High-flux enzymatic DNA synthesis method based on framework nucleic acid

Abstract

The invention relates to a high-flux enzymatic DNA synthesis method based on framework nucleic acid. Specifically, the invention provides a TdT-framework nucleic acid compound which can accurately regulate and control the position and distance of terminal deoxynucleotidyl transferase (TdT) so as to achieve the purpose of high-flux enzymatic DNA synthesis. The invention also provides a method for preparing the TdT-framework nucleic acid compound, and a method for synthesizing DNA (Deoxyribonucleic Acid) by using the TdT-framework nucleic acid compound. When the TdT-framework nucleic acid compound is used for synthesizing DNA, high-flux enzymatic DNA synthesis can be realized, and the TdT-framework nucleic acid compound has important significance for developing a high-flux DNA synthesis technology with mild conditions.

Description

Technical Field

[0001] This invention relates to the field of DNA synthesis, and more specifically to a high-throughput enzymatic DNA synthesis method based on framework nucleic acids. Background Technology

[0002] With the development of the internet and big data, the total amount of data globally is growing exponentially, and the demand for internet data storage is increasing. According to predictions by the international data organization IDC, the total amount of data globally will reach 175 ZB by 2025. At that time, traditional data storage media, such as optical discs, hard disks, magnetic tapes, and flash memory, will be unable to meet the ever-growing demand for massive amounts of data. To solve this data storage problem, inspired by biology, DNA is considered a promising data storage medium.

[0003] DNA, as a storage medium, boasts numerous advantages, including high storage density, long preservation time, small footprint, and low energy consumption, making it one of the most promising media for solving the future data storage crisis. First, DNA has a high storage density, reaching 215 PB / g. 50 grams of DNA could store the information of 10 million hard drives, and 200 kilograms of DNA could store all the world's data. DNA storage technology can drastically save storage space for future archival data. Second, DNA has a long storage period. DNA information from a 700,000-year-old wild horse fossil can still be stored today, while hard drives and magnetic tapes can only retain data for a few decades at most. Furthermore, DNA storage has low energy consumption, requiring no huge investment of manpower and financial resources, only needing to be stored in a low-temperature environment. In contrast, storing 1GB of data on a hard drive requires only 0.04W of energy. The maintenance cost of using DNA for data storage over a century is 12 orders of magnitude lower than that of traditional media. Finally, DNA storage offers high security. Paper archives are easily affected by unforeseen events such as fires and earthquakes, and cannot be restored; hard drive data is easily tampered with and attacked by viruses; while DNA storage technology, with its dual encryption functions of IT and BT, can protect information security in more diverse dimensions, making it more secure than other current storage media.

[0004] DNA data storage primarily involves four processes: ① Data encoding, converting computer data into 0 / 1 binary information and mapping this binary information to the four base sequences A / T / C / G; ② DNA synthesis, using artificial DNA synthesis technology to synthesize DNA polymer molecules that can be stored; ③ DNA sequencing, using sequencing technology to read the base sequences of the stored DNA polymer molecules; and ④ Data recovery, using the mapping relationship between the 0 / 1 binary information and A / T / C / G sequences from step ① to restore the sequences obtained from sequencing in step ③ back into 0 / 1 binary information, and further converting them into stored data. Among these four steps, artificial DNA synthesis technology, as the core of data storage, is crucial for the transition of DNA data storage from concept to application.

[0005] However, current DNA synthesis technology still relies on the phosphoramide-based chemical synthesis method developed by Marvin Caruthers and colleagues at the University of Colorado in 1981. This method requires a four-step cycle of deprotection, coupling, capping, and oxidation to synthesize a single nucleotide. Although this method remains the mainstream approach for commercial DNA synthesis, it is limited by chemical reaction efficiency, synthetic purity, and synthetic length, making it difficult to synthesize nucleic acid chains exceeding 200 nt.

[0006] Compared to chemical DNA synthesis methods, enzymatic synthesis methods offer advantages for achieving green long-chain DNA synthesis due to their mild aqueous reaction conditions, lack of use of toxic compounds, and high synthesis efficiency. Terminal deoxynucleotidyl transferase (TdT) is a template-free DNA polymerase that catalyzes the binding of deoxynucleotides to the 3' hydroxyl terminus of DNA molecules, and TdT-based enzymatic DNA synthesis methods have attracted increasing attention. However, compared to chemical synthesis methods, enzymatic synthesis methods struggle to achieve single-base regulation, and their synthesis throughput needs improvement.

[0007] Therefore, there is an urgent need in this field to develop a simple, efficient, and high-throughput enzymatic DNA synthesis method to meet the growing demand for artificial DNA synthesis. Summary of the Invention

[0008] The purpose of this invention is to provide a simple, efficient, and high-throughput enzymatic DNA synthesis method.

[0009] In a first aspect of the invention, a terminal deoxynucleotidyl transferase (TdT)-framework nucleic acid complex is provided, comprising: (a) a framework nucleic acid; and (b) a TdT with a linker strand;

[0010] The TdT binds to a predetermined site on the framework nucleic acid via the linker strand, and the outer surface of the framework nucleic acid is exposed with primer segments; DNA synthesis is performed at the ends of the primer segments under the catalysis of the TdT.

[0011] In another preferred embodiment, the predetermined site is position-adjustable.

[0012] In another preferred embodiment, the framework nucleic acid is DNA, RNA, locked nucleic acid, peptide nucleic acid, or a combination thereof.

[0013] In another preferred embodiment, the framework nucleic acid is DNA.

[0014] In another preferred embodiment, the framework nucleic acid is a triangle, quadrilateral, hexagon, tetrahedron, triangular prism, dodecahedron, or a combination thereof.

[0015] In another preferred embodiment, the framework nucleic acid is a triangular framework nucleic acid.

[0016] In another preferred embodiment, the side length of the triangular framework nucleic acid is 20-200 nm, more preferably 50-150 nm, and even more preferably 100-140 nm.

[0017] In another preferred embodiment, the framework nucleic acid is formed by multiple nucleic acid monomers through complementary base pairing.

[0018] In another preferred embodiment, the nucleic acid monomer is a single-stranded DNA, RNA, locked nucleic acid, peptide nucleic acid, or a combination thereof.

[0019] In another preferred embodiment, the nucleic acid monomer is single-stranded DNA.

[0020] In another preferred embodiment, the nucleic acid monomer comprises: a scaffold strand, a staple strand, a capture strand, and a primer strand.

[0021] In another preferred embodiment, the nucleic acid monomer comprises: a scaffold strand, multiple staple strands, at least one capture strand, and at least one primer strand.

[0022] In another preferred embodiment, the backbone chain is M13 phage genomic DNA.

[0023] In another preferred embodiment, the staple chain forms a base complementary pair with a portion of the sequence in the skeleton chain.

[0024] In another preferred embodiment, the capture chain includes staple segments and capture segments, the staple segments being complementary to a portion of the skeleton chain sequence, and the capture segments not being complementary to the skeleton chain sequence.

[0025] In another preferred embodiment, the primer strand includes a staple segment and a primer segment, the staple segment being complementary to a portion of the backbone strand sequence, and the primer segment not being complementary to the backbone strand sequence.

[0026] In another preferred embodiment, the capture segment or primer segment is located on the outer surface of the framework nucleic acid.

[0027] In another preferred embodiment, each DNA synthesis region on the surface of the framework nucleic acid contains a capture segment and a primer segment.

[0028] In another preferred embodiment, each DNA synthesis region on the surface of the framework nucleic acid contains two capture segments and at least one primer segment.

[0029] In another preferred embodiment, no base complementary pairing occurs between the capture segment and the primer segment in each DNA synthesis region.

[0030] In another preferred embodiment, the distance between the capture segment and the primer segment in each DNA synthesis region does not exceed 5 nanometers.

[0031] In another preferred embodiment, the framework nucleic acid has n DNA synthesis regions, where n is an integer from 1 to 50, more preferably, n is an integer from 1 to 10, and even more preferably, n is an integer from 1 to 5.

[0032] In another preferred embodiment, the distance between the centers of two adjacent DNA synthesis regions is 10–120 nm.

[0033] In another preferred embodiment, the distance between the centers of two adjacent DNA synthesis regions is 10.9–110 nm.

[0034] In another preferred embodiment, the position of the DNA synthesis region on the framework nucleic acid is adjustable.

[0035] In another preferred embodiment, the location of the DNA synthesis region is regulated by designing the sequences of the staple chain, capture chain, and / or primer chain.

[0036] In another preferred embodiment, the DNA synthesis region is located at the vertices, edges, or combinations thereof of the framework nucleic acid.

[0037] In another preferred embodiment, the linker strand is single-stranded DNA.

[0038] In another preferred embodiment, the TdT is covalently connected to the connecting chain.

[0039] In another preferred embodiment, the structure of the TdT with connecting chain is shown in equation (I) below:

[0040] TdT-LZ type (I)

[0041] in,

[0042] TdT is a terminal deoxynucleotidyl transferase;

[0043] L represents a chemical linking group;

[0044] Z represents the connecting chain.

[0045] In another preferred embodiment, the structural formula of the chemical linking group is shown in formula (II) below:

[0046]

[0047] In another preferred embodiment, the linker chain and the trapping segment may be base-complementary.

[0048] In another preferred embodiment, the connecting chain is completely complementary or substantially complementary to the capturing segment.

[0049] In another preferred embodiment, the sequence of the connecting chain is as shown in SEQ ID NO:1 and / or SEQ ID NO:11.

[0050] In another preferred embodiment, the TdT is attached to the outer surface of the framework nucleic acid via complementary base pairing of the linker strand and the capture segment.

[0051] In another preferred embodiment, the TdT is linked to the DNA synthesis region on the surface of the framework nucleic acid via complementary base pairing of the linker strand and the capture segment.

[0052] In a second aspect of the invention, a TdT-framework nucleic acid complex array is provided, containing N TdT-framework nucleic acid complexes as described in the first aspect of the invention, wherein N is a positive integer ≥4, more preferably, N is a positive integer ≥6.

[0053] In another preferred embodiment, the array is formed by the self-assembly of N TdT-framework nucleic acid complexes.

[0054] In another preferred embodiment, the array is arranged in a regular and / or irregular pattern.

[0055] In another preferred embodiment, the array is arranged in a regular pattern.

[0056] In another preferred embodiment, in the array, 3 to 8 of the TdT-framework nucleic acid complexes constitute a secondary complex (such as a hexagonal secondary complex).

[0057] In another preferred embodiment, in the array, six of the TdT-framework nucleic acid complexes constitute a hexagonal secondary complex.

[0058] In another preferred embodiment, the density of the DNA synthesis regions on the array is 10. 8 ~10 11 pcs / square centimeter

[0059] In a third aspect of the invention, a method for preparing a TdT-framework nucleic acid complex as described in the first aspect of the invention is provided, comprising the steps of:

[0060] (a) Provide TdT and framework nucleic acids with linker strands;

[0061] (b) Under suitable annealing conditions, TdT with a linker strand and framework nucleic acid are incubated to form a TdT-framework nucleic acid complex as described in the first aspect of the invention.

[0062] In another preferred embodiment, the annealing reaction conditions in step (b) include: cooling the temperature from 45°C to 25°C at a rate of 0.1°C / 1 minute, repeated twice.

[0063] In another preferred embodiment, in step (b), the molar ratio of the TdT-linker strand to the framework nucleic acid is 2:1 to 5:1, preferably 3:1.

[0064] In another preferred embodiment, in step (a), the TdT with the connecting chain is obtained by chemically connecting the TdT with the connecting chain to obtain TdT with the connecting chain (TdT-connecting chain).

[0065] In another preferred embodiment, the method specifically includes:

[0066] (i) The NH2-modified linker reacts with SPDP to obtain the SPDP-linker;

[0067] (ii) The SPDP-linked chain reacts with TdT to give the TdT-linked chain product.

[0068] In another preferred embodiment, in step (i), the molar ratio of the SPDP to the connecting chain is 40:1 to 80:1, preferably 50:1.

[0069] In another preferred embodiment, in step (ii), the molar ratio of the SPDP-modified linker chain to TdT is 10:1 to 4:1, preferably 5:1.

[0070] In another preferred embodiment, the method further includes:

[0071] (iii) Ultrafiltration was performed on the TdT-linked chain product to remove excess linker chains and obtain purified TdT-linked chain product.

[0072] In another preferred embodiment, in step (a), the framework nucleic acid is obtained by providing a backbone strand, designing staple strands, capture strands and primer strands, and annealing and assembling to form the framework nucleic acid.

[0073] In another preferred embodiment, the method further includes: designing the sequence of the staple chain such that the staple chain forms a base complementary pair with a portion of the sequence in the backbone chain, assembling it into a framework nucleic acid of a specific shape.

[0074] In another preferred embodiment, the method further includes: designing the sequences of the capture strand and the primer strand such that the capture segment and the primer segment are located on the surface of the framework nucleic acid, and that the capture segment and the primer segment do not have complementary base pairing with the backbone strand.

[0075] In a fourth aspect of the invention, a chip for nucleic acid synthesis is provided, comprising:

[0076] (a) Solid support;

[0077] (b) A TdT-framework nucleic acid complex array as described in the second aspect of the invention, the array being located on at least one main surface of the solid support.

[0078] In another preferred embodiment, the primer fragments in the TdT-framework nucleic acid complex are either unextended or extended.

[0079] In another preferred embodiment, the extension refers to extension catalyzed by TdT.

[0080] In another preferred embodiment, the solid support is a substrate, particles, or columnar body.

[0081] In another preferred embodiment, the solid support is a mica substrate.

[0082] In a fifth aspect of the invention, a method for synthesizing DNA is provided, comprising the steps of:

[0083] (1) Provide a TdT-framework nucleic acid complex as described in the first aspect of the present invention, or a TdT-framework nucleic acid complex array as described in the second aspect of the present invention, or a chip as described in the third aspect of the present invention;

[0084] (2) Add specific types of dNTPs in sequence to carry out TdT enzymatic reaction and obtain DNA product.

[0085] In another preferred embodiment, in step (2), the dNTP is catalyzed by TdT and linked to the primer segment of the TdT-framework nucleic acid complex.

[0086] In another preferred embodiment, the reaction conditions for step (2) include incubating a specific dNTP with a TdT-framework nucleic acid complex at 37°C for 30 minutes.

[0087] In another preferred embodiment, the DNA product has a length of 5 to 500 nt.

[0088] In a sixth aspect of the invention, an application of the TdT-framework nucleic acid complex as described in the first aspect of the invention, or the TdT-framework nucleic acid complex array as described in the second aspect of the invention, or the chip as described in the third aspect of the invention is provided, characterized in that it is used for template-independent DNA synthesis.

[0089] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Attached Figure Description

[0090] Figure 1 This is a schematic diagram of site-specific TdT enzymatic DNA synthesis on the framework nucleic acid substrate.

[0091] Figure 2 A flowchart for TdT-connector chain coupling and a 15% page verification photo.

[0092] Figure 3 PAGE images showing the UV absorption spectrum of the TdT-linked chain and the enzyme activity.

[0093] Figure 4 This diagram illustrates the linkages of TdT with framework nucleic acids of different site types and the AFM characterization results.

[0094] Figure 5 This diagram illustrates site-specific enzymatic DNA synthesis at the framework nucleic acid interface and the AFM characterization results.

[0095] Figure 6 This study describes the regulation of the distance between nucleic acid interface synthesis sites and the corresponding enzymatic DNA synthesis results.

[0096] Figure 7 The results represent the assembly of the framework nucleic acid array and the characterization of high-density DNA synthesis. Detailed Implementation

[0097] Through extensive and in-depth research, the inventors have provided a TdT-framework nucleic acid complex that allows TdT to be immobilized at specific sites on framework nucleic acids for DNA synthesis. The immobilization sites, number, and spacing of the TdTs are flexibly controllable. The invention also provides a method for preparing the TdT-framework nucleic acid complex and a method for synthesizing DNA using the TdT-framework nucleic acid complex. The method for synthesizing DNA using the TdT-framework nucleic acid complex of this invention enables high-throughput enzymatic DNA synthesis, with a synthesis density reaching up to 10. 11 A density of DNA strands per square centimeter is of great significance for developing the application of DNA in the field of data storage. This invention was completed based on this principle.

[0098] The framework nucleic acid of the present invention

[0099] This invention provides a framework nucleic acid capable of linking TdTs, and the TdT linking site is precisely controllable. The framework nucleic acid of this invention can be designed and prepared using DNA origami techniques. As used herein, the terms "framework nucleic acid," "DNA origami," and "origami" are used interchangeably.

[0100] DNA origami is a method for precisely controlling the structure of DNA at the nanoscale. It utilizes the base pairing rules between DNA molecules—the complementarity between A and T, and C and G—to guide the backbone chain to fold into specific geometric shapes by designing the sequence of staple chains. Specifically, DNA origami uses a long single-stranded DNA as a scaffold (i.e., the "backbone chain" of this invention), which is then paired with hundreds of short-stranded DNAs (i.e., the "staple chains" or "staple chains" of this invention) to fold into one-dimensional, two-dimensional, or three-dimensional nanomaterials of predetermined shapes.

[0101] In this invention, M13 bacteriophage genomic DNA (approximately 7000 bp) is used as the backbone strand, and multiple staple chains are designed to self-fold and obtain the framework nucleic acid of this invention. The shape of the framework nucleic acid of this invention is not particularly limited; preferably, it can be triangular, quadrilateral, hexagonal, tetrahedral, triangular prism, dodecahedral, etc. In one embodiment of this invention, the framework nucleic acid is triangular.

[0102] In this invention, a portion of the staple chain has a capture segment at its end. This capture segment does not pair complementaryly with the backbone chain bases but protrudes onto the surface of the framework nucleic acid. This staple chain with the capture segment is referred to as a "capture chain". The capture segment in the capture chain is used to capture and immobilize TdT.

[0103] In this invention, a portion of the staple chain has a primer segment at its end. This primer segment does not pair complementaryly with the backbone bases but protrudes from the surface of the framework nucleic acid. This staple chain with the primer segment is referred to as a "primer chain". The primer segment in the primer chain serves as a substrate for TdT and as a primer for synthesizing new DNA.

[0104] In this invention, the capture segments and primer segments close to each other on the surface of the framework nucleic acid constitute the DNA synthesis region. Each framework nucleic acid surface may contain 1 to 50 DNA synthesis regions, preferably 1 to 5.

[0105] In one embodiment of the present invention, the side length of the triangular framework nucleic acid is 20-200 nm, preferably 50-150 nm, and more preferably 100-140 nm. Multiple framework nucleic acids of the present invention can self-assemble to form a neatly arranged framework nucleic acid array. The area of ​​the framework nucleic acid array of the present invention can reach the level of square centimeters.

[0106] The TdT of the present invention

[0107] As used herein, the term "TdT" refers to Terminal Deoxynucleotidyl Transferase, a DNA polymerase that adds deoxynucleotides (dNTPs) to the 3' end of a DNA strand without a DNA template. TdT activity requires a short sequence containing at least three bases as a primer. In its natural state, TdT exhibits a high synthetic rate of approximately 200 bases per minute.

[0108] In this invention, multiple TdTs are immobilized to the DNA synthesis region of a framework nucleic acid, enabling high-throughput DNA synthesis. The TdTs of this invention are immobilized to the framework nucleic acid via a single-stranded DNA (i.e., the "linker strand" of this invention). This linker strand has complementary base pairing with the capture segment on the framework nucleic acid, thereby capturing the TdTs into the framework nucleic acid. In one embodiment of this invention, the nucleotide sequence of the linker strand is as shown in SEQ ID NO:1 or SEQ ID NO:11.

[0109] This invention provides a method for covalently linking TdT to single-stranded DNA linker. By using the heterobifunctional cross-linking agent SPDP (3-(2-pyridinedimercapto)propionic acid N-hydroxysuccinimide ester) to react with the thiol group on the cysteine ​​residue and the amino group on the single-stranded nucleic acid in the TdT molecule, a simple method for stable and efficient two-step synthesis of TdT-linker is achieved.

[0110] In one embodiment of the present invention, the specific steps of linking TdT with the linker strand include: linking NH2-modified linker strand single-stranded DNA with SPDP to obtain SPDP-modified linker strand DNA; and covalently linking SPDP-modified DNA with TdT to obtain TdT-linker strand.

[0111] The present invention relates to the TdT-framework nucleic acid complex and its preparation method.

[0112] The TdT-framework nucleic acid complex of the present invention is composed of a TdT linker strand and a framework nucleic acid through base complementary pairing. Specifically, the linker strand can form a base complementary pair with the capture segment on the framework nucleic acid, thereby capturing TdT to a specific site on the framework nucleic acid. An exemplary TdT-framework nucleic acid complex of the present invention is shown below. Figure 1 As shown, the black segment protruding from the surface of the framework nucleic acid is the capture segment, and the red segment is the primer segment. After TdT is covalently linked to the linker strand, it pairs complementaryly with the bases of the capture segment to form the TdT-frame nucleic acid complex of the present invention.

[0113] The TdT-framework nucleic acid complex of the present invention can self-assemble into a regularly arranged TdT-framework nucleic acid complex array. Placing the array on a solid substrate can form a chip for high-throughput DNA synthesis, as shown in the schematic diagram below. Figure 7 As shown. The density of the TdT-framework nucleic acid complex array of the present invention reaches 10. 8 ~10 11 DNA synthesis region per square centimeter.

[0114] The present invention also provides a method for preparing a TdT-framework nucleic acid complex, comprising the steps of: (a) linking TdT with a linker chain through a chemical reaction to obtain a TdT-linker chain; (b) providing a backbone chain and a staple chain to assemble a framework nucleic acid; and (c) mixing the TdT-linker chain with the framework nucleic acid to assemble the TdT-framework nucleic acid complex.

[0115] The method for synthesizing DNA of the present invention

[0116] The present invention also provides a method for synthesizing DNA using the TdT-framework nucleic acid complex and dNTPs of the present invention, comprising the steps of:

[0117] (1) Provide the TdT-framework nucleic acid complex of the present invention, or an array composed of multiple TdT-framework nucleic acid complexes; (2) Add specific types of dNTPs in sequence to carry out TdT enzymatic reaction to obtain DNA product.

[0118] Specifically, a specific dNTP is incubated with a TdT-framework nucleic acid complex at 37°C for 30 minutes, and the dNTP is catalyzed by TdT to be linked to a primer segment of the TdT-framework nucleic acid complex.

[0119] The DNA synthesis method of the present invention can be used to synthesize DNA with a length of 5 to 500 nt, and the synthesis density can reach 10. 11 DNA per square centimeter.

[0120] The main advantages of this invention include:

[0121] (1) This invention utilizes the TdT-linker strand to precisely modify the terminal deoxynucleotidyl transferase (TdT) at a specific position on the framework nucleic acid substrate to achieve site-specific enzymatic DNA synthesis.

[0122] (2) This invention utilizes the highly controllable and addressable shape and size of framework nucleic acids to precisely control the spacing between adjacent synthesis regions.

[0123] (3) This invention constructs a large-scale, regularly arranged framework nucleic acid array through framework nucleic acid self-assembly to achieve high-density, high-throughput TdT-catalyzed DNA synthesis, with a theoretical synthesis density reaching 10-1. 11 DNA per square centimeter.

[0124] (4) The TdT-framework nucleic acid complex of the present invention can further broaden the application of DNA in data storage.

[0125] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. Unless otherwise stated, percentages and fractions are weight percentages and weight fractions.

[0126] Example 1: Preparation of TdT-linker chains

[0127] 1. Experimental reagents:

[0128] Terminal deoxynucleotidyl transferase TdT (purchased from Thermo Fisher Scientific); NH2-modified single-stranded DNA (DNA Linker 1, 20nt, ssDNA, SEQ ID NO:1) for coupling with TdT, purchased from Shanghai Sangon Biotech Co., Ltd.; N-hydroxysuccinimide 3-(2-pyridinedithio)propionic acid (SPDP) purchased from Sigma Aldrish.

[0129] 2. Experimental steps:

[0130] The ligation process of TdT with DNA Linker1 in this invention is as follows:

[0131] (1) TdT enzyme prewash.

[0132] Mix 40 μL of 20 U / μL TdT enzyme stock solution with 460 μL of 50 mM HEPES buffer (pH = 7.02). After mixing, transfer the solution to a 10K ultrafiltration tube and ultrafilter at 8000 rcf and 4°C for 10 minutes. Remove the lower layer of the ultrafiltration tube, then add 50 mM HEPES buffer (pH = 7.02) to the upper layer to make up to a volume of 500 μL. Ultrafilter again, repeating the process twice. Collect the supernatant, which is the TdT solution.

[0133] (2) Preparation of SPDP solution.

[0134] Take 1.0 mg SPDP, add 160 μL DMSO, mix well to obtain a 20 mM SPDP solution.

[0135] (3) NH2-modified DNA Linker 1 is mixed with SPDP and reacted.

[0136] Mix 62.4 μL of 10 μM DNA Linker 1, 1.56 μL of 20 mM SPDP, and 436 μL of 50 mM HEPES buffer (pH = 8.5), and place the mixture on an Eppendorf shaker. Incubate at 37°C and 400 rpm for 1 hour in the dark.

[0137] The reaction solution was transferred to a 3K ultrafiltration tube and ultrafiltered at 15,000 rpm and 4°C for 15 minutes to remove excess SPDP. The lower layer of the ultrafiltration tube was removed, and 50 mM HEPES buffer (pH = 7.5) was added to the upper layer to make up to a volume of 500 μL. Ultrafiltration was repeated three times. The supernatant was collected to obtain the DNA-SPDP ligation product (DNA-SPDP), which was stored at 4°C for later use.

[0138] (4) TdT is coupled with DNA-SPDP.

[0139] Mix all the TdT solution obtained in step (1) and all the DNA-SPDP solution obtained in step (3), and add an appropriate amount of 50mM HEPES buffer (pH=7.5) to make up a volume of 500μL. Place the mixture on an Eppendorf shaker and react at 37°C and 400rpm for 1 hour in the dark.

[0140] The reaction solution was transferred to a 30K ultrafiltration tube and ultrafiltered at 8000 rcf and 4°C for 10 minutes to remove excess DNA. The lower layer of the ultrafiltration tube was removed, and 50 mM HEPES buffer (pH = 7.5) containing 1.5 M NaCl was added to the upper layer to make a volume of 500 μL. Ultrafiltration was repeated twice. The lower layer of the ultrafiltration tube was removed again, and 50 mM HEPES buffer (pH = 7.5) was added to the upper layer to make a volume of 500 μL. Ultrafiltration was repeated twice. The supernatant was collected, yielding the DNA-TdT conjugate (TdT-linker strand), which was stored at 4°C for later use.

[0141] (5) Analysis of the advantages of the TdT-linker preparation method.

[0142] The method of the present invention uses NH2-modified DNA to link SH to the cysteine ​​residues on the TdT molecule. Compared with the traditional method of using SH-modified DNA to react with NH2 in the amino acid residues of protein molecules, it reduces the process of activating SH with TCEP, saves reaction time, and improves reaction efficiency.

[0143] Example 2: Connection Verification of TdT-Connection Chain

[0144] The connectivity of the TdT-linker chains prepared in Example 1 was verified as follows:

[0145] (1) Prepare 15% PAGE gel.

[0146] (2) Take 10 μL of 250 nM DNA Linker 1 and TdT-linker strand separately, add 2 μL of 6× loading buffer and mix well; add the two samples and 2 μL of 20 bp DNA marker to the gel wells and electrophore for 2 hours at 1×TBE (containing 12.5 mM MgCl2) electrophoresis buffer and 90 V voltage.

[0147] (3) After electrophoresis, the gel was stained in 1×GelRed staining solution for 15 minutes and gel imaging was performed.

[0148] The results are as follows Figure 2As shown, the TdT-linker strand band is significantly lagging behind the DNA Linker 1 alone. This is because the molecular weight of the complex increases significantly after DNA is coupled with TdT, resulting in a decrease in migration rate, proving the successful preparation of the TdT-linker strand.

[0149] Example 3: Determination of the TdT to DNA ratio in the TdT-linker strand

[0150] The process for determining the TdT to DNA ratio in the TdT-linker strand prepared in Example 1 is as follows:

[0151] A 1 μM TdT solution and a DNA Linker 1 solution were prepared, and their UV absorption spectra were measured. Simultaneously, the UV absorption spectrum of the TdT-linker strand was also measured. The results are as follows: Figure 3 As shown in Figure a. The UV absorbance values ​​of the three at 260 nm and 280 nm were read respectively, as shown in Table 1:

[0152] Table 1

[0153] Sample / Absorbance <![CDATA[NH2-DNA]]> TdT TdT-DNA A260 / nm 0.1241 0.0419 0.0778 A280 / nm 0.0840 0.0810 0.0652

[0154] Let x be the concentration of DNA in the TdT-linking strand and y be the concentration of TdT. Establish the following equation:

[0155] 0.0778 = 0.1241x + 0.0419y

[0156] 0.0652 = 0.0840x + 0.0810y

[0157] Solving for x and y, we get x = 0.5466 and y = 0.2378. Therefore, x:y = 2:1, meaning that each TdT molecule in the TdT-linker strand is linked to two DNA strands.

[0158] Example 4: Verification of TdT-linker activity

[0159] 1. Experimental reagents:

[0160] Primer DNA (28nt, ssDNA, SEQ ID NO:2) was purchased from Shanghai Sangon Biotech Co., Ltd.; deoxythymidine triphosphate dTTP was purchased from Shanghai Sangon Biotech Co., Ltd.; terminal deoxynucleotidyl transferase (TdT) was purchased from Thermo Fisher Scientific; 5× reaction buffer was purchased from Thermo Fisher Scientific.

[0161] 2. Experimental steps:

[0162] The verification process for the TdT-DNAase catalytic activity of the present invention is as follows:

[0163] (1) Prepare 15% PAGE gel.

[0164] (2) The primer fragment and dTTP were incubated under TdT and TdT-linking conditions, respectively.

[0165] Take 2.5 μL of 1 μM Primer, 2.5 μL of 100 μM dTTP, 3 μL of 5×Reaction buffer, 0.2 μL of 20 U / μL TdT (approximately 5.2 μM), and 6.8 μL of water respectively, and place them on an Eppendorf shaker at 37°C and 400 rpm for 30 minutes.

[0166] Take 2.5 μL of 1 μM Primer, 2.5 μL of 100 μM dTTP, 3 μL of 5×Reaction buffer, 4.4 μL of 0.24 μM TdT-linking chain, and 2.6 μL of water respectively, and place them on an Eppendorf shaker at 37°C and 400 rpm for 30 minutes.

[0167] (3) High-temperature incubation inactivates TdT enzyme and terminates the reaction.

[0168] The product from step (2) was placed on an Eppendorf shaker and reacted at 70°C and 400 rpm for 10 minutes to inactivate the TdT enzyme and terminate the enzyme-catalyzed reaction.

[0169] (4) Take the two products from step (3) and 3 μL of 6× loading buffer, mix them evenly, add them to the gel wells, and electrophore for 2 hours in 1×TBE (containing 12.5 mM MgCl2) electrophoresis buffer and 90V voltage.

[0170] (5) After electrophoresis, the gel was stained in 1×GelRed staining solution for 15 minutes and then gel imaging was performed.

[0171] 3. Experimental Results:

[0172] The result is as follows Figure 3 As shown in b, it can be seen that compared to the single primer chain containing the primer fragment (band 1), the bands with the addition of TdT (band 2) or TdT-linked chain (band 3) both exhibit significant hysteresis, proving that both TdT and TdT-linked chain catalyze the extension of the primer. This indicates that the TdT-linked chain still retains the catalytic activity of TdT, and its activity is only slightly reduced compared to the unmodified TdT alone.

[0173] Example 5: Regulation of Synthesis Site Location at the Framework Nucleic Acid Interface

[0174] 1. Experimental reagents:

[0175] Eight stapled linker strands containing capture segments replace the eight staple strands of the DNA framework nucleic acid to connect with the TdT-linker strand to synthesize, as... Figure 4 The structure shown in a. The eight staple chains containing capture segments are as follows: A62-5A16 (45nt, ssDNA, SEQ ID NO:3), A63-5A16 (61nt, ssDNA, SEQ ID NO:4), B62-5A16 (45nt, ssDNA, SEQ ID NO:5), B63-5A16 (61nt, ssDNA, SEQ ID NO:6), B07-5A16 (53nt, ssDNA, SEQ ID NO:7), B08-5A16 (60nt, ssDNA, SEQ ID NO:8), C62-5A16 (45nt, ssDNA, SEQ ID NO:9), and C63-5A16 (61nt, ssDNA, SEQ ID NO:10); all purchased from Shanghai Sangon Biotech Co., Ltd.

[0176] 2. Experimental steps:

[0177] The site-specific ligation process of TdT-DNA to framework nucleic acid in this invention is as follows:

[0178] (1) Replace the original staple strand with 8 linker strands to synthesize the following 4 sets of triangular DNA origami framework nucleic acids:

[0179] Group 1 (①A62-5A16, A63-5A16; ②B07-5A16, B08-5A16);

[0180] Group 2 (①A62-5A16, A63-5A16, B62-5A16, B63-5A16; ②A62-5A16, A63-5A16, B07-5A16, B08-5A16; ③B62-5A16, B63-5A16, B07-5A16, B08-5A16);

[0181] 3 groups (①A62-5A16, A63-5A16, B62-5A16, B63-5A16, C62-5A16, C63-5A16; ②A62-5A16, A63-5A16, B62-5A16, B63-5A16, B07-5A16, B08-5A16; ③B62-5A16, B63-5A16, B07-5A16, B08-5A16, C62-5A16, C63-5A16);

[0182] 4 groups (A62-5A16, A63-5A16, B62-5A16, B63-5A16, B07-5A16, B08-5A16, C62-5A16, C63-5A16);

[0183] (2) Ultrafiltration purification of framework nucleic acids containing different groups of linker chains;

[0184] (3) Quantification of the prepared triangular framework nucleic acids:

[0185] Nanodrop was used to measure the UV absorbance of each framework nucleic acid at 260 nm; the specific concentration of the triangular origami framework nucleic acid was calculated using the formula c = 12.6 * A260.

[0186] (4) Ligation reaction of nucleic acids of various types of triangular origami framework with TdT-linker strands:

[0187] The molar ratio of TdT-DNA to triangular framework nucleic acid is 3:1; the temperature is programmed by incubation at 37°C for 5 minutes, followed by a temperature program of 36-10°C at 2 minutes / °C, and finally cooled to 4°C for storage; excess TdT-linked strands are removed by ultrafiltration through a 100K tube.

[0188] (5) The obtained sample was measured by atomic force microscopy.

[0189] 3. Experimental Results:

[0190] The results are as follows Figure 4 As shown in b, one, two, three, and four TdT molecules were observed at specific sites in the triangular origami framework nucleic acid, demonstrating the specific linkage between the TdT-linker strand and the framework nucleic acid.

[0191] Example 6: Site-specific DNA synthesis on a framework nucleic acid substrate

[0192] 1. Experimental reagents:

[0193] The long linker strand (DNA Linker 2, SEQ ID NO:11) is used to link TdT and framework nucleic acids; 17 linker or primer strands replace the 17 staple strands of the framework nucleic acids and provide linking sites with TdT as well as primer strands for TdT-catalyzed DNA synthesis: A60-3P (SEQ ID NO:12), A62-5L-3P (SEQ ID NO:13), A63-5L-3P (SEQ ID NO:14), A64-3P (SEQ ID NO:15), B60-3P (SEQ ID NO:16), B62-5L-3P (SEQ ID NO:17), B63-5L-3P (SEQ ID NO:18), B64-3P (SEQ ID NO:19), C60-3P (SEQ ID NO:20), C62-5L-3P (SEQ ID NO:21), C63-5L-3P (SEQ ID NO:22), C ... The following were purchased from Shanghai Sangon Biotech Co., Ltd.: B07-5L (SEQ ID NO:24), B08-5L-3P (SEQ ID NO:25), B11-3P (SEQ ID NO:26), B36-3P (SEQ ID NO:27), B37-3P (SEQ ID NO:28), and SH-DNA (SEQ ID NO:29); AuNPs with a particle size of 5 nm were purchased from BBI Corporation.

[0194] 2. Experimental steps:

[0195] According to the present invention, the site-specific DNA synthesis process on the framework nucleic acid substrate is as follows:

[0196] (1) TdT-linked strands were prepared by linking DNA Linker 2 with TdT.

[0197] (2) Replace the original staple strand with 17 linker or primer strands to synthesize triangular origami framework nucleic acids containing 1 to 4 sites as shown below:

[0198] A sites (A60-3P, A62-5L-3P, A63-5L-3P, A64-3P);

[0199] B sites (B60-3P, B62-5L-3P, B63-5L-3P, B64-3P);

[0200] C sites (C60-3P, C62-5L-3P, C63-5L-3P, C64-3P);

[0201] Bm site (B07-5L, B08-5L-3P, B11-3P, B36-3P, B37-3P)

[0202] like Figure 5 As shown in b, nine types of triangular origami framework nucleic acids containing 1, 2, 3, and 4 sites were synthesized; the products were purified by ultrafiltration and quantified using Nanodrop.

[0203] (3) Framework nucleic acids with different linker strands are linked to TdT-DNA:

[0204] The sample was added according to a TdT-linker to framework nucleic acid molar ratio of 3:1, and the TdT was ligated to the framework nucleic acid substrate by programmed cooling. Then, ultrafiltration was performed at 3000 rcf for 5 minutes at 4°C using a 100K ultrafiltration tube to remove excess TdT-linker. The lower filtrate of the ultrafiltration tube was removed, buffer was added to make up the volume, and ultrafiltration was repeated twice to ensure thorough removal of unligated TdT-linker. The upper layer of the ultrafiltration tube was collected, which is the ligation product of framework nucleic acid and TdT.

[0205] (4) The ligation products of framework nucleic acids and TdT undergo site-specific enzymatic DNA synthesis:

[0206] Samples were added according to the principle of extending each primer chain by 20 bases. Individual dATP, 5× reaction buffer, and an appropriate amount of water were added to maintain the final reaction system under 1× reaction buffer conditions. The reaction was carried out at 37°C for 2 hours to ensure that dATP was fully extended in the primer chain, thereby obtaining the extension product of a polyA sequence extended by the primer chain.

[0207] (5) AuNPs are linked to polyT sequences to form spherical nucleic acids (AuNPs-polyT):

[0208] Spherical nucleic acids were synthesized using a cryogenic method. An appropriate amount of AuNPs particle solution was added to the centrifuged SH-modified DNA powder, thoroughly mixed, aliquoted, and stored at -20°C overnight. After thawing, the mixture was centrifuged at 20,000 rcf for 20 minutes, the supernatant was removed, ultrapure water was added, and centrifugation was repeated twice. The final product obtained was the ligation of polyT and AuNPs, AuNPs-polyT, i.e., spherical nucleic acids. The actual concentration of spherical nucleic acids was quantified using Nanodrop.

[0209] (6) Validation of framework nucleic acid site-specific enzymatic DNA synthesis:

[0210] To verify the synthesis of new strand DNA specific to the origami framework nucleic acid sites, the spherical nucleic acid from step (5) and the extension product of the new strand at the origami interface from step (4) were added in a molar ratio of 3:1 and incubated at 37°C for 1 hour. AFM imaging analysis was performed after incubation.

[0211] 3. Experimental Results:

[0212] The results are as follows Figure 5 As shown, the presence of AuNPs can be observed at specific sites in the framework nucleic acids, proving the successful synthesis of the new DNA.

[0213] Example 7: Regulation of the distance between adjacent synthesis sites at the framework nucleic acid interface

[0214] 1. Experimental reagents:

[0215] Long linker strands (DNA Linker 2) were used to link TdT and framework nucleic acids; 17 staple strands containing capture segments or primer segments were used to replace the 17 staple strands of the framework nucleic acids, providing linking sites with TdT and primer segments for TdT-catalyzed DNA synthesis, and were purchased from Shanghai Sangon Biotech Co., Ltd.; AuNPs with a particle size of 5 nm were purchased from BBI.

[0216] Site 1: B62-5L-3P (SEQ ID NO:17), B63-5L-3P (SEQ ID NO:18), B64-3P (SEQ ID NO:19);

[0217] Site 2: B29-3P (SEQ ID NO:30), B30-5L-3P (SEQ ID NO:31), B31-5L-3P (SEQ ID NO:32);

[0218] Site 3: B07-5L (SEQ ID NO:24), B08-5L-3P (SEQ ID NO:25), B11-3P (SEQ ID NO:26), B36-3P (SEQ ID NO:27), B37-3P (SEQ ID NO:28);

[0219] Site 4: B45-5L-3P (SEQ ID NO:33), B48-3P (SEQ ID NO:34), B49-5L-3P (SEQ ID NO:35);

[0220] Site 5: B55-3P (SEQ ID NO:36), B59-5L-3P (SEQ ID NO:37), B61-5L-3P (SEQ ID NO:38).

[0221] 2. Experimental steps:

[0222] The process of regulating the distance between synthesis sites on the framework nucleic acid substrate of this invention is as follows:

[0223] (1) TdT-linked strands were prepared by linking DNA Linker 2 with TdT;

[0224] (2) Replace the original staple strand with 17 linker or primer strands to synthesize framework nucleic acids containing the following site combinations, as shown in the schematic diagram. Figure 6 As shown in a:

[0225] Site 1+2: (B62-5L-3P, B63-5L-3P, B64-3P)+(B29-3P, B30-5L-3P, B31-5L-3P), distance 110 nm;

[0226] Site 1+3: (B62-5L-3P, B63-5L-3P, B64-3P)+(B07-5L, B08-5L-3P, B11-3P, B36-3P, B37-3P), distance 54.4 nm;

[0227] Site 1+4: (B62-5L-3P, B63-5L-3P, B64-3P)+(B45-5L-3P, B48-3P, B49-5L-3P), distance 32.6 nm;

[0228] Site 1+5(B62-5L-3P, B63-5L-3P, B64-3P)+(B55-3P, B59-5L-3P, B61-5L-3P), distance 10.9 nm;

[0229] Four types of triangular origami framework nucleic acids with adjacent synthesis sites distanced by 110 nm, 54.4 nm, 32.6 nm, and 10.9 nm were synthesized. The synthesized products were purified by ultrafiltration and quantified using Nanodrop.

[0230] (3) Linkage of framework nucleic acids to TdT at synthesis sites at different distances:

[0231] The sample was added at a TdT-linker to framework nucleic acid molar ratio of 3:1, and TdT was ligated to the framework nucleic acid substrate by programmed cooling. Subsequently, ultrafiltration was performed at 3000 rcf for 5 minutes at 4°C using a 100K ultrafiltration tube to remove excess TdT-linker. The lower filtrate of the ultrafiltration tube was removed, buffer was added to make up the volume, and ultrafiltration was repeated twice to ensure thorough removal of unligated TdT-linker. The upper filtrate of the ultrafiltration tube was collected, which is the ligation product of framework nucleic acid and TdT. AFM was used to characterize TdT ligation at different distances.

[0232] (4) Enzymatic DNA synthesis regulated by synthesis sites at different distances:

[0233] Samples were added according to the principle of extending each primer chain by 20 bases. Individual dATP, 5× reaction buffer, and an appropriate amount of water were added to maintain the final reaction system under 1× reaction buffer conditions. The reaction was carried out at 37°C for 2 hours to ensure that dATP was fully extended in the primer chain, thereby obtaining the extension product of a polyA sequence extended by the primer chain.

[0234] (5) AuNPs are linked to polyT sequences to form spherical nucleic acids (AuNPs-polyT):

[0235] Spherical nucleic acids were synthesized using a cryogenic method. An appropriate amount of AuNPs particle solution was added to the centrifuged SH-modified DNA powder, thoroughly mixed, aliquoted, and stored at -20°C overnight. After thawing, the mixture was centrifuged at 20,000 rcf for 20 minutes, the supernatant was removed, ultrapure water was added, and centrifugation was repeated twice. The final product obtained was the ligation of polyT and AuNPs, AuNPs-polyT, i.e., spherical nucleic acids.

[0236] Nanodrop quantifies the actual concentration of spherical nucleic acids.

[0237] (6) Validation of DNA synthesis at different distances from the framework nucleic acid interface:

[0238] To verify the synthesis of new strand DNA specific to the origami framework nucleic acid sites, the spherical nucleic acid from step (5) and the extension product of the new strand at the origami interface from step (4) were added in a molar ratio of 3:1 and incubated at 37°C for 1 hour. TEM imaging analysis was performed after incubation.

[0239] 3. Experimental Results:

[0240] The results are as follows Figure 6 b and Figure 6 As shown in Figure c, AuNPs at different distances can be observed, proving the successful synthesis of DNA at synthesis sites at different distances, indicating that the method of the present invention can precisely control the distance between DNA synthesis sites.

[0241] Example 8: High-throughput enzymatic DNA synthesis based on framework nucleic acids

[0242] 1. Experimental reagents:

[0243] Four capture or primer strands were used to replace the four staple strands of the framework nucleic acid and provided connection sites with TdT and primers for TdT-catalyzed DNA synthesis, for validating high-throughput enzymatic DNA synthesis. The sequences are as follows: A09-3P (SEQ ID NO:39), A13-5L-3P (SEQ ID NO:40), A14-3P (SEQ ID NO:41), and A17-5L-3P (SEQ ID NO:42), all purchased from Shanghai Sangon Biotech Co., Ltd.

[0244] 2. Experimental steps:

[0245] According to the present invention, the verification process for high-throughput enzymatic DNA synthesis based on framework nucleic acids is as follows:

[0246] (1) Synthesize origami-frame nucleic acids with one synthesis site. Replace the original staple strands with A09-3P, A13-5L-3P, A14-3P, and A17-5L-3P to synthesize triangular origami-frame nucleic acids with one DNA synthesis site. Purify by ultrafiltration and perform Nanodrop quantification analysis.

[0247] (2) Framework nucleic acids self-assemble into a large-area, regularly arranged framework nucleic acid array.

[0248] Prepare 50 μL of 2 nM framework nucleic acid solution in a buffer system of 12.5 mM MgCl2 and 75 mM NaCl. After thorough mixing, add the solution dropwise onto a clean and flat mica sheet and let it stand at room temperature for 2 hours to generate a regularly arranged framework nucleic acid array. Figure 7 As shown, the framework nucleic acids are arranged in a regular pattern with hexagons as the smallest unit.

[0249] (3) The framework nucleic acid array is connected to TdT.

[0250] Add TdT-linking chains at a ratio of 3:1, drop the mixture onto the mica sheet, and then place the mica sheet in a humidified chamber. Incubate the chamber at 37°C for 1 hour. After incubation, rinse the mica sheet interface with a buffer to remove any unlinked TdT-linking chains.

[0251] (4) Framework nucleic acid array enzymatic DNA synthesis.

[0252] Samples were added according to the principle of extending each primer strand by 20 bases. Separate amounts of dATP, 5× reaction buffer, and water were added to maintain the final reaction system at 1× reaction buffer. The reaction was carried out at 37°C for 2 hours to ensure sufficient dATP extension of the primer strands, yielding an extension product consisting of a polyA sequence. After incubation, the mica sheet interface was rinsed with buffer to remove unbound dATP and salt ions.

[0253] (5) Validation of high-throughput DNA synthesis based on framework nucleic acids.

[0254] Spherical nucleic acids were added to the product of step (4) at a feed ratio of 3:1, and incubated at 37°C for 1 hour, followed by AFM imaging. Figure 7 As shown, AuNPs on the framework nucleic acid array can be seen, proving the successful high-throughput DNA synthesis based on framework nucleic acids.

[0255] (6) Theoretical density calculation

[0256] The side length of the triangular origami framework nucleic acid is 120 nm. Assuming one synthesis site is designed on each origami piece, the synthesis density can be calculated as: 1 DNA strand / 6235 square nanometers, which translates to 1.6 × 10⁻⁶. -4 DNA per square nanometer. Through framework nucleic acid self-assembly, the area of ​​the framework nucleic acid array of this invention can reach the level of square centimeters. Therefore, based on the calculation of designing one synthesis site on one origami framework nucleic acid, its theoretical synthesis density can reach 1.6 × 10⁻⁶. 10 DNA strands per square centimeter. Furthermore, this invention allows for the design of more synthesis sites on each framework nucleic acid, thus enabling the TdT-based enzymatic DNA synthesis method based on framework nucleic acid arrays to achieve a synthesis density exceeding 102 DNA strands per square centimeter. 11 With a density of strips per square centimeter, comparable to or even surpassing the integration density of existing transistors, it truly achieves high-throughput enzymatic DNA synthesis.

[0257] sequence

[0258] DNA Linker 1 (SEQ ID NO:1)

[0259] 5'-TTTTTTTTTTTTTTCCCTTT-3'NH2

[0260] Primer DNA (SEQ ID NO:2)

[0261] 5'-TATGGTTATCTTCAGTCAGGTGCGTTCA-3'

[0262] A62-5A16(SEQ ID NO:3)

[0263] 5'-AAAAAAAAAAAAAAAATCTCTTCAGCTAAAAAAGGTAAAGTAATT-3

[0264] A63-5A16(SEQ ID NO:4)

[0265] 5'-AAAAAAAAAAAAAAAATCTCTACGCTAACGAGCGTCTGGCGTTTTAG CGAACCCAACATGT-3'

[0266] B62-5A16(SEQ ID NO:5)

[0267] 5'-AAAAAAAAAAAAAAAAATCTCTGGCAAAAGTAAAATACGTAATGCC-3

[0268] B63-5A16(SEQ ID NO:6)

[0269] 5'-AAAAAAAAAAAAAAAATCTCTTGGTTTAATTTCAACTCGGATATTCAT TACCCACGAAAGA-3'

[0270] B07-5A16(SEQ ID NO:7)

[0271] 5'-AAAAAAAAAAAAAAAAATCTCTAACCAGACGTTTAGCTATATTTTCTTC TACTA-3

[0272] B08-5A16(SEQ ID NO:8)

[0273] 5'-AAAAAAAAAAAAAAAATTTTGAATACCACATTCAACTTAAGAGGAAG CCCGATCAAAGCG-3

[0274] C62-5A16(SEQ ID NO:9)

[0275] 5'-AAAAAAAAAAAAAAAAATCTCTGCGCTCACAAGCCTGGGGTGCCTA-3'

[0276] C63-5A16(SEQ ID NO:10)

[0277] 5'-AAAAAAAAAAAAAAATCTCTCGATGGCCCACTACGTATAGCCCGAG ATAGGGATTGCGTT-3'

[0278] DNA Linker 2(SEQ ID NO:11)

[0279] 5'-TTATAACTATTCCTTTTTGCTATCTGGTATCT-3'NH2

[0280] A60-3P(SEQ ID NO:12)

[0281] 5'-TTCTGACCTAAAATAAAGTACCGACTGCAGAACATTATTAA-3'

[0282] A62-5L-3P(SEQ ID NO:13)

[0283] 5'-AGGAATAGTTATAATTTCAGCTAAAAAAGGTAAAGTAATTATTTA A-3'

[0284] A63-5L-3P(SEQ ID NO:14)

[0285] 5'-AGGAATAGTTATATTTACGCTAACGAGCGTCTGGCGTTTTAGCGAACCCAACATGTTATTAA-3'

[0286] A64-3P(SEQ ID NO:15)

[0287] 5'-ACGACAATAAATCCCGACTTGCGGGAGATCCTGAATCTTACCAATTATT AA-3'

[0288] B60-3P(SEQ ID NO:16)

[0289] 5'-CGGTTTATCAGGTTTCCATTAAACGGGAATACACTATTATTAA-3'

[0290] B62-5L-3P(SEQ ID NO:17)

[0291] 5'-AGGAATAGTTATATTTTGGCAAAAGTAAAATACGTAATGCCATTATTA A-3'

[0292] B63-5L-3P(SEQ ID NO:18)

[0293] 5'-AGGAATAGTTATAATTTGGTTTAATTTCAACTCGGATATTCATTACCC ACGAAAGAATTATTAA-3'

[0294] B64-3P(SEQ ID NO:19)

[0295] 5'-ACCAACCTAAAATCAACGTAACAAAATTGGGCTTGAGAATTAT TAA-3'

[0296] C60-3P(SEQ ID NO:20)

[0297] 5'-TCTTCGCTATTGGAAGCATAAAGTGTATGCCCGCTATTTATTAA-3'

[0298] C62-5L-3P(SEQ ID NO:21)

[0299] 5'-AGGAATAGTTATAATTTGCGCTCACAAGCCTGGGGTGCCTAATTATTA A-3'

[0300] C63-5L-3P(SEQ ID NO:22)

[0301] 5'-AGGAATAGTTATAATTTTCGATGGCCCACTACGTATAGCCCGAGATAGGGATTGCGTTATTTATTAA-3'

[0302] C64-3P(SEQ ID NO:23)

[0303] 5'-AACTCACATTATTGAGTGTTGTTCCAGAAACCGTCTATCAGGGATTATT AA-3'

[0304] B07-5L(SEQ ID NO:24)

[0305] 5'-AGGAATAGTTATATTTAACCAGACGTTTAGCTATATTTTCTTCTACTA-3'

[0306] B08-5L-3P(SEQ ID NO:25)

[0307] 5'-GGAATAGTTAATTTTGATACCACATTCAACTTAAGGAAGCCCGATCAAAGCGATTATTTAA-3'

[0308] B11-3P(SEQ ID NO:26)

[0309] 5'-CHATCAAATGGTCATAACCTCGGAAGCHATTAA-3'

[0310] B36-3P(SEQ ID NO:27)

[0311] 5'-GCCGAGACTCCATGTTACTTAGCCCGTTTTAAAATTATTAA-3'

[0312] B37-3P(SEQ ID NO:28)

[0313] 5'-ACAGGTAGAAATTCATCAGTTGAGATTGATTTAGATTA-3'

[0314] SH-DNA(SEQ ID NO:29)

[0315] 5'-SH-AATTTTTTTTTTTTTTTTTTTTT-3'

[0316] B29-3P(SEQ ID NO:30)

[0317] 5′ - ACTAAAGTACGGTGTCATTATATATATTATTATATATTAA-3′

[0318] B30-5L-3P(SEQ ID NO:31)

[0319] 5'-AGGAATAGTTAATTTGCTGTAGATCCCCCTCAAATGCTGCGAGAGGCTTTTGCAATTATTAA-3'

[0320] B31-5L-3P(SEQ ID NO:32)

[0321] 5'-AGGAATAGTTATTTAAAGAAGTTTTGCCAGCATAAATATTCATTGACTCAACATGTTATTTAA-3'

[0322] B45-5L-3P(SEQ ID NO:33)

[0323] 5'-AGGAATAGTTATATTTTTAATAAAACGAACTAACCGAACTGACCAACTCCT GATAAATTATTAA-3'

[0324] B48-3P(SEQ ID NO:34)

[0325] 5'-GACAACAAGCATCGGAACGAGGGTGAGATTTGATTATTAA-3'

[0326] B49-5L-3P(SEQ ID NO:35)

[0327] 5'-AGGAATAGTTATATTTTATCATCGTTGAAAGAGGACAGATGGAAGAAAAATCTACGATTTATTAA-3'

[0328] B55-3P(SEQ ID NO:36)

[0329] 5'-AACAGCTTGCTTTGAGGACTAAAGCCGATTATATTAA-3'

[0330] B59-5L-3P(SEQ ID NO:37)

[0331] 5'-AGGAATAGTTATATTTACCTTATGCGATTTTATGACCTTCATCAAGAGCATCTTTGATTTATTAA-3'

[0332] B61-5L-3P(SEQ ID NO:38)

[0333] 5'-AGGAATAGTTATATTTAAAACACTTAATCTTGACAGACTTAATCATTGTGAATTATTAA-3'

[0334] A09-3P(SEQ ID NO:39)

[0335] 5'-GATAAGTGCCGTCGAGCTGAAACATGAAAGTATACAGGAGATTTTAA-3'

[0336] A13-5L-3P(SEQ ID NO:40)

[0337] 5'-AGGAATAGTTATAATTTTTTTAACGGTTCGGAACCTATTATTAGGGTTGATATAAGTAATTATTAA-3'

[0338] A14-3P (SEQ ID NO:41)

[0339] 5'-CTCAGAGCATATTCACAAACAAATTAATAAGTATTATTAA-3'

[0340] A17-5L-3P (SEQ ID NO:42)

[0341] 5'-AGGAATAGTTATAATTTTTAGCCCGGAATAGGTGAATGCCCCCTGCCTATGGTCAGTGATTATTAA-3'

[0342] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims.

Claims

1. A terminal deoxynucleotidyl transferase (TdT)-framework nucleic acid complex, characterized in that, The complex comprises: (a) a framework nucleic acid; and (b) TdT with a linker strand; The TdT binds to a predetermined site on the framework nucleic acid via the linker strand, and the outer surface of the framework nucleic acid is exposed with primer segments; DNA synthesis is performed at the ends of the primer segments under the catalysis of the TdT.

2. The complex according to claim 1, characterized in that, Each DNA synthesis region on the surface of the framework nucleic acid contains a capture segment and a primer segment.

3. The complex according to claim 1, characterized in that, The structural formula of the TdT with connecting chain is shown in equation (I) below: TdT-LZ type (I) in, TdT is a terminal deoxynucleotidyl transferase; L represents a chemical linking group; Z represents the connecting chain.

4. The complex according to claim 1, characterized in that, The TdT is linked to the DNA synthesis region on the surface of the framework nucleic acid through complementary base pairing of the linker strand and the capture segment.

5. A TdT-framework nucleic acid complex array, characterized in that, The array contains N TdT-framework nucleic acid complexes as described in claim 1, where N is a positive integer ≥ 4.

6. The array as described in claim 5, characterized in that, The density of the DNA synthesis region on the array is 10. 8 ~10 11 pcs / square centimeter 7. A method for preparing the TdT-framework nucleic acid complex as described in claim 1, characterized in that, The method includes the following steps: (a) Provide TdT and framework nucleic acids with linker strands; (b) Under suitable annealing conditions, TdT with a linker strand and a framework nucleic acid are incubated to form the TdT-framework nucleic acid complex as described in claim 1.

8. A chip for nucleic acid synthesis, characterized in that, The chip includes: (a) Solid support; (b) The TdT-framework nucleic acid complex array of claim 5, wherein the array is located on at least one main surface of the solid support.

9. A method for synthesizing DNA, characterized in that, Including the following steps: (1) Provide the TdT-framework nucleic acid complex as described in claim 1, or the TdT-framework nucleic acid complex array as described in claim 5, or the chip as described in claim 8; (2) Add specific types of dNTPs in sequence to carry out TdT enzymatic reaction and obtain DNA product.

10. An application of the TdT-framework nucleic acid complex as described in claim 1, or the TdT-framework nucleic acid complex array as described in claim 5, or the chip as described in claim 8, characterized in that, Used for template-independent DNA synthesis.

Images