Application of CsCOMT2 gene in breeding of new citrus varieties
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- GERMPLASM INNOVATION GRAND SCIENCE CENTER OF WESTERN CHINA (CHONGQING) SCIENCE CITY
- Filing Date
- 2025-08-15
- Publication Date
- 2026-07-24
AI Technical Summary
Existing technologies are insufficient to effectively increase the content of vincain-2, rutin, hesperidin and lemon balm in citrus peel, thus affecting the comprehensive utilization rate of citrus and the breeding process.
By overexpressing the CsCOMT2 gene, an overexpression vector was constructed using genetic engineering methods and transformed into Agrobacterium tumefaciens to infect citrus fruits, thereby increasing the content of vincain-2, rutin, hesperidin and/or lemon balm glycoside in citrus peel.
It significantly increases the content of vincain-2, rutin, hesperidin and lemon balm in citrus peel, up to 51.7%, accelerating the breeding process and improving the comprehensive utilization rate of citrus.
Smart Images

Figure CN120905289B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology, and in particular relates to the application of the CsCOMT2 gene in the breeding of new citrus varieties. Background Technology
[0002] Citrus fruits are among the most widely cultivated and highest-yielding fruit varieties in China. Citrus fruits are rich in nutrients and bioactive secondary metabolites, which not only give them their unique flavor and health benefits but also play significant roles in antioxidation, anti-inflammation, and anti-cancer activity. Currently known substances in citrus fruits with important anti-inflammatory, antioxidant, and anti-tumor effects include phenolic acids, flavonoids, carotenoids, essential oils, limonene, and synephrine.
[0003] Vicine belongs to the flavonoid glycosides class of flavonoid compounds. Naringin, hesperidin, and lemon balm glycoside are all typical flavonoid glycoside compounds with significant biological activities, including: 1) plant stress resistance and defense, resisting pathogens such as bacteria, fungi, and pests; 2) antioxidant and photoprotective effects, scavenging intracellular reactive oxygen species (ROS) and excess free radicals, reducing oxidative damage; 3) anti-inflammatory effects, exhibiting anti-inflammatory activity by inhibiting pro-inflammatory cytokines and reducing leukocyte infiltration; 4) cardiovascular protection, studies have shown that dietary intake of naringin and hesperidin can effectively reduce the risk of cardiovascular disease death in adults; 5) anti-cancer and anti-tumor effects, studies have shown that dietary intake of naringin and hesperidin can reduce the incidence of breast cancer, lung cancer, colon cancer, prostate cancer, and pancreatic cancer; 6) metabolic regulation and anti-obesity: regulating the balance of intestinal flora, inhibiting the growth of pathogenic bacteria, promoting the proliferation of probiotics such as Bifidobacteria, and improving intestinal barrier function.
[0004] Vizanol, naringin, hesperidin, and lemon balm glycoside are widely distributed in various vegetables and fruits and are used in food processing to reduce the use of synthetic chemicals and improve human health. Identifying the key enzymes in their biosynthetic pathways and elucidating their molecular mechanisms of function can provide a theoretical basis for molecular breeding of functional citrus fruits with high levels of vizanol, naringin, hesperidin, and lemon balm glycoside, which is of great significance for improving the comprehensive utilization rate of citrus fruits. Summary of the Invention
[0005] To address the aforementioned technical issues, this invention proposes the application of the CsCOMT2 gene in the breeding of new citrus varieties. By overexpressing the CsCOMT2 gene, the content of vincain-2, rutin, hesperidin, and / or lemon balm glycoside in citrus peel is increased. This suggests that the CsCOMT2 gene can serve as a candidate gene for breeding new citrus varieties with high contents of vincain-2, rutin, hesperidin, and / or lemon balm glycoside, and that functional new citrus varieties can be cultivated using genetic engineering methods.
[0006] To achieve the above objectives, the present invention provides the application of the CsCOMT2 gene in the breeding of new citrus varieties, and the CDS sequence of the CsCOMT2 gene is shown in SEQ ID NO.1.
[0007] Preferably, by overexpressing the CsCOMT2 gene, the content of vincain-2, rutin, hesperidin and / or lemon balm glycoside in citrus peel is increased, resulting in new citrus varieties with high contents of vincain-2, rutin, hesperidin and / or lemon balm glycoside.
[0008] The present invention also provides an overexpression vector containing the CsCOMT2 gene, the CDS sequence of which is shown in SEQ ID NO.1.
[0009] The present invention also provides a recombinant strain containing a vector overexpressing the CsCOMT2 gene, the CDS sequence of which is shown in SEQ ID NO.1.
[0010] This invention also provides the application of the overexpression vector or the recombinant strain in the breeding of new citrus varieties. The overexpression vector or the recombinant strain increases the content of vincain-2, rutin, hesperidin and / or lemon balm glycoside in citrus peel by overexpressing the CsCOMT2 gene, thereby obtaining new citrus varieties with high content of vincain-2, rutin, hesperidin and / or lemon balm glycoside.
[0011] The present invention also provides a method for breeding new citrus varieties with high contents of citrus tincture-2, rutin, hesperidin and / or lemon balm glycoside, comprising the following steps: amplifying the CDS sequence of the CsCOMT2 gene, constructing an overexpression vector of the CsCOMT2 gene, transforming Agrobacterium tumefaciens, infecting citrus fruits, and obtaining new citrus varieties; the CDS sequence of the CsCOMT2 gene is shown in SEQ ID NO.1.
[0012] This invention also provides the application of the CsCOMT2 gene in the breeding of new citrus varieties with high lemon balm content. The CDS sequence of the CsCOMT2 gene is shown in SEQ ID NO.1. By overexpressing the CsCOMT2 gene, the lemon balm content in citrus peel is increased, resulting in new citrus varieties with high lemon balm content.
[0013] This invention also provides the application of the CsCOMT2 gene in the breeding of new citrus varieties with high rutin content. The CDS sequence of the CsCOMT2 gene is shown in SEQ ID NO.1. By overexpressing the CsCOMT2 gene, the content of rutin in citrus peel is increased, and new citrus varieties with high rutin content are obtained.
[0014] This invention also provides the application of the CsCOMT2 gene in the breeding of new citrus varieties with high virginine-2 content. The CDS sequence of the CsCOMT2 gene is shown in SEQ ID NO.1. By overexpressing the CsCOMT2 gene, the content of virginine-2 in citrus peel is increased, and new citrus varieties with high virginine-2 content are obtained.
[0015] This invention also provides the application of the CsCOMT2 gene in increasing the content of vescenin-2, rutin, and lemon balm in citrus peel, wherein the CDS sequence of the CsCOMT2 gene is shown in SEQ ID NO.1; by overexpressing the CsCOMT2 gene, the content of vescenin-2, rutin, and lemon balm in citrus peel is increased.
[0016] Compared with the prior art, the present invention has the following advantages and technical effects:
[0017] This invention provides the application of the CsCOMT2 gene in the breeding of new citrus varieties, and its specific technical effects are as follows:
[0018] (1) This invention first discovered that the expression level of CsCOMT2 gene is positively correlated with the content of veselene-2, rutin, hesperidin and / or lemon balm in citrus. The higher the expression level of CsCOMT2 gene, the higher the content of veselene-2, rutin, hesperidin and / or lemon balm in citrus peel. In the experiment, the citrus transformed with CsCOMT2 gene overexpression vector can be up to 51.7% higher than that of citrus transformed with empty vector.
[0019] (2) The CsCOMT2 gene can be used as a candidate gene for breeding new citrus varieties with high content of citrus ... Attached Figure Description
[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0021] Figure 1 The diagram shows the structure of the CsCOMT2 gene in Late Orange, where A represents the chromosomal location of the CsCOMT2 gene, B represents the structure of the CsCOMT2 gene, and C represents the conserved domain of the CsCOMT2 gene.
[0022] Figure 2 The image shows the agarose gel electrophoresis results of the amplified CsCOMT2 gene CDS sequence. In the figure, M represents the Maker and CDS represents the CsCOMT2 gene CDS sequence.
[0023] Figure 3 The structure of the CsCOMT2 gene overexpression vector pLGNe-CsCOMT2 is shown.
[0024] Figure 4 The images show photos of Late Orange fruits from the experimental and control groups on the day of instantaneous transformation and after 5 days of cultivation. In the images, A is a photo of Late Orange fruits from the control and experimental groups on the day of instantaneous transformation, B is a photo of Late Orange fruits from the control and experimental groups after 5 days of cultivation, and C is a partial sample photo of Late Orange fruits from the control and experimental groups after 5 days of cultivation when total RNA was extracted. In the figures, pLGNe represents the control group, and pLGNeCsCOMT2-1, pLGNeCsCOMT2-2, and pLGNeCsCOMT2-3 represent the experimental group.
[0025] Figure 5 The expression levels of the CsCOMT2 gene in the peel of the late-maturing oranges injected with 5 days of culture were shown in the figure. pLGNe represents the control group, and pLGNe-CsCOMT2-1, pLGNe-CsCOMT2-2 and pLGNe-CsCOMT2-3 represent the experimental group. P < 0.0001 indicates significant difference.
[0026] Figure 6Figure 1 shows the results of detecting the contents of vezin-2, rutin, hesperidin, and lemon balm in the peel of the injected area of the late-maturing orange after 5 days of cultivation in the experimental and control groups. In the figure, A represents the content detection result of vezin-2, B represents the content detection result of rutin, C represents the content detection result of hesperidin, and D represents the content detection result of lemon balm. In the figure, pLGNe represents the control group, pLGNe-CsCOMT2-1, pLGNe-CsCOMT2-2, and pLGNe-CsCOMT2-3 represent the experimental group. P < 0.0001 and P < 0.0002 represent the significance of the difference.
[0027] Figure 7 The structural formulas of vezin-2, rutin, hesperidin and lemon balm are shown below, where A is vezin-2, B is rutin, C is hesperidin and D is lemon balm. Detailed Implementation
[0028] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0029] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Every smaller range between any stated value or intermediate value within a stated range, and any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0030] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0031] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0032] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0033] The source of the materials used in this invention: the late-maturing Jincheng orange is a superior late-maturing Jincheng orange strain selected from the common Jincheng orange by the Citrus Research Institute of the Chinese Academy of Agricultural Sciences. The variety approval number is Yu Shen Citrus 2011001.
[0034] Example 1
[0035] I. Bioinformatics analysis of the CsCOMT2 gene.
[0036] The structure of the CsCOMT2 gene in Late Orange is as follows: Figure 1 As shown, the CsCOMT2 gene is located between 11102916 bp and 11105725 bp on chromosome 4 of Citrus sinensis, chromosome version number Citrus sinensis v3.0, containing 4 introns and 5 exons, encoding 239 amino acids. The CDS sequence of the CsCOMT2 gene is shown in SEQ ID NO.1.
[0037] The CDS sequence of the CsCOMT2 gene is SEQ ID NO.1: ATGACAGACAAAGCAAAACAAGCAGCA.
[0038] II. Cloning the CDS sequence of the CsCOMT2 gene.
[0039] 1. RNA extraction and cDNA synthesis.
[0040] Total RNA was extracted from leaves of *Citrus aurantiacus* using a plant total RNA extraction kit (Adley, CAT: RN09). RNA quality was verified by agarose gel electrophoresis, and RNA concentration was determined using a concentration meter. cDNA was then synthesized using a reverse transcription kit (PrimeScript RTMaster Mix, TaKaRa, CAT: RR036A) according to the accompanying instructions.
[0041] 2. Amplify the CDS sequence of the CsCOMT2 gene.
[0042] Using primers OE-CsCOMT2-F (SEQ ID NO.2), OE-CsCOMT2-R (SEQ ID NO.3), and the high-fidelity enzyme PrimeSTAR Max DNAPolymerase (TaKaRa, CAT: R045Q), and with late-ripening orange cDNA as a template, the amplification system was prepared according to the instructions for PrimeSTAR Max DNAPolymerase. The PCR amplification program was: 98℃, 5 min; 98℃, 30 s, 56℃, 30 s, 72℃, 1.5 min, 35 cycles; extension at 72℃ for 10 min. The amplified DNA fragment of the CsCOMT2 gene CDS sequence was obtained, with a fragment length of 726 bp (717 bp CDS sequence - 3 bp terminator + 12 bp of restriction enzyme sites).
[0043] The nucleotide sequence of primer OE-CsCOMT2-F is SEQ ID NO.2: GGTACCATGACAGACAAAGCAAAACAAGCAG.
[0044] The nucleotide sequence of primer OE-CsCOMT2-R is SEQ ID NO.3: GAATTCGAATATACGCCTGCAGATTGTGATCC.
[0045] Agarose gel electrophoresis results are as follows Figure 2 As shown, the amplified fragment size results were as expected. Under UV light, the agarose gel block containing the target fragment was cut off with a clean blade, and the DNA fragment was recovered using a kit (BioFlux, CAT: BSC02M1). A portion of the recovered product was sent to the company for sequencing. The sequencing results, after comparative analysis, confirmed that the obtained DNA fragment was the CDS sequence (SEQ ID NO.1) of the CsCOMT2 gene of Late Orange.
[0046] III. Construct an overexpression vector for the CsCOMT2 gene and transform it into Agrobacterium.
[0047] 1. Constructing an overexpression vector for the CsCOMT2 gene:
[0048] The recovered DNA fragments, namely the CDS sequence of the CsCOMT2 gene of Late Orange and the overexpression vector pLGNe, were digested with restriction endonucleases KpnⅠ and EcoRI (ThermoFisher) and then recovered by gel extraction. The DNA fragments were ligated at 16℃ for 12 h. The digestion system and reaction conditions were prepared according to the attached instructions. The ligation was performed using the T4 DNALigase kit (Promega, CAT: M1801). The ligation system and reaction conditions were prepared according to the attached instructions for the T4 DNALigase kit.
[0049] The obtained ligation product was transformed into *E. coli* DH5α using the method described in the instruction manual accompanying the *E. coli* DH5α product (purchased from Weidi Biotechnology). Plasmids from positive clones were extracted using a plasmid extraction kit (Omega, CAT: D6942) to obtain the overexpression vector pLGNe-CsCOMT2 of the CsCOMT2 gene.
[0050] like Figure 3 The image shows the structure of the CsCOMT2 gene overexpression vector pLGNe-CsCOMT2.
[0051] 2. Transform Agrobacterium tumefaciens with an overexpression vector of the CsCOMT2 gene.
[0052] The overexpression vector pLGNe-CsCOMT2 was introduced into Agrobacterium tumefaciens EHA105 cells using a heat shock method. The specific steps were as follows: 50 μL of frozen Agrobacterium tumefaciens competent cells (EHA105) were thawed on ice in a 2 mL centrifuge tube. 2 μL of the plasmid of the overexpression vector was added to the competent cells, and the mixture was mixed by pipetting. The mixture was then placed on ice for 5 min, flash-frozen in liquid nitrogen for 5 min, incubated at 37°C for 5 min, and placed on ice for 5 min. Then, 800 μL of LB liquid medium was added to a 2 mL centrifuge tube, mixed by pipetting, and cultured on a shaker at 28°C for 2 h at 260 rpm. After the designated time, centrifuge the bacterial culture at 6000 rpm for 1 min, discard the supernatant, resuspend the bacterial cells in 50 μL of LB liquid medium, and then spread the resuspended cells onto LB solid medium containing 50 mg / L kanamycin. Incubate in the dark at 28°C for 2 days. Once plaques have grown, pick colonies and perform PCR verification on single colonies using primers ID-CsCOMT2-F (SEQ ID NO.4) and ID-CsCOMT2-R (SEQ ID NO.5) and the high-fidelity enzyme PrimeSTAR Max DNAPolymerase (TaKaRa, CAT: R045Q). The amplification system was prepared according to the instructions for the high-fidelity enzyme PrimeSTAR Max DNAPolymerase. The PCR amplification conditions were: 94°C for 3 min; 94°C for 30 s, 58°C for 30 s, 72°C for 30 s, 30 cycles; 72°C for 10 min.
[0053] The nucleotide sequence of primer ID-CsCOMT2-F is SEQ ID NO.4: TCGTTGAAGATGCCTCTGCCGACAG.
[0054] The nucleotide sequence of primer ID-CsCOMT2-R is SEQ ID NO.5: GAATATACGCCTGCAGATTGTGAT CC.
[0055] The PCR amplification products were subjected to agarose gel electrophoresis. Colonies with the correct band size were positive clones containing the overexpression vector pLGN e-CsCOMT2.
[0056] IV. Transient conversion of the CsCOMT2 gene overexpression vector pLGNe-CsCOMT2.
[0057] 1. Agrobacterium infection:
[0058] Select late-ripening orange fruits of uniform growth stage and sterilize them in a clean bench with 75% ethanol aqueous solution. Add 500 μL of Agrobacterium tumefaciens containing pLGNe and pLGNe-CsCOMT2 plasmids to 50 mL of liquid LB medium (containing 50 mg / L kanamycin) and incubate at 28℃ and 200 rpm until OD500. 600 =0.5. Centrifuge and collect the precipitate. Resuspend Agrobacterium in 1 / 2 MS liquid medium. Then, randomly select four injection points on the diagonal of the equatorial plane of the sterilized Late Jin Orange fruit and mark them. Inject the Agrobacterium resuspension containing pLGNe-CsCOMT2 plasmid into the peel of the Late Jin Orange using a 1 mL syringe. Inject 1 mL into each area, which is recorded as the experimental group. The Late Jin Oranges injected with the same method and the same amount of Agrobacterium resuspension containing pLGNe plasmid are used as the control group. The experimental group and the control group are each repeated three times. The Late Jin Oranges injected with Agrobacterium resuspension are placed in a 28℃ incubator in the dark for 5 days.
[0059] like Figure 4 The image shows photos of the late-ripening orange fruits in the experimental and control groups on the day of instantaneous transformation and after 5 days of cultivation. Figure 4 Image A shows photographs of the late-night orange fruits of the control group (pLGNe) and experimental groups (pLGNeCsCOMT2-1, pLGNeCsCOMT2-2, and pLGNeCsCOMT2-3) on the day of instantaneous transformation. Figure 4 Image B shows photos of late-ripening orange fruits after 5 days of cultivation in the control group (pLGNe) and experimental groups (pLGNeCsCOMT2-1, pLGNeCsCOMT2-2, and pLGNeCsCOMT2-3). Figure 4 Photograph of part of the sample during total RNA extraction (C).
[0060] 2. qRT-PCR analysis of transiently transformed late-ripening orange fruits:
[0061] Total RNA (Adelai, CAT No: RN09) was extracted from the peel of the injected areas of *Citrus reticulata* var. *mairei* (Citrus reticulata) cultured in the experimental and control groups at 28°C in the dark for 5 days. cDNA was synthesized using the PrimeScript RTMaster Mix reverse transcription kit (TaKaRa, CAT: RR036A), and the expression level of the target gene was detected by qRT-PCR. The detection primers were RT-CsCOMT2-F (SEQ ID NO. 6) and RT-CsCOMT2-R (SEQ ID NO. 7).
[0062] qRT-PCR reaction conditions: 95℃ for 3 min, 94℃ for 10 s; 56℃ for 10 s, 72℃ for 10 s, 40 cycles; 72℃ for 10 min.
[0063] The nucleotide sequence of primer RT-CsCOMT2-F is SEQ ID NO.6:TTTGTGGATGCCGACAAGGA.
[0064] The nucleotide sequence of primer RT-CsCOMT2-R is SEQ ID NO.7:GAACCTGCTCTTCAGGCACT.
[0065] Use 2 -△△Ct The relative expression levels of the CsCOMT2 gene in the experimental and control groups of Late Jin oranges were calculated as follows: the control group sample was defined as the reference factor, i.e., its CsCOMT2 expression level was 1. Then, the fold increase in gene expression in the experimental group sample relative to the reference factor was calculated as 2. -△△Ct , which is its relative expression level.
[0066] The results are as follows Figure 5 As shown, the expression level of CsCOMT2 gene in the experimental groups (pLGNe-CsCOMT2-1, pLGNe-CsCOMT2-2 and pLGNe-CsCOMT2-3) was significantly higher than that in the control group, with the highest level being more than 8 times that of the control group.
[0067] V. Determine the content of vincain-2, rutin, hesperidin and lemon balm in the fruits of the experimental group and the control group.
[0068] The contents of vinazine-2, rutin, hesperidin, and / or lemon balm glycosides in the fruit peel of the experimental and control groups after 5 days of dark incubation at 28℃ were determined by UPLC-MS. Figure 7 China A Figure 7 B, Figure 7 C and Figure 6 Figure 7 shows the structural formulas of veselene-2, rutin, hesperidin and lemon balm glycoside.
[0069] The results are as follows Figure 6 China A Figure 6 B, Figure 6 C and Figure 6 As shown in Figure D, compared with the control group fruits transiently transformed with pLGNe, the contents of vescenin-2, rutin, hesperidin, and lemon balm in the peels of the experimental groups pLGNe-CsCOMT2-1, pLGNe-CsCOMT2-2, and pLGNe-CsCOMT2-3, which were transiently transformed with pLGNe-CsCOMT2, increased by 30.86%–51.69%, 25.99%–32.40%, 9.49%–13.87%, and 24.27%–36.84%, respectively. This indicates that transient overexpression of the CsCOMT2 gene can significantly increase the contents of vescenin-2, rutin, hesperidin, and lemon balm in the fruit of the late-maturing orange.
[0070] In summary, this invention is the first to discover a positive correlation between the expression level of the CsCOMT2 gene and the content of vincain-2, rutin, hesperidin, and / or lemon balm glycoside in citrus. The higher the expression level of the CsCOMT2 gene, the higher the content of vincain-2, rutin, hesperidin, and lemon balm glycoside in the citrus peel. In the experiment, citrus transiently transformed with the CsCOMT2 gene overexpression vector showed up to 51.7% higher levels of these compounds compared to citrus transformed with the empty vector. The CsCOMT2 gene can serve as a candidate gene for breeding new citrus varieties with high contents of vincain-2, rutin, hesperidin, and lemon balm glycoside. This is of great significance for using genetic engineering methods to cultivate new functional citrus varieties, accelerate the breeding process, reduce the breeding workload, and improve the comprehensive utilization rate of citrus.
[0071] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. The application of the CsCOMT2 gene in the breeding of new citrus varieties, characterized in that, The CDS sequence of the CsCOMT2 gene is shown in SEQ ID NO.
1. By overexpressing the CsCOMT2 gene, the content of vincain-2, rutin, hesperidin and / or lemon balm glycoside in citrus peel is increased, resulting in a new citrus variety with high content of vincain-2, rutin, hesperidin and / or lemon balm glycoside. The citrus is a late-maturing orange.
2. The application of a vector overexpressing the CsCOMT2 gene as described in claim 1 or a recombinant strain overexpressing the CsCOMT2 gene as described in claim 1 in the breeding of new citrus varieties, characterized in that, The vector or the recombinant strain, by overexpressing the CsCOMT2 gene, increases the content of vincain-2, rutin, hesperidin and / or lemon balm glycoside in citrus peel, thereby obtaining a new citrus variety with high content of vincain-2, rutin, hesperidin and / or lemon balm glycoside, wherein the citrus is a late-maturing orange.
3. A method for breeding a new citrus variety with high content of vincain-2, rutin, hesperidin, and / or lemon balm glycoside, characterized in that, Includes the following steps: The CDS sequence of the CsCOMT2 gene was amplified, an overexpression vector of the CsCOMT2 gene was constructed, Agrobacterium was transformed, and citrus fruits were infected to obtain a new citrus variety. The CDS sequence of the CsCOMT2 gene is shown in SEQ ID NO.1; the citrus fruit is the late-maturing orange.
4. The application of the CsCOMT2 gene in increasing the content of vinazine-2, rutin, and lemon balm in citrus peel, characterized in that... The CDS sequence of the CsCOMT2 gene is shown in SEQ ID NO.1; by overexpressing the CsCOMT2 gene, the content of vincain-2, rutin, and lemon balm in citrus peel is increased; the citrus is Late Orange.