Chimeric antigen receptor modified CD34 + stem cell as well as preparation method and application thereof

Abstract

The invention provides a chimeric antigen receptor modified CD34 + stem cell as well as a preparation method and application thereof, and belongs to the technical field of stem cell treatment. The preparation method comprises the following steps: step 1, flushing marrow fluid from femoral marrow of a C57BL / 6J mouse, and performing centrifugal separation and purification to obtain purified femoral marrow mononuclear cells of the C57BL / 6J mouse; step 2, separating and purifying the purified C57BL / 6J mouse femoral bone marrow mononuclear cells by a magnetic bead separation method to obtain CD34 + cells, and culturing and proliferating for passage to obtain primary CD34 + stem cells of the C57BL / 6J mouse; step 3, constructing a CAR overexpression plasmid; 4, packaging the CAR overexpression plasmid and the lentivirus to obtain a CAR overexpression lentivirus vector; 5, the CAR overexpression lentiviral vector and C57BL / 6J mouse primary CD34 + stem cells are subjected to mixed culture, and the chimeric antigen receptor modified CD34 + stem cells are obtained.

Description

Technical Field

[0001] This invention relates to the field of stem cell therapy technology, specifically to a chimeric antigen receptor-modified CD34+ stem cell, its preparation method, and its application. Background Technology

[0002] Circulating CD34+ stem cells (PCs) have been shown to be mobilized from bone marrow and play a role in repair and angiogenesis in cardiovascular disease. They can directly differentiate into endothelial cells (ECs) and release bioactive molecules, such as exosomes and PPAR agonists, to enhance EC activity. Studies have found that injection of CD34+ PCs can improve EC growth on grafts. To address these challenges, current research has explored methods for recruiting CD34+ stem cells at lesion sites, such as using custom scaffolds designed to enhance CD34+ cell survival at the injury site. Therefore, the focus of research is on increasing the number and function of CD34+ stem cells in the lesion site and guiding them to homing (targeting) to the injury site.

[0003] Chimeric antigen receptor T cells (CAR-T) and macrophages (CAR-M) have been widely used in targeted cancer therapy and have shown significant efficacy. Studies have utilized genetically engineered CAR hematopoietic stem cells (CAR-HPSCs) to generate allogeneic hematopoietic stem cell engineered iNKT (AlloHSC-iNKT) cells, which effectively target tumor cells. These research results indicate that the use of CAR-based technologies in stem cell therapy may be feasible and holds great promise for the future. Many cardiovascular diseases are characterized by high expression of inflammatory factors such as VCAM-1 at the site of injury. Meanwhile, VEGFA has the function of promoting angiogenesis and endothelial cell proliferation and repair, and can stimulate stem cell differentiation into endothelial cells. Summary of the Invention

[0004] This invention is made to solve the above-mentioned problems, and aims to provide a chimeric antigen receptor-modified CD34+ stem cell, its preparation method and application.

[0005] This invention provides a method for preparing chimeric antigen receptor-modified CD34+ stem cells, characterized by the following steps: Step 1, rinsing bone marrow fluid from the femoral bone marrow of C57BL / 6J mice and centrifuging to purify C57BL / 6J mouse femoral bone marrow mononuclear cells; Step 2, separating and purifying the purified C57BL / 6J mouse femoral bone marrow mononuclear cells using magnetic bead separation to obtain CD34+ cells, culturing and proliferating them for passage to obtain primary CD34+ stem cells of C57BL / 6J mice; Step 3, constructing a CAR overexpression plasmid; Step 4, packaging the CAR overexpression plasmid and lentivirus to obtain a CAR overexpression lentiviral vector; Step 5, co-culturing the CAR overexpression lentiviral vector with primary CD34+ stem cells of C57BL / 6J mice to obtain chimeric antigen receptor-modified CD34+ stem cells.

[0006] The method for preparing chimeric antigen receptor-modified CD34+ stem cells provided by this invention may also have the following features: Step 1 specifically includes: taking the femur of a C57BL / 6J mouse, washing out the bone marrow cell suspension with M199 culture medium and filtering it through a 70μm sieve to obtain the filtered bone marrow suspension; centrifuging the filtered bone marrow suspension using a centrifuge at 37℃, speed 300g / min, time 10min, resuspending the cells and adding them above the lymphocyte separation medium, centrifuging at 18-20℃, 2000r / min, 30min, taking the intermediate layer cells, adding them to PBS buffer, centrifuging at 00g / min, 5min, and resuspending to obtain purified C57BL / 6J mouse femoral bone marrow mononuclear cells.

[0007] The method for preparing chimeric antigen receptor-modified CD34+ stem cells provided by this invention may further include the following feature: Step 2 specifically includes: mixing purified C57BL / 6J mouse femoral bone marrow mononuclear cells with CD34+ magnetic beads and incubating at room temperature for 30 min to obtain a mixture, wherein the magnetic beads are MACS CD34 MicroBeads; sorting the mixture using a MACS magnetic sorting system to obtain a cell suspension, transferring the cell suspension to a sorting tube, washing the sorted cells multiple times to obtain enriched CD34+ stem cells; resuspending the enriched CD34+ stem cells in EGM-2 medium and adjusting the cell density to 1×10⁻⁶ cells / mL. 6 The cell suspension was then transferred to a 6-well plate pre-coated with human plasma fibrin and cultured in a cell culture incubator at 37°C and 5% CO2. The medium was changed for the first time after 3 days, and the morphology and growth of the cells were observed.

[0008] The method for preparing chimeric antigen receptor-modified CD34+ stem cells provided by this invention may also have the following features: after obtaining primary CD34+ stem cells from C57BL / 6J mice, it is necessary to perform immunophenotypic identification on the primary CD34+ stem cells from C57BL / 6J mice. The immunophenotypic identification is performed by flow cytometry and immunofluorescence, and the antibodies used are CD34 flow cytometry antibody and CD34 antibody, respectively.

[0009] The method for preparing chimeric antigen receptor-modified CD34+ stem cells provided by this invention may also have the following feature: wherein step 3 specifically includes:

[0010] The scFv target VCAM-1, with CD28 as the hinge region and VEGFA as the intracellular domain. The VCAM-1 single-chain antibody (anti-VCAM-1scFv) and the VEGFA gene were constructed into the PGMLV-EF1a-hinge_TM(CD28) vector to obtain the CAR overexpression plasmid.

[0011] The method for preparing chimeric antigen receptor-modified CD34+ stem cells provided by the present invention may also have the following features: wherein the nucleotide sequence of scFv targeting VCAM-1 is as shown in SEQ ID No: 1, and the gene base sequence of VEGFA is as shown in SEQ ID No: 2.

[0012] The method for preparing chimeric antigen receptor-modified CD34+ stem cells provided by this invention may also have the following characteristics: In step 4, the lentivirus is derived from the supernatant of HEK293T cells, and the lentivirus packaging uses a kit to mix 10 μL of CAR overexpression plasmid with 10 μL of lentivirus mixture and HGTransgene. TM 60 μL of reagent was co-transfected for 2 days to obtain a concentrated viral solution, which was a CAR overexpression lentiviral vector.

[0013] The method for preparing chimeric antigen receptor-modified CD34+ stem cells provided by this invention may also have the following feature: In step 5, the CAR overexpression lentiviral vector diluted with MOI=50 is mixed with 1×105 C57BL / 6J mouse primary CD34+ stem cells and cultured for 16h to obtain chimeric antigen receptor-modified CD34+ stem cells. The culture medium used for the mixed culture is EGM-2 cell culture medium + 0.5μg / mL puromycin.

[0014] The present invention also provides a chimeric antigen receptor-modified CD34+ stem cell, which is prepared by the above-described method for preparing chimeric antigen receptor-modified CD34+ stem cells.

[0015] The present invention also provides the application of the above-mentioned chimeric antigen receptor modified CD34+ stem cells in the preparation of products for the treatment of cardiovascular endothelial injury.

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] The chimeric antigen receptor-modified CD34+ stem cells prepared in this invention can target scFV of vascular cell adhesion molecule-1 (VCAM-1) and secrete vascular endothelial growth factor A (VEGFA). This not only targets common cardiovascular diseases but also increases the ability of CD34+ stem cells to proliferate, migrate, differentiate into endothelial cells, and secrete exosomes to repair vascular damage.

[0018] This invention is the first to apply chimeric antigen receptor technology to the treatment of cardiovascular diseases, providing a promising prospect for its minimally invasive and non-invasive treatment. Attached Figure Description

[0019] Figure 1 This is a flowchart illustrating the isolation of CD34+PC from the bone marrow of C57BL / 6J mice;

[0020] Figure 2 This is an immunofluorescence staining image of CD34+ stem cells;

[0021] Figure 3 This is a flow cytometry staining image of CD34+ stem cells;

[0022] Figure 4 This is a schematic diagram of the CAR structure; Figure 5 These are CAR overexpression plasmids and CAR overexpression lentiviral vectors;

[0023] Figure 6 Construction and purification of lentiviral CAR vectors;

[0024] Figure 7 It represents the expression level of anti-VCAM-1scFv in CD34+ stem cells among different groups;

[0025] Figure 8 The expression stability of CD34+ stem cells against VCAM-1scFv among different groups;

[0026] Figure 9 It represents the expression level of VEGFA among different groups;

[0027] Figure 10 It is the in vitro proliferation capacity of CD34+ stem cells among different groups;

[0028] Figure 11 It is a test of the differentiation capacity of CD34+ stem cells among different groups. Detailed Implementation

[0029] To make the technical means, creative features, objectives and effects of this invention easy to understand, the following embodiments, in conjunction with the accompanying drawings, specifically illustrate the chimeric antigen receptor-modified CD34+ stem cells of this invention, their preparation methods and applications.

[0030] Example

[0031] This embodiment provides a chimeric antigen receptor-modified CD34+ stem cell, its preparation method, and its application.

[0032] The method for preparing chimeric antigen receptor-modified CD34+ stem cells includes the following steps:

[0033] Step 1: Bone marrow fluid was flushed out from the femoral bone marrow of C57BL / 6J mice, and purified by centrifugation to obtain purified C57BL / 6J mouse femoral bone marrow mononuclear cells, which were then cultured in a culture medium.

[0034] Step 1 specifically includes the following sub-steps:

[0035] Step 1-1: Thoroughly disinfect the operating instruments and mice, expose the femur of C57BL / 6J mice, use a syringe to draw 2ml of M199 culture medium to rinse the bone marrow until the bone marrow cavity becomes clear; transfer the rinsed bone marrow cell suspension to a 50ml centrifuge tube with a 70μm sieve, and then add 5ml of M199 culture medium to the centrifuge tube to obtain the filtered bone marrow suspension.

[0036] Steps 1-2: Place the filtered bone marrow suspension in a preheated (37°C) high-speed centrifuge and centrifuge at 300 g / min for 10 min. After centrifugation, remove excess culture medium and resuspend the cells in 3 ml of M199 medium. Gently transfer the resuspended bone marrow cells onto a layer of lymphocyte separation medium (density 1.078) and carefully place the centrifuge. Centrifuge at 18-20°C and 2000 r / min for 30 min. After centrifugation, carefully aspirate the intermediate layer of monocytes, add 2 ml of PBS buffer, centrifuge at 300 g / min for 5 min, wash and resuspend the monocytes, adjusting the cell concentration to 1.5 x 10⁻⁶ cells / mL. 6 Cells / ml were used to obtain purified femoral bone marrow mononuclear cells from C57BL / 6J mice.

[0037] Step 2: The purified femoral bone marrow mononuclear cells of C57BL / 6J mice were separated and purified by magnetic bead separation to obtain CD34+ cells, which were then cultured, proliferated and passaged to obtain primary CD34+ stem cells of C57BL / 6J mice.

[0038] Step 2 specifically includes the following sub-steps:

[0039] Step 2-1: Purified C57BL / 6J mouse femoral bone marrow mononuclear cells were mixed with pre-prepared CD34+ magnetic beads and incubated at room temperature for 30 min to obtain the mixture. The magnetic beads used were MACS CD34 MicroBeads.

[0040] Step 2-2: The mixture is sorted using the MACS magnetic sorting system to collect the enriched CD34+ cells, obtain a cell suspension, and transfer the cell suspension to a sorting tube. The sorted cells are washed multiple times to obtain enriched CD34+ stem cells.

[0041] Steps 2-3: Resuspend the enriched CD34+ stem cells in EGM-2 medium and adjust the cell density to 1×10⁻⁶ cells / year. 6 Cells / ml were collected, and the cell suspension was then transferred to 6-well plates pre-coated with human plasma fibrin. After washing with 3 ml of EGM-2 medium in centrifuge tubes, 1 ml of the solution was transferred to each well of the culture plate. The 6-well plates were incubated at 37°C with 5% CO2. The medium was changed for the first time after 3 days to remove suspended and dead cells. Thereafter, the medium was changed every 2 days, and cell morphology and growth were observed.

[0042] The experimental procedures for steps 1 and 2 above are as follows: Figure 1 As shown.

[0043] Step 3: Immunophenotypic identification of primary CD34+ stem cells from C57BL / 6J mice. Immunophenotypic identification was performed using flow cytometry and immunofluorescence, with CD34 flow cytometry antibody and CD34 antibody used, respectively.

[0044] Step 3 specifically includes the following sub-steps:

[0045] Step 3-1: Seed CD34+ cells onto coverslips and fix with 4% paraformaldehyde solution at room temperature for 15-20 minutes. Incubate with 0.1%-0.3% Triton X-100 solution at room temperature for 10 minutes, then block with 5%-10% BSA solution at room temperature for 30 minutes. Dilute the CD34 primary antibody to 1:100, dilute with antibody diluent, and add to the cells. Incubate at room temperature in the dark for 1 hour. Wash cells three times with PBS buffer, 5 minutes each time. Dilute the fluorescently labeled secondary antibody to 1:200 and add to the cells. Incubate at room temperature in the dark for 30-60 minutes. Wash as before. Add 1 μg / ml DAPI staining solution to the cells and incubate in the dark for 5 minutes. Wash as before. Observe the CD34 fluorescence signal of the cells under a fluorescence microscope. (Flowchart of CD34+ PC isolation from C57BL / 6J mouse bone marrow, purity approximately 96.16±1.22% (n=3) is shown.) Figure 2 As shown.

[0046] Step 3-2: Prepare a cell suspension from the above-mentioned cells and adjust the cell concentration to 1×10⁷ cells / ml. Fix with 4% paraformaldehyde solution for 10 minutes at room temperature, then incubate at 300 g / min for 5 minutes, discarding the supernatant. Permeabilize with methanol at 4℃ for 30 minutes; then incubate at 300 g / min for 5 minutes to prepare a cell suspension again. Add 3×10⁵ cells (approximately 30 μl) and 5 μl of FITC-labeled CD34 antibody to a flow cytometer and incubate at room temperature in the dark for 1 hour. Incubate at 300 g / min for 5 minutes, wash, and prepare a cell suspension again. Store at 4℃ in the dark and analyze the results using flow cytometry. Figure 3 As shown.

[0047] Step 4, construct CAR overexpression plasmid:

[0048] CAR structural design such as Figure 4 As shown, to endow CD34+ PCs with the ability to target VCAM-1 expressed in aortic lesions and secrete large amounts of VEGFA, thereby activating CD34+ cells and promoting endothelial cell repair, we designed a specialized cell type called VCAM-1CAR-CD34+ PC expressing VEGFA (VEGFA-VCAM-1-CAR PC). This tandem construct consists of a first-generation anti-VCAM-1 CAR construct and mouse VEGFA linked by a cleavable 2A peptide sequence.

[0049] The scFv target VCAM-1, with CD28 as the hinge region and VEGFA as the intracellular domain. The VCAM-1 single-chain antibody (anti-VCAM-1scFv) and the VEGFA gene were constructed into the PGMLV-EF1a-hinge_TM(CD28) vector to obtain the CAR overexpression plasmid.

[0050] The nucleotide sequence of the scFv targeting VCAM-1 (as shown in SEQ ID No: 1) is as follows:

[0051] CAGAAGCCTGGGCAGGGCCTTGAGTGGATTGGATATATTAATCC

[0052] TTACAATGATGGACTAAGTACAATGAGAAGTTCAAAGGCAAGG

[0053] CCACACTGACTTCAGACAAATCCTCCAGCACAGCCTACATGGA

[0054] GCTCAGCAGCCTGACCTCTGAGGACTCTGCGGTCTATTACTGTG

[0055] CAAGATCCTATAGGTACGGTCGATATGCTATGGACTACTGGGGTC

[0056] AAGGAACCTCAGTCACCGTCTCCTCAGGTGGAGGCGGTTCAGG

[0057] CGGAGGTGGTTCTGGCGGTGGCGGATCGGACATTGTGCTGACC

[0058] CAGTCTCCTGCTTCCTTAGCTGTATCTCTGGGGCAGAGGGCCAC

[0059] CATCTCATGCAGGGCCAGCCAAAGTGTCAGTACATCTAGCTATA

[0060] GTTATATGCACTGGTACCAACAGAAACCAGGACAGCCACCCAA

[0061] ACTCCTCATCAAGTATGCATCCAACCTAGAATCTGGGGTCCCTG

[0062] CCAGGTTCAGTGGCAGTGGGTCTGGGACAGACTTCACCCTCAA

[0063] CATCCATCCTGTGGAGGAGGAGGATACTGCAACATATTACTGTC

[0064] AGCACAGTTGGGAGATTCCGTACACGTTCGGAGGGGGGACCAAGCTGGAAATAAAACGG。

[0065] The gene base sequence of VEGFA (as shown in SEQ ID No: 2) is specifically as follows:

[0066]

[0067] Step 4 specifically includes the following sub-steps:

[0068] Step 4-1: Design and synthesize primers. Based on the target gene sequence (SEQ ID No: 1 and SEQ ID No: 2), design and synthesize primers for amplifying the target gene fragment. During amplification, EcoRI and BamHI restriction enzyme sites are added to both ends of the target gene to facilitate subsequent cloning operations.

[0069] Step 4-2: Cultivate and extract the vector plasmid. Select the bacterial culture of the PGMLV-EF1a-hinge_TM(CD28) vector and culture it overnight. The next day, take 3-5 mL of fresh culture medium for plasmid extraction. Ensure that the extracted plasmid has high purity and appropriate concentration.

[0070] Step 4-3: Take 1 μg of the extracted fresh plasmid and perform double digestion using the appropriate restriction endonuclease. The digestion system is set up as follows:

[0071]

[0072] The enzyme digestion products were loaded into an agarose gel and separated by electrophoresis. After electrophoresis, the gel was observed under a UV lamp to locate the strip containing the target fragment. The gel strip containing the target fragment was cut off under UV light, taking care to avoid entraining other irrelevant fragments. The total weight of the gel strip was weighed using a balance, and the weight of the empty tube was subtracted to calculate the actual weight of the gel. Based on the weight of the gel, the gel volume was calculated proportionally (100 mg agarose gel is approximately equal to 100 μL), and then an equal volume of Binging Solution was added. The mixture was placed in a 65°C water bath for heating and dissolution, ensuring complete gel melting. During this process, the EP tube was gently shaken to accelerate the dissolution rate. After the gel was completely dissolved, DNA was recovered using a dedicated recovery reagent, following the instructions in the kit's manual, to obtain the purified target gene fragment.

[0073] Step 4-4: Transfer all the above liquid to the filter column and centrifuge at 13000 rpm for 30 seconds. Discard the liquid in the tube, add 500 μL of WA Solution to the filter column, and centrifuge again at 13000 rpm for 30 seconds. Discard the liquid in the tube, add 500 μL of Wash Solution to the filter column, and centrifuge at 13000 rpm for 30 seconds. Then, run the filter column empty for 3 minutes to ensure it is completely dry. Next, place the filter column in a new 1.5 mL EP tube and allow it to air dry at room temperature. Finally, add 35 μL of ddH2O to the filter column, let it stand for 5 minutes, and centrifuge again at 13000 rpm for 1.5 minutes to complete DNA elution. Add the dissolved DNA back to the filter column and centrifuge for 1 minute. Discard the filter column to obtain the recovered vector fragment, and determine its concentration.

[0074] Steps 4-5: Dilute the synthesized primers to a final concentration of 10 μmol / L in stock solution. Use this stock solution to perform PCR amplification with template DNA. The PCR reaction system is as follows:

[0075]

[0076] Steps 4-6: Add the above PCR reaction system to a thin-walled tube, mix gently, and centrifuge briefly. Place the reaction tube in a PCR instrument, set the appropriate annealing and extension temperatures, and start PCR amplification. After PCR amplification, analyze the amplification products using agarose gel electrophoresis, and recover the target gene fragment as needed, following the steps outlined above.

[0077] Steps 4-7 involve ligating the target fragment to the vector using a seamless cloning method. First, the concentrations of the recovered vector and target fragment are determined. This is based on Hieff Clone... TM For the recombinant reaction system, the optimal amount of cloning vector is 0.03 pmol, and the optimal molar ratio of cloning vector to insert fragment is 1:2, meaning the optimal amount of insert fragment is 0.06 pmol. Based on the number of base pairs in the target DNA, the required DNA mass can be calculated using the following formula:

[0078] Optimal cloning vector dosage = [0.02 × number of base pairs in the cloning vector] ng (i.e., 0.03 pmol)

[0079] Optimal amount of insert fragment used = [0.04 × number of base pairs of insert fragment] ng (i.e. 0.06 pmol)

[0080] Steps 4-8 involve ligating the vector to the target fragment at 50°C for 20 minutes. The ligation reaction system is as follows:

[0081]

[0082] Steps 4-9: Place competent cells on ice (4°C) to thaw naturally. After thawing, add 10 μL of the ligation product to the competent cells and continue to place the reaction tube on ice (4°C) for 30 minutes. Then, transfer the cells to a 42°C water bath for heat shock for 90 seconds. After heat shock, immediately place the tube on ice (4°C) for 2-3 minutes. Add 500 μL of antibiotic-free SOC medium to the reaction system, mix well, and incubate with shaking at 37°C and 225 rpm for 45 minutes.

[0083] Steps 4-10: Centrifuge the culture medium at 3000 rpm for 2 minutes and discard 900 μL of supernatant. Gently pipette the bottom of the tube to resuspend the cells. Spread the suspension onto a culture plate containing the appropriate antibiotic (such as ampicillin or kanamycin) using a sterile spreader to evenly distribute the cells. Finally, invert the culture plate and incubate overnight at 37°C.

[0084] Step 5: CAR overexpression lentiviral vectors were obtained by packaging CAR overexpression plasmids and lentiviruses. The lentiviruses were derived from the supernatant of HEK293T cells.

[0085] Step 5 specifically includes the following sub-steps:

[0086] Step 5-1, 293T cell separation: One day before transfection, passage the 293T cells that have grown to the appropriate state into 10cm culture dishes at an appropriate ratio, and culture them until the cell density reaches 70%-80%, in preparation for transfection.

[0087] Step 5-2: Take a sterile 1.5mL EP tube or 15mL centrifuge tube and prepare the transfection system according to the following formula:

[0088]

[0089] After mixing the transfection system, let it stand at room temperature for 15-20 minutes. After standing, add the transfection solution evenly to the culture dish to be transfected, and then place the culture dish in an incubator containing 5% CO2 for further incubation.

[0090] Add enhancing buffer: 10-12 hours after transfection, add 100× enhancing buffer evenly to promote transfection, at a rate of 120 μL / plate.

[0091] Step 5-3: 18-20 hours after transfection, carefully aspirate the cell culture medium and discard it in a waste container filled with sterile solution. Then add 12 mL of DMEM cell culture medium containing 1% serum and continue culturing.

[0092] Step 5-4: 48 hours after transfection, collect the cell supernatant into a 50 mL centrifuge tube and centrifuge at 4000g for 5 minutes at 4°C. Filter the supernatant through a 0.22 μm filter, and transfer the filtered liquid to a new centrifuge tube. Then, transfer the filtrate in batches to a concentration device and centrifuge at 3500g for 10 minutes at 4°C, discarding the lower layer (discard in a waste container). Finally, centrifuge again at 3500g for 20 minutes at 4°C; the liquid collected at the top of the filter at this point is the lentivirus concentrate.

[0093] Step 5-5: Aliquot the lentivirus concentrate and store it at -80°C.

[0094] Steps 5-6: Lentiviral packaging uses a kit to mix 10 μL of CAR overexpression plasmid with 10 μL of lentivirus mixture and HGTransgene. TM 60 μL of reagent was co-transfected for 2 days to obtain a concentrated viral solution, which was a CAR overexpression lentiviral vector.

[0095] The plasmid constructed in step 4 above and the CAR-overexpressing lentiviral vector packaged in step 5 above are as follows: Figure 5 As shown, the experimental procedure for constructing plasmids and CAR lentiviral vectors is as follows: Figure 6 As shown.

[0096] Step 6: The CAR-overexpressing lentiviral vector was co-cultured with primary CD34+ stem cells from C57BL / 6J mice to obtain chimeric antigen receptor-modified CD34+ stem cells.

[0097] In step 6, the CAR overexpression lentiviral vector diluted with MOI=50 was co-cultured with 1×10⁵ primary CD34+ stem cells of C57BL / 6J mice for 16 h to obtain chimeric antigen receptor modified CD34+ stem cells. The culture medium used for co-culture was EGM-2 cell culture medium + 0.5 μg / mL puromycin.

[0098] After obtaining a stable transfected CD34+ cell line through lentiviral transfection, the expression of VCAM-1scFv was quantified by flow cytometry, such as... Figure 7 As shown.

[0099] Stability testing of VCAM-1scFv expression showed that VCAM-1scFv expression was stable within three days. Figure 8 As shown.

[0100] VEGFA expression level analysis and Western blot analysis showed that, compared with PBS, CD34+ PC transfected with a lentiviral vector overexpressing CAR plasmid (LV-CAR) showed significantly increased VEGFA expression (all p < 0.05). Figure 9As shown.

[0101] VEGFA promoted the migration, differentiation, and proliferation of CD34+ progenitor cells. EdU assays showed that the LV-CAR group had significantly increased cell proliferation compared to the other groups (all p < 0.05). Figure 10 In freshly isolated CD34+ stem cells, flow cytometry analysis three days after CAR plasmid overexpression showed a significant increase in endothelial markers, including CD31 and VE-CAD. Figure 11 ).

[0102] The above results indicate that the chimeric antigen receptor-modified CD34+ stem cells prepared in this embodiment can be used to prepare products for the treatment of cardiovascular endothelial injury.

[0103] Those skilled in the art should understand that this invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to this invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the invention as claimed. The scope of protection of this invention is defined by the appended claims and their equivalents.

Claims

1. A method for preparing chimeric antigen receptor-modified CD34+ stem cells, characterized in that, Includes the following steps: Step 1: Bone marrow fluid was flushed out from the femoral bone marrow of C57BL / 6J mice and purified by centrifugation to obtain purified C57BL / 6J mouse femoral bone marrow mononuclear cells; Step 2: The purified C57BL / 6J mouse femoral bone marrow mononuclear cells are separated and purified by magnetic bead separation to obtain CD34+ cells, which are then cultured, proliferated, and passaged to obtain C57BL / 6J mouse primary CD34+ stem cells. Step 3: Construct CAR overexpression plasmid; Step 4: Use the CAR overexpression plasmid and lentivirus to package and obtain a CAR overexpression lentiviral vector; Step 5: The CAR-overexpressing lentiviral vector is co-cultured with the primary CD34+ stem cells of C57BL / 6J mice to obtain chimeric antigen receptor-modified CD34+ stem cells.

2. The method for preparing chimeric antigen receptor-modified CD34+ stem cells according to claim 1, Its features are: Step 1 specifically includes: The femur of C57BL / 6J mice was used to wash out the bone marrow cell suspension using M199 medium and filtered through a 70μm sieve to obtain the filtered bone marrow suspension. The filtered bone marrow suspension was centrifuged at 37°C, 300 g / min, for 10 min. After resuspending the cells, the suspension was added above the lymphocyte separation medium and centrifuged at 18-20°C, 2000 r / min, for 30 min. The intermediate layer cells were collected, added to PBS buffer, centrifuged at 300 g / min, for 5 min, and resuspended to obtain purified C57BL / 6J mouse femoral bone marrow mononuclear cells.

3. The method for preparing chimeric antigen receptor-modified CD34+ stem cells according to claim 2, characterized in that: in, Step 2 specifically includes: The purified C57BL / 6J mouse femoral bone marrow mononuclear cells were mixed with CD34+ magnetic beads and incubated at room temperature for 30 min to obtain a mixture. The magnetic beads were MACS CD34 MicroBeads. The mixture was sorted using a MACS magnetic sorting system to obtain a cell suspension, which was then transferred to a sorting tube. The sorted cells were washed multiple times to obtain enriched CD34+ stem cells. The enriched CD34+ stem cells were resuspended in EGM-2 medium and the cell density was adjusted to 1×10⁻⁶. 6 The cell suspension was then transferred to a 6-well plate pre-coated with human plasma fibrin and cultured in a cell culture incubator at 37°C and 5% CO2. The medium was changed for the first time after 3 days, and the morphology and growth of the cells were observed.

4. The method for preparing chimeric antigen receptor-modified CD34+ stem cells according to claim 1, characterized in that: in, After obtaining the primary CD34+ stem cells from C57BL / 6J mice, it is necessary to perform immunophenotypic identification on the primary CD34+ stem cells from C57BL / 6J mice. The immunophenotypic identification was performed using flow cytometry and immunofluorescence, with the antibodies used being CD34 flow cytometry antibody and CD34 antibody, respectively.

5. The method for preparing chimeric antigen receptor-modified CD34+ stem cells according to claim 1, characterized in that: in, Step 3 specifically includes: The scFv target VCAM-1, with CD28 as the hinge region and VEGFA as the intracellular domain. The VCAM-1 single-chain antibody and VEGFA gene were constructed into the PGMLV-EF1a-hinge_TM(CD28) vector to obtain the CAR overexpression plasmid.

6. The method for preparing chimeric antigen receptor-modified CD34+ stem cells according to claim 5, characterized in that: in, The nucleotide sequence of the scFv targeting VCAM-1 is shown in SEQ ID No:

1. The gene base sequence of VEGFA is shown in SEQ ID No:

2.

7. The method for preparing chimeric antigen receptor-modified CD34+ stem cells according to claim 1, characterized in that: in, In step 4, the lentivirus is derived from the supernatant of HEK293T cells. Lentiviral packaging uses a kit to mix 10 μL of the CAR overexpression plasmid with 10 μL of the lentivirus mixture and HGTransgene. TM 60 μL of reagent was co-transfected for 2 days to obtain a concentrated viral solution, which was the CAR overexpression lentiviral vector.

8. The method for preparing chimeric antigen receptor-modified CD34+ stem cells according to claim 1, characterized in that: in, In step 5, the CAR overexpression lentiviral vector was diluted with an MOI of 50 and mixed with 1×10⁵ primary CD34+ stem cells of the C57BL / 6J mouse for 16 h to obtain the chimeric antigen receptor modified CD34+ stem cells. The culture medium used for the mixed culture was EGM-2 cell culture medium + 0.5 μg / mL puromycin.

9. A chimeric antigen receptor-modified CD34+ stem cell, characterized in that: It was prepared using the method for preparing chimeric antigen receptor-modified CD34+ stem cells as described in any one of claims 1-8.

10. The use of the chimeric antigen receptor-modified CD34+ stem cells as described in claim 9 in the preparation of products for the treatment of cardiovascular endothelial injury.

Images