit as described in claim 3 in the detection of Leptospira nucleic acid.

5. The application of the spirochetal multiplex fluorescent PCR nucleic acid detection kit as described in claim 3 in the detection of relapsing heat spirochetal nucleic acid.

6. The application of the spirochete multiplex fluorescent PCR nucleic acid detection kit as described in claim 3 in the detection of Borrelia burgdorferi nucleic acid.

7. An engineered Escherichia coli strain carrying a recombinant artificial chromosome, characterized in that, The engineered Escherichia coli strain was prepared by integrating the 16S rRNA gene homologous sequence of Leptospira, the flaB gene homologous sequence of Treponema relapsingii, and the fla gene homologous sequence of Borrelia burgdorferi into the artificial chromosome of Escherichia coli using homologous recombination technology, thus completely preserving the cell structure of the engineered bacteria. The 16S rRNA gene homologous sequence of Leptospira is shown in SEQ ID NO:1, the flaB gene homologous sequence of Treponema relapsingii is shown in SEQ ID NO:2, and the fla gene homologous sequence of Borrelia burgdorferi is shown in SEQ ID NO:

3.

8. A quality control product for multiplex nucleic acid detection of spirochetes, characterized in that, The quality control sample is prepared from the engineered Escherichia coli of claim 7 through the following steps: (a) Cultivate engineered bacteria and heat-inactivate them; (b) Dilute with phosphate buffer to different concentration gradients; (c) A quality control sample containing the target gene of spirochetes was obtained for multiple nucleic acid detection of spirochetes. The DNA of the quality control sample was extracted, and its nucleic acid copy number was accurately determined by digital PCR and qPCR.

9. The application of the quality control material of claim 8 for non-disease diagnostic purposes, characterized in that, The application is any one of the following: (a) Quality control of precision and accuracy of fluorescent PCR and digital PCR; (b) Performance validation of the nucleic acid extraction kit; (c) Standardized testing for clinical diagnosis of spirochetal diseases.

Images