RNAi reagents for inhibiting expression of thymic stromal lymphopoietin (TSLP), compositions and methods of use thereof

Abstract

RNAi agents, compositions comprising RNAi agents, and methods for inhibiting thymic stromal lymphopoietin (TSLP) genes are described. The TSLP RNAi reagents and RNAi reagent conjugates disclosed herein inhibit the expression of the TSLP gene. Also described are pharmaceutical compositions comprising one or more TSLP RNAi agents, optionally in conjunction with one or more additional therapeutic agents. Delivery of the TSLP RNAi agents in vivo to lung cells provides inhibition of TSLP gene expression, which can provide therapeutic benefits to subjects, including human subjects, for the treatment of various diseases, including lung inflammatory diseases such as asthma, including allergic asthma.

Description

[0001] Cross-references to related applications This application claims priority to U.S. Provisional Patent Application Serial No. 63 / 485,081, filed February 15, 2023; U.S. Provisional Patent Application Serial No. 63 / 516,300, filed July 28, 2023; and U.S. Provisional Patent Application Serial No. 63 / 625,543, filed January 26, 2024, the contents of which are incorporated herein by reference in their entirety.

[0002] sequence list This application contains a sequence list (compliant with standard ST26) that has been submitted in XML format and is incorporated herein by reference in its entirety. The XML sequence list file is named 30723-WO_SeqListing.xml, was created on February 7, 2024, and has a size of 3252 kb. Invention Field

[0003] This disclosure relates to RNA interference (RNAi) agents, such as double-stranded oligonucleotide RNAi agents, compositions including TSLP RNAi agents, for inhibiting the expression of the thymic stromal lymphopoietin (“TSLP”) gene, and methods of using the same. Background of the Invention Thymic stromal lymphopoietin (“TSLP”) is an epithelial-derived cytokine involved in the initiation and persistence of inflammatory pathways in asthma (Parnes et al., 2022). TSLP is a member of the 4-helix bundle cytokine family and a distant paralog of interleukin (IL)-7, expressed by human epithelial cells in the thymus, lung, intestine, skin, and stroma, as well as in tonsillar and mast cells (Hu et al., 2017). TSLP affects various cell types via a heterodimeric receptor composed of the IL-7 receptor chain (IL-7Ra) and the specific subunit TSLP-specific receptor (TSLPR) (Pandey et al., 2000).

[0005] Two variants of human TSLP (short and long) have been identified to date. The short TSLP (“sfTSLP”) (60 amino acids) is constitutively expressed and maintains homeostasis in the skin, gut, oral epithelium, and salivary glands, and is downregulated under inflammatory conditions. In contrast, the long TSLP (“lfTSLP”) (159 amino acids) is inducible and can be significantly upregulated in inflammatory diseases such as atopic dermatitis (AD) and allergic asthma (AA) (Adhikary et al. 2021, Pelaia et al. 2021). sfTSLP does not bind to TSLPR and does not block the binding of lfTSLP to this receptor (Adhikary, Tan et al. 2021).

[0006] TSLP stimulates dendritic cells to guide naive Th cells toward Th2 lineage differentiation, but can also promote Th17 shaping (Gauvreau, Sehmi et al. 2020). Furthermore, TSLP activates ILC2, mast cells, and basophils, induces eosinophil survival and migration, and also affects the function of airway structural cells such as fibroblasts and airway smooth muscle cells (Gauvreau, Sehmi et al. 2020). In allergic asthma, TSLP promotes Th2 lymphocyte differentiation via dendritic cell activation, secreting IL-4, IL-5, IL-9, and IL-13, which target B cells, eosinophils, mast cells, and airway smooth muscle cells, respectively (Pelaia et al. 2021). Given its top position in the inflammatory cascade, TSLP can exert a broad influence on airway inflammation through its effects on multiple cell types and pathways. Therefore, therapies targeting TSLP could provide novel approaches to treating inflammation in asthma.

[0007] TSLP overexpression can be detected on the inner and outer surfaces of bronchial epithelial biopsies, as well as in serum, induced sputum, bronchoalveolar lavage fluid (BALF), and exhaled condensate in asthmatic patients and mice with asthma (Al-Shami et al. 2005; Ying et al. 2005; Zhou et al. 2005). Furthermore, airway expression levels of TSLP are associated with asthma severity and airflow (Ying et al. 2008; Gauvreau et al. 2020).

[0008] Genomic studies have shown that some single nucleotide polymorphisms (SNPs) in the TSLP gene are associated with the risk of developing asthma (Torgerson et al., 2011).

[0009] Tezepelumab is an anti-TSLP human monoclonal antibody used to treat asthma. In the PATHWAY phase 2b (NCT02054130) and NAVIGATOR phase 3 (NCT03347279) studies, tezepelumab significantly reduced the rate of exacerbations in patients with severe, uncontrolled asthma compared to placebo (Corren et al. 2017; Menzies-Gow et al. 2021). The reported clinical benefits were associated with reductions in a broad spectrum of cytokines (e.g., interleukin [IL]-5, IL-13) and baseline biomarkers (e.g., blood eosinophils, immunoglobulin [Ig]E, exhaled nitric oxide [FeNO]) levels and were observed across a range of severe asthma phenotypes, including eosinophilic and non-eosinophilic (Diver et al. 2021; Puzzovio et al. 2022). TSLP-neutralizing antibodies have also been reported to alleviate airway inflammation in various asthma models, including mouse house dust mite (HDM), ovalbumin (OVA), and toluene diisocyanate (TDI) induced models (Li et al. 2010; Chen et al. 2018; Yu et al. 2019). However, tazelimumab requires subcutaneous injection every 4 weeks. A sufficiently safe, potent, and active RNA interference agent targeting TSLP would provide alternative treatment options for patients, and in particular, if the RNAi agent could be administered via inhalation and / or on a less frequent basis (e.g., once per quarter or once every two months), it could offer patients improved and more desirable treatment options. Invention Overview There is a need for novel RNA interference (RNAi) agents (referred to as RNAi reagents, RNAi triggers, or triggers), such as double-stranded RNAi reagents, capable of selectively and effectively inhibiting TSLP gene expression, including for use as therapeutics or pharmaceuticals. Furthermore, there is a need for compositions of novel TSLP-specific RNAi reagents for the treatment of diseases or conditions associated with lung inflammation, such as asthma (specifically including allergic asthma) and / or conditions that can be mediated, at least partially, by reduced TSLP gene expression.

[0011] The nucleotide sequences and chemical modifications of the TSLP RNAi reagents disclosed herein, as well as their combinations with certain specific targeting ligands suitable for the selective and efficient delivery of the TSLP RNAi reagents to relevant lung cells in vivo, differ from those previously disclosed or known in the art. The TSLP RNAi reagents disclosed herein provide highly potent and efficient inhibition of TSLP gene expression.

[0012] Generally, this disclosure is characterized by a TSLP gene-specific RNAi reagent, a composition comprising the TSLP RNAi reagent, and a method for inhibiting TSLP gene expression in vitro and / or in vivo using the TSLP RNAi reagent and the composition comprising the TSLP RNAi reagent described herein. The TSLP RNAi reagent described herein can selectively and effectively reduce TSLP gene expression, thereby inhibiting the translation of TSLP proteins or cytokines at the initiation stage of the inflammatory cascade, leading to a reduction in airway inflammation.

[0013] The TSLP RNAi reagent can be used in therapeutic treatments (including preventative or prophylactic treatments) for, but not limited to, the following symptoms and diseases: asthma, including but not limited to allergic asthma; chronic obstructive pulmonary disease, including but not limited to chronic bronchitis and emphysema; inflammatory lung diseases; interstitial lung disease (ILD); cystic fibrosis; various other types of fibrosis; infectious diseases (e.g., SARS-CoV-2); acute lung injury (e.g., acute respiratory distress syndrome (ARDS)); pulmonary hypertension; various lung cancers; chronic sinusitis with or without nasal polyps; autoimmune diseases, including but not limited to systemic sclerosis (SSc); and various inflammatory diseases, including but not limited to atopic dermatitis, chronic spontaneous urticaria, and eosinophilic esophagitis.

[0014] In one aspect, this disclosure features an RNAi reagent for inhibiting TSLP gene expression, wherein the RNAi reagent comprises a sense strand (also referred to as a guest strand) and an antisense strand (also referred to as a guide strand). The sense strand and antisense strand may be partially complementary, substantially complementary, or completely complementary to each other. The length of the sense strand of the RNAi reagent described herein may each be from 12 to 49 nucleotides. The length of the antisense strand of the RNAi reagent described herein may each be from 18 to 30 nucleotides. In some embodiments, the lengths of the sense strand and antisense strand are independently from 18 to 26 nucleotides. The sense strand and antisense strand may be the same length or different lengths. In some embodiments, the lengths of the sense strand and antisense strand are independently from 21 to 26 nucleotides. In some embodiments, the lengths of the sense strand and antisense strand are independently from 21 to 24 nucleotides. In some embodiments, both the sense strand and antisense strand are 21 nucleotides in length. In some embodiments, the length of the antisense strand is independently 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. In some embodiments, the length of the sense strand is independently 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides. Upon delivery to TSLP-expressing cells, such as lung cells, the RNAi reagent described herein inhibits the expression of one or more TSLP gene variants in vivo and / or in vitro.

[0015] The TSLP RNAi reagents disclosed herein target the human TSLP gene (see, for example, SEQ ID NO:1). In some embodiments, the TSLP RNAi reagents disclosed herein target a portion of the TSLP gene having any of the sequences disclosed in Table 1.

[0016] In another aspect, this disclosure is characterized by compositions, including pharmaceutical compositions comprising one or more disclosed TSLP RNAi agents capable of selectively and effectively reducing TSLP gene expression. Compositions comprising one or more TSLP RNAi agents described herein may be administered to subjects, such as human or animal subjects, for the treatment (including prophylactic treatment or inhibition) of, but not limited to, the following symptoms and diseases: asthma, including but not limited to allergic asthma; chronic obstructive pulmonary disease, including but not limited to chronic bronchitis and emphysema; inflammatory lung diseases; interstitial lung disease (ILD); cystic fibrosis; various other types of fibrosis; infectious diseases (e.g., SARS-CoV-2); acute lung injury (e.g., acute respiratory distress syndrome (ARDS)); pulmonary hypertension; various lung cancers; chronic sinusitis with or without nasal polyps; autoimmune diseases, including but not limited to systemic sclerosis (SSc); and various inflammatory diseases, including but not limited to atopic dermatitis, chronic spontaneous urticaria, and eosinophilic esophagitis.

[0017] Tables 3, 4, 5, and 6 provide examples of sense and antisense strands of TSLP RNAi reagents that can be used in TSLP RNAi reagents. Tables 7A, 7B, 8, 9, and 10 provide examples of duplexes of TSLP RNAi reagents. Table 2 provides examples of 19-nucleotide core sequences that may consist of or may be included in the sense and antisense strands of certain TSLP RNAi reagents disclosed herein.

[0018] In another aspect, this disclosure is characterized by a method for delivering a TSLP RNAi reagent to epithelial cells of a subject (e.g., a mammal) in vivo. Compositions for use in such methods are also described herein. In some embodiments, methods for delivering a TSLP RNAi reagent to lung cells (epithelial cells, macrophages, smooth muscle cells, endothelial cells) of a subject in vivo are disclosed herein. In some embodiments, the subject is a human subject.

[0019] The methods disclosed herein include administering one or more TSLP RNAi reagents to a subject, such as a human or animal subject, using any suitable means known in the art. The pharmaceutical compositions disclosed herein comprising one or more TSLP RNAi reagents can be administered in a variety of ways, depending on whether local or systemic treatment is required. Administration can be, but is not limited to, intravenous, intra-arterial, subcutaneous, intraperitoneal, subdermal (e.g., via an implanted device), and intraparenchymal administration. In some embodiments, the pharmaceutical compositions described herein are administered by inhalation (e.g., dry powder inhalation or aerosol inhalation) or by using a nebulizer, intranasal administration, intratracheal administration, or oropharyngeal aspiration.

[0020] In some implementations, the TSLP RNAi reagent described herein is intended to inhibit the expression of the TSLP gene in the lung epithelium, and its application is by inhalation (e.g., via an inhaler device, such as a metered inhaler, or a nebulizer such as a jet or vibrating mesh nebulizer, or a soft mist inhaler).

[0021] One or more TSLP RNAi reagents can be delivered to target cells or tissues using any oligonucleotide delivery technology known in the art. In some embodiments, the TSLP RNAi reagent is delivered to cells or tissues by covalently linking the RNAi reagent to a targeting group. In some embodiments, the targeting group may include a cell receptor ligand, such as an integrin targeting ligand. Integrins are a family of transmembrane receptors that promote extracellular matrix (ECM) adhesion. In particular, integrin α-v-β-6 (αvβ6) is an epithelial-specific integrin known as a receptor for ECM proteins and the TGF-β potential related peptide (LAP), and is expressed in a variety of cells and tissues. Integrin αvβ6 is known to be highly upregulated in damaged lung epithelium. In some embodiments, the TSLP RNAi reagent described herein is linked to an integrin targeting ligand with affinity for integrin αvβ6. As mentioned herein, an "αvβ6 integrin-targeting ligand" is a compound with affinity for integrin αvβ6 that can be used as a ligand to facilitate the targeting and delivery of an RNAi reagent to which it is attached to to the desired cells and / or tissues (i.e., cells expressing integrin αvβ6). In some embodiments, multiple αvβ6 integrin-targeting ligands or clusters of αvβ6 integrin-targeting ligands are linked to a TSLP RNAi reagent. In some embodiments, the TSLP RNAi reagent-αvβ6 integrin-targeting ligand conjugate is selectively internalized by lung epithelial cells via receptor-mediated endocytosis or by other means.

[0022] Examples of targeting groups that can be used to deliver TSLP RNAi reagents comprising αvβ6 integrin targeting ligands are disclosed, for example, in International Patent Application Publication No. WO 2018 / 085415 and International Patent Application Publication No. WO 2019 / 089765, the contents of which are incorporated herein by reference in their entirety.

[0023] The targeting group can be attached to the 3' or 5' end of the sense or antisense strand of the TSLP RNAi reagent. In some embodiments, the targeting group is attached to the 3' or 5' end of the sense strand. In some embodiments, the targeting group is attached to the 5' end of the sense strand. In some embodiments, the targeting group is internally attached to a nucleotide on the sense and / or antisense strand of the RNAi reagent. In some embodiments, one or more targeting ligands are internally attached to one or more nucleotides on the sense strand of the RNAi reagent. In some embodiments, the targeting group is attached to the RNAi reagent via a linker.

[0024] In another aspect, this disclosure is characterized by compositions comprising one or more TSLP RNAi reagents having the double-stranded structures disclosed in Tables 7A, 7B, 8, 9 and 10.

[0025] The use of TSLP RNAi reagents provides a method for the therapeutic (including preventative) treatment of diseases or conditions for which a reduction in TSLP can provide therapeutic benefit. The TSLP RNAi reagents disclosed herein can be used to treat a variety of diseases, such as asthma (including but not limited to allergic asthma), chronic obstructive pulmonary disease (COPD) (including but not limited to chronic bronchitis and emphysema), inflammatory lung conditions, interstitial lung disease (ILD), cystic fibrosis, various other types of fibrosis, infectious diseases (e.g., SARS-CoV-2), acute lung injury (e.g., acute respiratory distress syndrome (ARDS)), pulmonary hypertension, various lung cancers, chronic sinusitis with or without nasal polyps, autoimmune diseases (including but not limited to systemic sclerosis (SSc)), and various inflammatory diseases (including but not limited to atopic dermatitis, chronic spontaneous urticaria, and eosinophilic esophagitis). In some embodiments, the TSLP RNAi reagents disclosed herein can be used to treat inflammatory lung diseases or conditions. In some embodiments, the TSLP RNAi reagents disclosed herein can be used to treat asthma. TSLP RNAi reagents can be used to treat, for example, allergic asthma. Such treatments involve administering TSLP RNAi reagents to humans or animals with a desired reduction in TSLP levels.

[0026] definition As used herein, the terms “oligonucleotide” and “polynucleotide” refer to polymers of linked nucleosides, each of which may be independently modified or unmodified.

[0027] As used herein, “RNAi reagent” (also referred to as “RNAi trigger”) means a composition of substances containing RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecules that are capable of degrading or inhibiting (e.g., under appropriate conditions, degrading or inhibiting) the translation of messenger RNA (mRNA) transcripts of target mRNA in a sequence-specific manner. As used herein, RNAi reagents may act through RNA interference mechanisms (i.e., by inducing RNA interference through interaction with RNA interference pathways in mammalian cells, such as RNA-induced silencing complexes or RISC) or through any alternative mechanism or pathway. Although it is considered that RNAi reagents act primarily through RNA interference mechanisms as used herein, the disclosed RNAi reagents are not bound to or limited to any particular pathway or mechanism of action. The RNAi reagents disclosed herein consist of sense and antisense strands and include, but are not limited to, short (or small) interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), and dicer substrates. The antisense strand of the RNAi reagent described herein is at least partially complementary to the target mRNA (i.e., TSLP mRNA). The RNAi reagent may include one or more modified nucleotides and / or one or more non-phosphodiester bonds.

[0028] As used herein, when referring to the expression of a given gene, the terms “silence,” “reduction,” “inhibition,” “downregulation,” or “knockdown” mean, as measured by the level of RNA transcribed from the gene, or the level of polypeptide, protein, or protein subunit translated from mRNA, in a cell, cell population, tissue, organ, or subject in which the gene is transcribed, when the cell, cell population, tissue, organ, or subject is treated with the RNAi reagent described herein, the expression of the gene is reduced compared to a second cell, cell population, tissue, organ, or subject who has not been treated in this way.

[0029] As used herein, the terms “sequence” and “nucleotide sequence” refer to a sequence or order of nucleobases or nucleotides described by consecutive letters using standard nomenclature.

[0030] As used herein, “base,” “nucleotide base,” or “nucleobase” is a heterocyclic pyrimidine or purine compound that is a component of a nucleotide, and includes primary purine bases adenine and guanine, and primary pyrimidine bases cytosine, thymine, and uracil. Nucleobases may be further modified to include, but are not limited to, universal bases, hydrophobic bases, hybrid bases, size-extended bases, and fluorinated bases. (See, for example, Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed., Wiley-VCH, 2008). The synthesis of such modified nucleobases (including phosphorous amide compounds containing modified nucleobases) is known in the art.

[0031] As used herein, and unless otherwise stated, when used to describe a first nucleobase or nucleotide sequence (e.g., the sense strand or targeting mRNA of an RNAi reagent) relating to a second nucleobase or nucleotide sequence (e.g., the antisense strand or single-stranded antisense oligonucleotide of an RNAi reagent), the term "complementary" means the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize (forming base-pairing hydrogen bonds under mammalian physiological conditions (or otherwise suitable in vivo or in vitro conditions) under certain standard conditions and to form a double-stranded or double-helical structure. Those skilled in the art will be able to select the set of conditions most appropriate for the hybridization assay. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs and, at least to the extent that the hybridization requirements described above are met, include native or modified nucleotides or nucleotide mimics. Sequence identity or complementarity is independent of modification. For example, for the purpose of determining identity or complementarity, a and Af, as defined herein, are complementary to U (or T) and identical to A.

[0032] As used herein, “completely complementary” or “perfectly complementary” means that in a hybridization pair of nucleobase or nucleotide sequences, all (100%) bases in the adjacent sequence of the first oligonucleotide hybridize with the same number of bases in the adjacent sequence of the second oligonucleotide. The adjacent sequence may contain all or part of the first or second nucleotide sequence.

[0033] As used herein, "partially complementary" means that in a hybridization pair of nucleobase or nucleotide sequences, at least 70% but not all of the bases in the adjacent sequence of the first oligonucleotide hybridizes with the same number of bases in the adjacent sequence of the second oligonucleotide. The adjacent sequence may contain all or part of the first or second nucleotide sequence.

[0034] As used herein, "substantially complementary" means that in a hybridization pair of nucleobase or nucleotide sequences, at least 85% but not all of the bases in the adjacent sequence of the first oligonucleotide hybridizes with the same number of bases in the adjacent sequence of the second oligonucleotide. The adjacent sequence may contain all or part of the first or second nucleotide sequence.

[0035] As used herein, the terms “complementary,” “fully complementary,” “partially complementary,” and “substantially complementary” refer to the nucleobase or nucleotide matching between the sense and antisense strands of the RNAi reagent, or between the antisense strand of the RNAi reagent and the TSLP mRNA sequence.

[0036] As used herein, when applied to nucleic acid sequences, the terms "substantially identical" or "substantially identical" mean that a nucleotide sequence (or a portion thereof) has at least about 85% sequence identity or more, such as at least 90%, at least 95%, or at least 99%, compared to a reference sequence. The percentage of sequence identity is determined by comparing two best-aligned sequences within a comparison window. The percentage is calculated by determining the number of positions in both sequences where the same type of nucleic acid base appears below them to arrive at the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity. The invention disclosed herein covers nucleotide sequences substantially identical to the nucleotide sequences disclosed herein.

[0037] As used herein, the terms “treat,” “treatment,” etc., refer to a method or procedure taken to provide relief or reduction of the number, severity, and / or frequency of one or more disease symptoms in a subject. As used herein, “treat” and “treatment” may include prevention, management, preventive treatment, and / or suppression or reduction of the number, severity, and / or frequency of one or more disease symptoms in a subject.

[0038] As used herein, when referring to RNAi reagents, the phrase “introduced into cells” means the functional delivery of the RNAi reagent into cells. The phrase “functional delivery” means the delivery of the RNAi reagent into cells in a manner that enables it to have the expected biological activity, such as sequence-specific inhibition of gene expression.

[0039] Unless otherwise stated, symbols are used as in this document. The use of "it" means that any one or more groups may be attached to it within the scope of the invention as described herein.

[0040] As used herein, the term "isomer" refers to a compound that has the same molecular formula but differs in the bonding order or properties of its atoms or in the spatial arrangement of its atoms. Isomers with different spatial arrangements of atoms are called "stereoisomers." Stereoisomers that are not mirror images of each other are called "diastereomers," and stereoisomers that are non-overlapping mirror images are called "enantiomers," or sometimes optical isomers. The carbon atom bonded to four different substituents is called a "chiral center."

[0041] As used herein, for each structure containing an asymmetric center and thus producing enantiomers, diastereomers, or other stereoisomers, each structure disclosed herein is intended to represent all such possible isomers, including their optically pure and racemic forms, unless specifically identified as having a particular conformation in the structure. For example, the structures disclosed herein are intended to cover mixtures of diastereomers and single stereoisomers.

[0042] As used in the claims herein, the phrase “consisting of” excludes any element, step, or ingredient not specified in the claims. When used in the claims herein, the phrase “consisting substantially of” limits the scope of the claims to the specified materials or steps, and those materials or steps that do not substantially affect the essential and novel features of the invention.

[0043] It will be readily understood and appreciated by those skilled in the art that the compounds and compositions disclosed herein may have certain atoms (e.g., N, O, or S atoms) in a protonated or deprotonated state, depending on the environment in which the compound or composition is placed. Accordingly, as used herein, the structures disclosed contemplate certain functional groups, such as OH, SH, or NH, which may be protonated or deprotonated. As will be readily understood by those skilled in the art, the disclosure herein is intended to cover the disclosed compounds and compositions regardless of their protonated state based on the environment (e.g., pH). Accordingly, compounds described herein having unstable protons or basic atoms should also be understood to represent salt forms of the respective compounds. The compounds described herein may be in the form of free acids, free bases, or salts. Pharmaceutically acceptable salts of the compounds described herein should be understood to be within the scope of this invention.

[0044] As used herein, when referring to a connection between two compounds or molecules, the terms “connected” or “combined” mean that the two compounds or molecules are joined by a covalent bond. Unless otherwise stated, as used herein, the terms “connected” and “combined” may refer to a connection between a first compound and a second compound, with or without any intermediate atoms or groups of atoms.

[0045] As used herein, the term “including” is used to mean the phrase “including but not limited to” and is interchangeable with the phrase “including but not limited to”. Unless the context clearly indicates otherwise, the term “or” is used herein to mean the term “and / or” and is interchangeable with the term “and / or”.

[0046] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While suitable methods and materials are described below, similar or equivalent methods and materials may be used in the practice or testing of this invention. All publications, patent applications, patents, and other references mentioned herein are incorporated herein by reference in their entirety. In case of conflict, the definitions included in this specification shall prevail. Furthermore, materials, methods, and examples are illustrative only and are not intended to be limiting.

[0047] Other objects, features, aspects, and advantages of the invention will become apparent from the following detailed description, accompanying drawings, and claims. Brief description of the attached diagram Figure 1 The chemical structure of the tridentate αvβ6 epithelial cell targeting ligand, referred to in this paper as Tri-SM6.1-αvb6-(TA14), is represented.

[0049] Figure 2 A graph was plotted showing the reduction of hTSLP protein in the lungs of AAV-transduced mice by certain TSLP RNAi reagents tested (see also Example 5).

[0050] Figure 3A and Figure 3B A graph was plotted showing the reduction of hTSLP protein in AAV-transduced mouse lungs using the tested RNAi reagent (see also Example 7). Protein expression was analyzed on separate plates (plate 1 shown). Figure 3A In the middle; panel 2 is displayed at Figure 3B (in the middle); the same control is used for both plates.

[0051] Figure 4A , Figure 4B and Figure 4C The decrease in lung TSLP mRNA in rats treated with TSLP RNAi reagent was plotted. Figure 4A A graph showing the inflammatory cell counts of BAL and eosinophils in the BAL sample. Figure 4B ) and total BAL cells ( Figure 4C (See also Example 10)

[0052] Figure 5A , Figure 5B and Figure 5C The levels of TSLP in rats treated with rat-specific TSLP RNAi reagent were plotted. Figure 5A ), IL-13 Figure 5B ) and IL-33 ( Figure 5C A graph of lung mRNA levels (see also Example 3).

[0053] Figure 5D , Figure 5E and Figure 5F The levels of BAL-soluble collagen in rats treated with rat-specific TSLP RNAi reagent were plotted. Figure 5D ), BAL IL-5 ( Figure 5E ) and BAL IL-13 ( Figure 5F The diagram (see also Example 3).

[0054] Figure 6A , Figure 6B and Figure 6C The human TSLP mRNA in the transduced mouse lungs was mapped. Figure 6A ), human TSLP protein in the lungs of mice transduced with AAV ( Figure 6B ), and human TSLP protein in the serum of AAV-transduced mice ( Figure 6C (See also Example 11).

[0055] Figure 7 A graph of human TSLP protein in the lungs of AAV-transduced mice was plotted (see also Example 15).

[0056] Figure 8 A graph of human TSLP protein in the lungs of AAV-transduced mice was plotted (see also Example 16).

[0057] Figure 9A and Figure 9B AAV-transduced mouse lungs were plotted. Figure 9A ) and mouse serum ( Figure 9B A graph of human TSLP protein in (see also Example 18).

[0058] Figure 10A and Figure 10B AAV-transduced mouse lungs were plotted. Figure 10A ) and mouse serum ( Figure 10B A chart of human TSLP protein in (see also Example 19).

[0059] Figure 11A and Figure 11B AAV-transduced mouse lungs were plotted. Figure 11A ) and mouse serum ( Figure 11BA diagram of human TSLP protein in (see also Example 25).

[0060] Figure 12A and Figure 12B AAV-transduced mouse lungs were plotted. Figure 12A ) and mouse serum ( Figure 12B A graph of human TSLP protein in (see also Example 26). Invention Details RNAi reagents This document describes RNAi reagents (referred to herein as TSLP RNAi reagents or TSLP RNAi triggers) for inhibiting TSLP gene expression. Each TSLP RNAi reagent disclosed herein comprises a sense strand and an antisense strand. The sense strand can be 12 to 49 nucleotides in length. The antisense strand can be 18 to 49 nucleotides in length. The sense strand and antisense strand can be the same length, or they can be different lengths. In some embodiments, the sense strand and antisense strand are each independently 18 to 27 nucleotides in length. In some embodiments, the sense strand and antisense strand are each 21 to 26 nucleotides in length. In some embodiments, the sense strand and antisense strand are each 21 to 24 nucleotides in length. In some embodiments, the sense strand and antisense strand are each independently 19 to 21 nucleotides in length. In some embodiments, the sense strand is about 19 nucleotides in length, and the antisense strand is about 21 nucleotides in length. In some embodiments, the sense strand is about 21 nucleotides in length, and the antisense strand is about 23 nucleotides in length. In some embodiments, the sense strand is 23 nucleotides long and the antisense strand is 21 nucleotides long. In some embodiments, both the sense strand and the antisense strand are 21 nucleotides long. In some embodiments, the sense strand of the RNAi reagent is independently 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides long. In some embodiments, the antisense strand of the RNAi reagent is independently 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides long. In some embodiments, the RNAi reagent is double-stranded and has a double-strand length of about 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides.

[0062] Examples of nucleotide sequences for forming TSLP RNAi reagents are provided in Tables 2, 3, 4, 5, 6, and 10. Examples of duplexes of RNAi reagents including the sense and antisense sequences in Tables 2, 3, 4, 5, and 6 are shown in Tables 7A, 7B, 8, 9, and 10.

[0063] In some embodiments, the length of the region of complete complementarity, substantial complementarity, or partial complementarity between the sense and antisense strands is 16-26 nucleotides (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26) and is located at or near the 5' end of the antisense strand (e.g., this region may be separated from the 5' end of the antisense strand by 0, 1, 2, 3, or 4 nucleotides, which are incompletely complementary, substantially complementary, or partially complementary).

[0064] The sense strand of the TSLP RNAi reagent described herein comprises at least 12 consecutive nucleotides, which has at least 85% identity with the core sequence (also referred to herein as the "core segment" or "core sequence") of the same number of nucleotides in the TSLP mRNA. In some embodiments, the sense core sequence is 100% (completely) complementary to or at least about 85% (substantially) complementary to the core sequence in the antisense strand, and therefore, the sense core sequence is typically identical or at least about 85% identical to a nucleotide sequence of the same length present in the TSLP mRNA target (sometimes referred to, for example, as the target sequence). In some embodiments, the length of the sense core is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides. In some embodiments, the length of the sense core is 17 nucleotides. In some embodiments, the length of the sense core is 19 nucleotides. In some embodiments, the length of the sense core is 21 nucleotides.

[0065] The antisense strand of the TSLP RNAi reagent described herein comprises at least 15 consecutive nucleotides, which is at least 85% complementary to the core segment of the same number of nucleotides in the TSLP mRNA and the core segment of the corresponding sense strand. In some embodiments, the antisense strand core segment is 100% (completely) complementary or at least about 85% (substantially) complementary to a nucleotide sequence of the same length present in the TSLP mRNA target (e.g., the target sequence). In some embodiments, the length of the antisense strand core segment is 17, 18, 19, 20, 21, 22, or 23 nucleotides. In some embodiments, the length of the antisense strand core segment is 19 nucleotides. In some embodiments, the length of the antisense strand core segment is 17 nucleotides. The sense strand core segment sequence may be the same length as the corresponding antisense core sequence, or it may be a different length.

[0066] The sense and antisense strands of the TSLP RNAi reagent are annealed to form a doublet. The sense and antisense strands of the TSLP RNAi reagent can be partially, substantially, or completely complementary to each other. Within the complementary doublet region, the sense core sequence is at least 85% or 100% complementary to the antisense core sequence. In some implementations, the sense core sequence contains a sequence of at least 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides, which is at least 85% or 100% complementary to the corresponding 16, 17, 18, 19, 20, 21, 22, or 23 nucleotide sequence of the antisense core sequence (i.e., the sense and antisense core sequences of the TSLP RNAi reagent have regions of at least 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides, which are at least 85% or 100% base-paired).

[0067] In some embodiments, the antisense strand of the TSLP RNAi reagent disclosed herein differs from any antisense strand sequence in Table 2 or Table 3 by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of the TSLP RNAi reagent disclosed herein differs from any sense strand sequence in Table 2, Table 4, Table 5, Table 6, or Table 10 by 0, 1, 2, or 3 nucleotides.

[0068] In some embodiments, the sense strand and / or antisense strand may optionally and independently contain an additional 1, 2, 3, 4, 5, or 6 nucleotides (extensions) at the 3' end, 5' end, or both 3' and 5' ends of the core sequence. The additional nucleotides of the antisense strand (if present) may or may not be complementary to the corresponding sequence in the TSLP mRNA. The additional nucleotides of the sense strand (if present) may be identical or different from the corresponding sequence in the TSLP mRNA. The additional nucleotides of the antisense strand (if present) may or may not be complementary to the corresponding additional nucleotides of the sense strand (if present).

[0069] As used herein, the extension comprises 1, 2, 3, 4, 5, or 6 nucleotides at the 5' and / or 3' ends of the sense strand core sequence and / or antisense strand core sequence. The extended nucleotides on the sense strand may or may not be complementary to the corresponding nucleotides in the antisense strand (or core sequence nucleotides or extended nucleotides). Conversely, the extended nucleotides on the antisense strand may or may not be complementary to the corresponding nucleotides in the sense strand (or core sequence nucleotides or extended nucleotides). In some embodiments, both the sense and antisense strands of the RNAi reagent contain 3' and 5' extensions. In some embodiments, one or more 3' extended nucleotides of one strand are base-paired with one or more 5' extended nucleotides of the other strand. In other embodiments, one or more 3' extended nucleotides of one strand are not base-paired with one or more 5' extended nucleotides of the other strand. In some embodiments, the TSLP RNAi reagent has an antisense strand containing a 3' extension and a sense strand containing a 5' extension. In some embodiments, the extended nucleotides are unpaired and form overhangs. As used herein, “protruding end” refers to one or more unpaired nucleotide segments located at the end of the sense or antisense strand that do not form part of the hybrid or double-stranded portion of the RNAi reagent disclosed herein (see, for example, U.S. Patent No. 8,362,231).

[0070] In some embodiments, the TSLP RNAi reagent comprises a 3' extended antisense strand having a length of 1, 2, 3, 4, 5, or 6 nucleotides. In other embodiments, the TSLP RNAi reagent comprises a 3' extended antisense strand having a length of 1, 2, or 3 nucleotides. In some embodiments, one or more antisense extended nucleotides comprise nucleotides complementary to the corresponding TSLP mRNA sequence. In some embodiments, one or more antisense extended nucleotides comprise nucleotides not complementary to the corresponding TSLP mRNA sequence.

[0071] In some embodiments, the TSLP RNAi reagent comprises a 3' extended sense strand having a length of 1, 2, 3, 4, or 5 nucleotides. In some embodiments, one or more sense strand extending nucleotides comprise adenosine, uracil, or thymidine nucleotides, AT dinucleotides, or nucleotides corresponding to or identical to nucleotides in the TSLP mRNA sequence. In some embodiments, the 3' sense strand extension comprises, but is not limited to, one of the following sequences: T, UT, TT, UU, UUT, TTT, or TTTT (each listed from 5' to 3').

[0072] The sense strand may have a 3′ extension and / or a 5′ extension. In some embodiments, the TSLP RNAi reagent comprises a sense strand with a 5′ extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In some embodiments, one or more sense strand extension nucleotides comprise nucleotides that correspond to or are identical to nucleotides in the TSLP mRNA sequence.

[0073] Examples of sequences for forming TSLP RNAi reagents are provided in Tables 2, 3, 4, 5, 6, and 10. In some embodiments, the antisense strand of the TSLP RNAi reagent comprises any sequence from Tables 2, 3, or 10. In some embodiments, the antisense strand of the TSLP RNAi reagent comprises, or is composed of, any of the modified sequences in Table 3. In some embodiments, the antisense strand of the TSLP RNAi reagent comprises nucleotides (5' → 3') 1-17, 2-15, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, or 2-21 from any sequence in Tables 2 or 3. In some embodiments, the sense strand of the TSLP RNAi reagent comprises any sequence from Tables 2, 4, 5, or 6. In some embodiments, the sense strand of the TSLP RNAi reagent comprises any of the nucleotide (5' to 3') sequences 1-18, 1-19, 1-20, 1-21, 2-19, 2-20, 2-21, 3-20, 3-21, or 4-21 from any of the sequences in Tables 2, 4, 5, or 6. In some embodiments, the sense strand of the TSLP RNAi reagent comprises, or is composed of, any of the modified sequences in Tables 4, 5, 6, or 10.

[0074] In some embodiments, the sense and antisense strands of the RNAi reagent described herein contain the same number of nucleotides. In some embodiments, the sense and antisense strands of the RNAi reagent described herein contain different numbers of nucleotides. In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of the RNAi reagent form blunt ends. In some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of the RNAi reagent form blunt ends. In some embodiments, both ends of the RNAi reagent form blunt ends. In some embodiments, neither end of the RNAi reagent is blunt. As used herein, "blunt end" refers to the end of a double-stranded RNAi reagent in which the terminal nucleotides of the two annealed strands are complementary (forming complementary base pairs).

[0075] In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of the RNAi reagent form a frayed end. In some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of the RNAi reagent form a frayed end. In some embodiments, both ends of the RNAi reagent form frayed ends. In some embodiments, neither end of the RNAi reagent is a frayed end. As used herein, a frayed end refers to the end of a double-stranded RNAi reagent where the terminal nucleotides of the two annealed strands form a pair (i.e., no overhang) but are not complementary (i.e., form a non-complementary pair). In some embodiments, one or more unpaired nucleotides at the end of one strand of the double-stranded RNAi reagent form an overhang. The unpaired nucleotides may be on the sense strand or the antisense strand, creating a 3' or 5' overhang. In some implementations, the RNAi reagent contains: a blunt end and a folded end, a blunt end and a 5' overhang, a blunt end and a 3' overhang, a folded end and a 5' overhang, a folded end and a 3' overhang, two 5' overhangs, two 3' overhangs, a 5' overhang and a 3' overhang, two folded ends, or two blunt ends. Typically, when present, the overhangs are located at the 3' end of the sense strand, the antisense strand, or both the sense and antisense strands.

[0076] The TSLP RNAi reagents disclosed herein may also consist of one or more modified nucleotides. In some embodiments, substantially all nucleotides of the sense strand and substantially all nucleotides of the antisense strand of the TSLP RNAi reagent are modified nucleotides. The TSLP RNAi reagents disclosed herein may further comprise one or more modified internucleotide bonds, such as one or more phosphate thioester bonds. In some embodiments, the TSLP RNAi reagent contains one or more modified nucleotides and one or more modified internucleotide bonds. In some embodiments, 2'-modified nucleotides are combined with modified internucleotide bonds.

[0077] In some embodiments, the TSLP RNAi reagent is prepared or provided as a salt, a mixed salt, or a free acid. In some embodiments, the TSLP RNAi reagent is prepared as a pharmaceutically acceptable salt. In some embodiments, the TSLP RNAi reagent is prepared as a pharmaceutically acceptable sodium salt. Such forms, well known in the art, are within the scope of the invention disclosed herein.

[0078] Modified nucleotides When used in various oligonucleotide constructs, the modified nucleotides can preserve the activity of the compound in cells, while increasing the serum stability of these compounds, and can also minimize the possibility of activating interferon activity in humans after administration of the oligonucleotide construct.

[0079] In some embodiments, the TSLP RNAi reagent contains one or more modified nucleotides. As used herein, a “modified nucleotide” is a nucleotide other than a ribonucleotide (2’-hydroxynucleotide). In some embodiments, at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%) of the nucleotides are modified nucleotides. As used herein, modified nucleotides may include, but are not limited to, deoxyribonucleotides, nucleotide mimics, debased nucleotides, 2'-modified nucleotides, 3'-modified nucleotides (2'-nucleoside linked), reverse nucleotides, nucleotides containing modified nucleotides, bridged nucleotides, peptide nucleic acids (PNAs), 2',3'-seco nucleotide mimics (unlocked nucleotide analogs), locked nucleotides, 3'-O-methoxy (2'-nucleoside linked) nucleotides, 2'-F-arabinonucleotides, 5'-methyl-2'-fluoronucleotides, morpholinonucleotides (modified nucleotides with a morpholino ring), nucleotides in which the typical 5-membered sugar ring of the nucleotide has been modified, vinylphosphonate deoxyribonucleotides, vinylphosphonate-containing nucleotides, and cyclopropylphosphonate-containing nucleotides. 2'-Modified nucleotides (i.e., nucleotides having a group other than a hydroxyl group at the 2' position of the five-membered sugar ring) include, but are not limited to, 2'-O-methyl nucleotides (also known as 2'-methoxynucleotides), 2'-fluoronucleotides (also known as 2'-deoxy-2'-fluoronucleotides), 2'-deoxynucleotides, 2'-methoxyethyl (2'-O-2-methoxyethyl) nucleotides (also known as 2'-MOE nucleotides), 2'-aminonucleotides, 2'-halogenated nucleotides, and 2'-alkyl nucleotides. All positions in a given compound need not be uniformly modified. Instead, more than one modification can be incorporated into a single TSLP RNAi reagent, or even into a single nucleotide. The sense and antisense strands of a TSLP RNAi reagent can be synthesized and / or modified using methods known in the art. Modification at one nucleotide does not depend on modification at another nucleotide.

[0080] Modified nucleobases include synthetic and natural nucleobases, such as 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines (e.g., 2-aminopropyladenine, 5-propynyluracil, or 5-propynylcytosine), 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, inosine, xanthine, hypoxanthine, 6-alkyl (e.g., 6-methyl, 6-ethyl, 6-isopropyl, or 6-n-butyl) derivatives of 2-aminoadenine, adenine, and guanine, 2-alkyl (e.g., 2-methyl, 2-ethyl, 2-isopropyl, or 2-n-butyl) derivatives of adenine and guanine, and other alkyl derivatives, 2-thiouracil, 2- Thiothymine, 2-thiocytosine, 5-halogenated uracil, cytosine, 5-propynyluracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halogenated, 8-amino, 8-mercapto, 8-thioalkyl, 8-hydroxy and other 8-substituted adenine and guanine, 5-halogenated (e.g., 5-bromo), 5-trifluoromethyl and other 5-substituted uracil and cytosine, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazoguanine, 7-deazoadenine, 3-deazoguanine and 3-deazoadenine.

[0081] In some embodiments, the 5' and / or 3' ends of the antisense strand may include a debase residue (Ab), which may also be referred to as a "debase site" or "debase nucleotide." A debase residue (Ab) is a nucleotide or nucleoside lacking a nucleotide base at the 1' position of the sugar moiety (see, for example, U.S. Patent No. 5,998,203). In some embodiments, the debase residue may be placed inside the nucleotide sequence. In some embodiments, Ab or AbAb may be added to the 3' end of the antisense strand. In some embodiments, the 5' end of the sense strand may include one or more additional debase residues (e.g., (Ab) or (AbAb)). In some embodiments, UUAb, UAb, or Ab is added to the 3' end of the sense strand. In some embodiments, the debase (deoxyribose) residue may be replaced with a ribitol (debase ribose) residue.

[0082] In some embodiments, all or substantially all nucleotides of the RNAi reagent are modified nucleotides. An RNAi reagent in which substantially all nucleotides present are modified nucleotides, as used herein, is an RNAi reagent in which four or fewer (i.e., 0, 1, 2, 3, or 4) nucleotides in both the sense and antisense strands are ribonucleotides (i.e., unmodified). A sense strand in which substantially all nucleotides present are modified nucleotides, as used herein, is a sense strand in which two or fewer (i.e., 0, 1, or 2) nucleotides in the sense strand are unmodified ribonucleotides. An antisense strand in which substantially all nucleotides present are modified nucleotides, as used herein, is an antisense strand in which two or fewer (i.e., 0, 1, or 2) nucleotides in the sense strand are unmodified ribonucleotides. In some embodiments, one or more nucleotides of the RNAi reagent are unmodified ribonucleotides. The chemical structures of certain modified nucleotides are described in Table 11 herein.

[0083] Modified internucleotide bonds In some embodiments, one or more nucleotides of the TSLP RNAi reagent are linked by non-standard bonding or a backbone (i.e., modified internucleotide bonding or a modified backbone). Modified internucleotide bonding or a backbone includes, but is not limited to, thiophosphate groups (represented herein as lowercase "s"), chiral thiophosphates, thiophosphates, dithiophosphates, phosphate triesters, aminoalkyl-phosphate triesters, alkylphosphonates (e.g., methylphosphonates or 3'-alkylenephosphonates), chiral phosphonates, hypophosphonates, aminophosphates (e.g., 3'-aminoaminophosphates, aminoalkylaminophosphates, or thiocarbonylaminophosphates), thiocarbonylalkylphosphonates, thiocarbonylalkylphosphate triesters, morpholino bonding, borane phosphates with normal 3'-5' bonding, analogs of 2'-5' linked borane phosphates, or borane phosphates with reverse polarity, wherein adjacent nucleoside unit pairs link 3'-5' to 5'-3' or 2'-5' to 5'-2'. In some embodiments, the modified internucleotide bonds or backbone lack phosphorus atoms. Modified internucleotide bonds lacking phosphorus atoms include, but are not limited to, bonds between short-chain alkyl or cycloalkyl sugars, mixed heteroatom and alkyl or cycloalkyl sugar bonds, or bonds between one or more short-chain heteroatoms or heterocyclic sugars. In some embodiments, the modified internucleotide backbone includes, but is not limited to, siloxane backbones, sulfide backbones, sulfone backbones, methylacetyl and thiomethylacetyl backbones, methylenemethylacetyl and thiomethylacetyl backbones, olefin-containing backbones, aminosulfonate backbones, methyleneimino and methylenehydrazine backbones, sulfonate and sulfonamide backbones, amide backbones, and other backbones having mixed N, O, S, and CH2 components.

[0084] In some embodiments, the sense strand of the TSLP RNAi reagent may contain 1, 2, 3, 4, 5, or 6 phosphate thioester bonds, and the antisense strand of the TSLP RNAi reagent may contain 1, 2, 3, 4, 5, or 6 phosphate thioester bonds, or both the sense and antisense strands may independently contain 1, 2, 3, 4, 5, or 6 phosphate thioester bonds. In some embodiments, the sense strand of the TSLP RNAi reagent may contain 1, 2, 3, or 4 phosphate thioester bonds, and the antisense strand of the TSLP RNAi reagent may contain 1, 2, 3, or 4 phosphate thioester bonds, or both the sense and antisense strands may independently contain 1, 2, 3, or 4 phosphate thioester bonds.

[0085] In some embodiments, the sense strand of the TSLP RNAi reagent contains at least two phosphate-thioester nucleoside bonds. In some embodiments, the phosphate-thioester nucleoside bonds are located between nucleotides at positions 1-3 starting from the 3' end of the sense strand. In some embodiments, one phosphate-thioester nucleoside bond is located at the 5' end of the sense strand nucleotide sequence, and another phosphate-thioester bond is located at the 3' end of the sense strand nucleotide sequence. In some embodiments, two phosphate-thioester nucleoside bonds are located at the 5' end of the sense strand, and another phosphate-thioester bond is located at the 3' end of the sense strand. In some embodiments, the sense strand does not include any phosphate-thioester nucleoside bonds between nucleotides, but contains one, two, or three phosphate-thioester bonds between terminal nucleotides at both the 5' and 3' ends and optionally present reverse debasement residues at the end cap. In some embodiments, the targeting ligand is linked to the sense strand via phosphate-thioester bonds.

[0086] In some embodiments, the antisense strand of the TSLP RNAi reagent contains four phosphate-thioester nucleoside bonds. In some embodiments, the four phosphate-thioester nucleoside bonds are between nucleotides at positions 1-3 starting from the 5' end of the antisense strand, and between nucleotides at positions 19-21, 20-22, 21-23, 22-24, 23-25, or 24-26 starting from the 5' end. In some embodiments, three phosphate-thioester nucleoside bonds are located between positions 1-4 starting from the 5' end of the antisense strand, and a fourth phosphate-thioester nucleoside bond is located between positions 20-21 starting from the 5' end of the antisense strand. In some embodiments, the TSLP RNAi reagent contains at least three or four phosphate-thioester nucleoside bonds in the antisense strand.

[0087] Capped residues or parts In some embodiments, the sense strand may include one or more capping residues or portions, sometimes referred to in the art as “cap,” “terminal cap,” or “capped residue.” As used herein, a “capped residue” is a nonnucleotide compound or other portion that may be incorporated at one or more ends of the nucleotide sequence of the RNAi reagent disclosed herein. In some cases, the capping residue may be to provide certain beneficial properties to the RNAi reagent, such as protection against exonuclease degradation. In some embodiments, an inverse debasement residue (invAb) (also referred to in the art as a “inverse debasement site”) is added as a capping residue (see Table 11). (See, for example, F. Czauderna, Nucleic Acids Res., 2003, 31(11), 2705-16). Capping residues are generally known in the art and include, for example, inverse debasement residues and carbon chains, such as terminal C3H7 (propyl), C6H… 13 (Hexyl) or C 12 H 25 (Dodecyl) group. In some embodiments, the capping residue is present at the 5' end, 3' end, or both the 5' and 3' ends of the sense chain. In some embodiments, the 5' end and / or 3' end of the sense chain may include more than one reverse debased deoxyribose moiety as a capping residue.

[0088] In some embodiments, one or more inverse debase residues (invAbs) are added to the 3' end of the sense strand. In some embodiments, one or more inverse debase residues (invAbs) are added to the 5' end of the sense strand. In some embodiments, one or more inverse debase residues or inverse debase sites are inserted between the nucleotide sequences of the sense strand of the targeting ligand and the RNAi reagent. In some embodiments, one or more inverse debase residues or inverse debase sites are included at or near one or more ends of the sense strand of the RNAi reagent, allowing for enhanced activity or other desired properties of the RNAi reagent.

[0089] In some embodiments, one or more inverse debase residues (invAb) are added to the 5' end of the sense strand. In some embodiments, one or more inverse debase residues may be inserted between the nucleotide sequences of the sense strand of the targeting ligand and the RNAi reagent. The inverse debase residues may be linked via phosphate esters, thiophosphate esters (e.g., shown herein as (invAb)s), or other nucleoside-to-nucleotide linkages. In some embodiments, including one or more inverse debase residues at or near one or more ends of the sense strand of the RNAi reagent may allow for enhanced activity or other desired properties of the RNAi reagent. In some embodiments, the inverse debase (deoxyribose) residue may be replaced with an inverse ribitol (debase ribose) residue. In some embodiments, the 3' end of the antisense core sequence or the 3' end of the antisense sequence may include an inverse debase residue. The chemical structures of the inverse debase deoxyribose residues are shown in Table 11 below.

[0090] TSLP RNAi reagent The TSLP RNAi reagents disclosed herein are designed to target a specific location on the TSLP gene (e.g., SEQ ID NO:1 (NM_0033035.5)). As defined herein, an antisense strand sequence is designed to target the TSLP gene at a given location on the gene when the 5' terminal nucleobase of the antisense strand is aligned with a position 21 nucleotides downstream (towards the 3' end) from the location on the gene. For example, as shown in Tables 1 and 2 herein, an antisense strand sequence designed to target the TSLP gene at position 571 requires that, when paired with the gene bases, the 5' terminal nucleobase of the antisense strand is aligned with position 591 of the TSLP gene.

[0091] As provided in this article, the TSLP RNAi reagent does not require the antisense strand to be at position 1 (5′). The nucleobase at position 3′ is complementary to the gene, provided that the antisense strand and the gene, spanning a core segment sequence of at least 16 consecutive nucleotides, have at least 85% complementarity (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity). For example, for the TSLP RNAi reagent disclosed herein designed to target position 571 of the TSLP gene, the 5' nucleotide of the antisense strand of the TSLP RNAi reagent must be aligned with position 591 of the gene; however, the 5' nucleotide of the antisense strand may, but is not required to, be complementary to position 591 of the TSLP gene, provided that the antisense strand and the gene transcript spanning at least 16 consecutive nucleotides have at least 85% complementarity (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity). As particularly shown by the various examples disclosed herein, the specific binding site of the gene via the antisense strand of the TSLP RNAi reagent (e.g., whether the TSLP RNAi reagent is designed to target the TSLP gene at position 571, position 520, position 570, or some other position) is an important factor for the level of inhibition and off-target effects (e.g., potential safety concerns) achieved by the TSLP RNAi reagent. (See, for example, Kamola et al.) The siRNA Non- seed Region and Its Target Sequences are Auxiliary Determinants of Off-Target Effects PLOS Computational Biology, 11(12), Figure 1 (2015)).

[0092] In some embodiments, the TSLP RNAi reagent disclosed herein targets the TSLP gene at or near the location of the TSLP sequence shown in Table 1. In some embodiments, the antisense strand of the TSLP RNAi reagent disclosed herein includes a core sequence that is fully complementary, substantially complementary, or at least partially complementary to the TSLP 19-mer sequence disclosed in Table 1.

[0093] Table 1. TSLP 19-mer mRNA target sequences (derived from Homo sapiens) homo sapiens Thymic stromal lymphopoietin (TSLP) transcript variant 1, GenBank NM_033035.5 (SEQ ID NO:1) .

[0094] Human thymic stromal lymphopoietin (TSLP) transcript variant 1, GenBank NM_033035.5, gene transcript (2610 bases):

[0095] In some implementations, the TSLP RNAi reagent includes an antisense strand, wherein the antisense strand (5′) Position 19 of the 3′ can form a base pair with position 1 of the 19-mer target sequence disclosed in Table 1. In some embodiments, the TSLP reagent includes an antisense strand, wherein the antisense strand (5′) Position 1 of 3′ can form a base pair with position 19 of the 19-mer target sequence disclosed in Table 1.

[0096] In some implementations, the TSLP reagent includes an antisense strand, wherein the antisense strand (5′) Position 2 of the 3′ can form a base pair with position 18 of the 19-mer target sequence disclosed in Table 1. In some embodiments, the TSLP reagent includes an antisense strand, wherein the antisense strand (5′) Positions 2 to 18 of 3′ can each form a base pair with the corresponding complementary bases at positions 18 to 2 of the 19-mer target sequence disclosed in Table 1.

[0097] For the RNAi reagents disclosed in this paper, at the antisense strand (5' end) The nucleotide at position 1 (3' end) can be completely complementary to the TSLP gene, or it can be non-complementary to the TSLP gene. In some implementations, at position 1 (5' end) of the antisense strand... The nucleotide at position 1 (3' end) is U, A, or dT. In some embodiments, the nucleotide at position 1 (5' end) of the antisense strand is U, A, or dT. The nucleotide at position 1 (3' end) forms an A:U or U:A base pair with the sense strand.

[0098] In some implementations, the antisense strand of the TSLP RNAi reagent contains nucleotides (5' end) of any antisense strand sequence in Table 2 or Table 3. The 3' end) 2-18 or 2-19 sequence. In some embodiments, the TSLP RNAi sense strand contains nucleotides (5' end) of any sense strand sequence from Table 2, Table 4, Table 5, or Table 6. (3' end) Sequences of 1-17, 1-18 or 2-18.

[0099] In some implementations, the TSLP RNAi reagent consists of: (i) nucleotides (5' end) containing any antisense strand sequence from Table 2 or Table 3. (ii) antisense strands containing any sense strand sequence from the 3' end (2-18 or 2-19), and nucleotides containing any sense strand sequence from the 5' end of Tables 2, 4, 5, or 6. (3' end) A meaningful chain of sequences 1-17 or 1-18.

[0100] In some implementations, the TSLP RNAi reagent includes the core 19-mer nucleotide sequence shown in Table 2 below.

[0101] Table 2. Core sequence of the antisense and sense strands of the TSLP RNAi reagent

[0102] The sense and antisense strands of a TSLP RNAi reagent containing or composed of the nucleotide sequences in Table 2 may be modified or unmodified nucleotides. In some embodiments, a TSLP RNAi reagent having any of the nucleotide sequences in Table 2, or the sense and antisense strand sequences composed of them, is entirely or substantially entirely composed of modified nucleotides.

[0103] In some embodiments, the antisense strand of the TSLP RNAi reagent disclosed herein differs from any antisense strand sequence in Table 2 by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of the TSLP RNAi reagent disclosed herein differs from any sense strand sequence in Table 2 by 0, 1, 2, or 3 nucleotides.

[0104] As used herein, each N listed in the sequences disclosed in Table 2 may be independently selected from any and all nucleobases (including nucleobases found on both modified and unmodified nucleotides). In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have nucleobases complementary to the N nucleotides at the corresponding position on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have nucleobases not complementary to the N nucleotides at the corresponding position on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have the same nucleobases as the N nucleotides at the corresponding position on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have nucleobases different from the N nucleotides at the corresponding position on the other strand.

[0105] Tables 3, 4, 5, 6, and 10 provide the sense and antisense strands of certain modified TSLP RNAi reagents. Table 3 provides the antisense strands of certain modified TSLP RNAi reagents, along with their potential unmodified nucleotide sequences. Tables 4, 5, and 6 provide the sense strands of certain modified TSLP RNAi reagents, along with their potential unmodified nucleotide sequences. When forming TSLP RNAi reagents, each nucleotide in each potential sequence listed in Tables 3, 4, 5, and 6, as well as in Table 2 above, can be a modified nucleotide.

[0106] The TSLP RNAi reagent described herein is formed by annealing the antisense strand with the sense strand. A sense strand containing the sequences listed in Tables 2, 4, 5, or 6 can hybridize with any antisense strand containing the sequences listed in Table 2 or 3, provided that the two sequences have regions of at least 85% complementarity on adjacent 16, 17, 18, 19, 20, or 21 nucleotide sequences.

[0107] In some implementations, the antisense strand of the TSLP RNAi reagent contains the nucleotide sequence of any of the sequences in Table 2 or Table 3.

[0108] In some embodiments, the TSLP RNAi reagent comprises or consists of a double strand having the nucleobase sequences of the sense and antisense strands of any of the sequences in Tables 2, 3, 4, 5, 6, or 10.

[0109] Table 3 provides examples of antisense strands containing modified nucleotides. Tables 4, 5, and 6 provide examples of sense strands containing modified nucleotides.

[0110] As used in Tables 3, 4, 5, 6, and 10, the following symbols are used to indicate modified nucleotides, targeting groups, and linking groups: A = adenosine-3'-phosphate C = cytidine-3'-phosphate G = guanosine-3'-phosphate U = uridine 3'-phosphate I = Inosine 3'-phosphate a = 2'-O-methyladenosine-3'-phosphate as = 2'-O-methyladenosine-3'-thiophosphate c = 2'-O-methylcytidine-3'-phosphate cs = 2'-O-methylcytidine-3'-thiophosphate g = 2'-O-methylguanosine-3'-phosphate gs = 2'-O-methylguanosine-3'-thiophosphate i = 2'-O-methylinosine-3'-phosphate is = 2'-O-methylinosine-3'-thiophosphate t = 2'-O-methyl-5-methyluridine-3'-phosphate ts = 2'-O-methyl-5-methyluridine-3'-thiophosphate u = 2'-O-methyluridine-3'-phosphate us = 2'-O-methyluridine-3'-thiophosphate Af = 2'-fluoroadenosine-3'-phosphate Afs = 2'-Fluoroadenosine-3'-Thiophosphate Cf = 2'-Fluorocytidine-3'-phosphate Cfs = 2'-Fluorocytidine-3'-Thiophosphate Gf = 2'-Fluoroguanosine-3'-phosphate Gfs = 2'-Fluoroguanosine-3'-Thiophosphate Tf = 2'-fluoro-5'-methyluridine-3'-phosphate Tfs = 2'-fluoro-5'-methyluridine-3'-thiophosphate Uf = 2'-fluorouridine-3'-phosphate Ufs = 2'-fluorouridine-3'-thiophosphate dT = 2'-deoxythymidine-3'-phosphate dTs = 2′-deoxythymidine-3′-thiophosphate dA = 2′-deoxyadenosine-3′-phosphate dAs = 2′-deoxyadenosine-3′-thiophosphate dC = 2′-deoxycytidine-3′-phosphate dCs = 2′-deoxycytidine-3′-thiophosphate dG = 2′-deoxyguanosine-3′-phosphate dGs = 2′-deoxyguanosine-3′-thiophosphate A UNA = 2',3'-open-ring-adenosine-3'-phosphate A UNA s = 2',3'-open-ring-adenosine-3'-thiophosphate C UNA = 2',3'-Octopylated Cytidine-3'-phosphate C UNA s = 2',3'-open-ring-cytidine-3'-thiophosphate G UNA = 2',3'-Octopylated guanosine 3'-phosphate G UNA s = 2',3'-open-ring-guanosine 3'-thiophosphate U UNA = 2',3'-Open-ring-uridine-3'-phosphate U UNA s = 2',3'-open-ring-uridine-3'-thiophosphate a_2N = 2′-O-methyl-2-aminoadenosine-3′-phosphate, see Table 11 a_2Ns = 2′-O-methyl-2-aminoadenosine-3′-thiophosphate, see Table 11 (invAb) = reverse debasing deoxyribonucleotide-5'-phosphate, see Table 11 (invAb)s = reverse debased deoxyribonucleotide-5'-thiophosphate ester, see Table 11 s = thiophosphate bond ss = dithiophosphate bond p = terminal phosphate ester (during synthesis) vpdN = vinylphosphonate deoxyribonucleotide cPrpa = 5'-cyclopropylphosphonate-2'-O-methyladenosine-3'-phosphate (see Table 11) cPrpas = 5'-cyclopropylphosphonate-2'-O-methyladenosine-3'-thiophosphate (see Table 11) cPrpu = 5'-cyclopropylphosphonate-2'-O-methyluridine-3'-phosphate (see Table 11) cPrpus = 5'-cyclopropylphosphonate-2'-O-methyluridine-3'-thiophosphate (see Table 11) cPrpi = 5'-cyclopropylphosphonate-2′-O-methylinosine-3′-phosphate (see Table 11) cPrpis = 5'-cyclopropylphosphonate-2′-O-methylinosine-3′-thiophosphate (see Table 11) (C6-SS-C6) = See Table 11 (6-SS-6) = See Table 11 (NH2-C6) = See Table 11 (NH2-C6)s = See Table 11 (TriAlk14) = See Table 11 (TriAlk14)s = See Table 11 -C6- = See Table 11 -C6s- = See Table 11 -L6-C6- = See Table 11 -L6-C6s- = See Table 11 (TA14) = See Table 11 (Structure of the combined (TriAlk14)s) (TA14)s = See Table 11 (Structure of the combined (TriAlk14)s) TGNA = Thymidine diol nucleic acid, see Table 11.

[0111] As will be readily understood by those skilled in the art, unless otherwise indicated by the sequence (e.g., via phosphate thioester bonds "s"), when present in oligonucleotides, nucleotide monomers are linked to each other by 5'-3'-phosphodiester bonds. As will be clearly understood by those skilled in the art, as shown in the modified nucleotide sequences disclosed herein, phosphate thioester bonds replace the phosphodiester bonds typically present in oligonucleotides. Further, it will be readily understood by those skilled in the art that the terminal nucleotide at the 3' end of a given oligonucleotide sequence typically has a hydroxyl group (-OH) rather than an isolated phosphate moiety at the corresponding 3' position of the given monomer. Additionally, for the embodiments disclosed herein, when observing the corresponding chain 5'→3', a reverse debasement residue is inserted such that the 3' position of the deoxyribose is linked at the 3' end of the previous monomer on the corresponding chain (see, for example, Table 11). Furthermore, as will be readily understood and appreciated by those skilled in the art, although the thiophosphate chemical structures depicted herein typically show an anion on the sulfur atom, the present invention disclosed herein covers all thiophosphate tautomers (e.g., where the sulfur atom has a double bond and the anion is on the oxygen atom). Unless otherwise expressly stated herein, this understanding is used when describing the TSLP RNAi reagents and compositions thereof disclosed herein.

[0112] Examples of targeting and linking groups that can be used with the TSLP RNAi reagents disclosed herein are included in the chemical structures provided in Table 11 below. Each sense strand and / or antisense strand may have any of the targeting or linking groups listed herein that are conjugated to the 5' and / or 3' ends of the sequence, as well as other targeting or linking groups.

[0113] The TSLP RNAi reagent disclosed herein is formed by annealing the antisense strand with the sense strand. A sense strand containing the sequences listed in Tables 2, 4, 5, or 6 can hybridize with any antisense strand containing the sequences listed in Table 2 or 3, provided that the two sequences have regions of at least 85% complementarity on adjacent 16, 17, 18, 19, 20, or 21 nucleotide sequences.

[0114] As shown in Table 5 above, some example TSLP RNAi reagent nucleotide sequences are shown to further include reactive linker groups at one or both of the 5' and 3' ends of the sense strand. For example, many of the TSLP RNAi reagents shown in Table 5 above have a (TriAlk14) linker group at the 5' end of the nucleotide sequence. In some embodiments, other linker groups may also be present or alternatively present, such as (NH2-C6) linker groups or (6-SS-6) or (C6-SS-C6) linker groups. Such reactive linker groups are positioned to facilitate the connection of targeting ligands, targeting groups, and / or PK / PD modulators to the TSLP RNAi reagents disclosed herein. Linkage or conjugation reactions are well known in the art and provide for the formation of covalent bonds between two molecules or reactants. Suitable conjugation reactions used within the scope of this invention include, but are not limited to, amide coupling reactions, Michael addition reactions, hydrazone formation reactions, inverse-demand Diels-Alder cycloaddition reactions, oxime linkages, and copper (I)-catalyzed or strain-promoted azide-alkyne cycloaddition reactions.

[0115] In some embodiments, the targeting ligand, such as the integrin targeting ligands disclosed herein and illustrated in the figures, can be synthesized as an activated ester, such as a tetrafluorophenyl (TFP) ester, which can be replaced by a reactive amino group (e.g., NH2-C6) to attach the targeting ligand to the TSLP RNAi reagent disclosed herein. In some embodiments, the targeting ligand is synthesized as an azide, which can be conjugated to a propargyl (e.g., TriAlk14) or DBCO group, for example via a copper (I)-catalyzed or strain-promoted azide-alkyne cycloaddition reaction.

[0116] Additionally, certain nucleotide sequences can be synthesized as dT nucleotides with a 3' end at the sense strand, followed by (3' 5') Linker (e.g., C6-SS-C6). In some embodiments, the linker can facilitate binding to other components such as PK / PD modulators or one or more targeting ligands. As described herein, the disulfide bond of C6-SS-C6 is first reduced to remove dT from the molecule, which can then facilitate conjugation to the desired PK / PD modulator. Therefore, the terminal dT nucleotide is not part of the fully conjugated construct.

[0117] In some embodiments, the antisense strand of the TSLP RNAi reagent disclosed herein differs from any antisense strand sequence in Table 3 or Table 10 by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of the TSLP RNAi reagent disclosed herein differs from any sense strand sequence in Table 4, Table 5, Table 6, or Table 10 by 0, 1, 2, or 3 nucleotides.

[0118] In some embodiments, the antisense strand of the TSLP RNAi reagent contains the nucleotide sequence of any sequence in Table 2 or Table 3. In some embodiments, the antisense strand of the TSLP RNAi reagent contains the nucleotide (5' end) of any sequence in Table 2, Table 3, or Table 10. The 3' end) contains sequences of 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, or 2-24. In some embodiments, the antisense strand of the TSLP RNAi reagent contains, or is composed of, any of the modified sequences in Table 3 or Table 10.

[0119] In some embodiments, the sense strand of the TSLP RNAi reagent comprises the nucleotide sequence of any sequence in Table 2 or Table 4. In some embodiments, the sense strand of the TSLP RNAi reagent comprises the nucleotide (5' end) of any sequence in Table 2, Table 4, Table 5, Table 6, or Table 10. The 3' end) contains sequences of 1-17, 2-17, 3-17, 4-17, 1-18, 2-18, 3-18, 4-18, 1-19, 2-19, 3-19, 4-19, 1-20, 2-20, 3-20, 4-20, 1-21, 2-21, 3-21, 4-21, 1-22, 2-22, 3-22, 4-22, 1-23, 2-23, 3-23, 4-23, 1-24, 2-24, 3-24, or 4-24. In some embodiments, the sense strand of the TSLP RNAi reagent contains, or is composed of, any of the modified sequences in Table 3 or Table 10.

[0120] For the RNAi reagents disclosed in this paper, at the antisense strand (5' end) The nucleotide at position 1 (3' end) can be completely complementary to the TSLP gene, or it can be non-complementary to the TSLP gene. In some implementations, at position 1 (5' end) of the antisense strand... The nucleotide at position 1 (3' end) is U, A, or dT (or a modified form of U, A, or dT). In some embodiments, at the antisense strand (5' end) The nucleotide at position 1 (3' end) forms an A:U or U:A base pair with the sense strand.

[0121] In some implementations, the antisense strand of the TSLP RNAi reagent contains nucleotides (5' end) of any antisense strand sequence from Table 2, Table 3, or Table 10. The 3' end) 2-18 or 2-19 sequence. In some embodiments, the sense strand of the TSLP RNAi contains nucleotides (5' end) of any sense strand sequence from Tables 2, 4, 5, 6, or 10. (3' end) Sequence of 1-17 or 1-18.

[0122] In some implementations, the TSLP RNAi reagent includes (i) an antisense strand containing nucleotides (5' end) of any antisense strand sequence from Table 2, Table 3, or Table 10. (ii) Sequences of 2-18 or 2-19 (3' end), and sense strands comprising nucleotides (5' end) of any sense strand sequence in Tables 2, 4, 5, 6, or 10. (3' end) Sequence of 1-17 or 1-18.

[0123] A sense strand containing sequences listed in Table 2 or Table 4 can hybridize with any antisense strand containing sequences listed in Table 2 or Table 3, provided that the two sequences have at least 85% complementarity in adjacent 16, 17, 18, 19, 20, or 21 nucleotide sequences. In some embodiments, the TSLP RNAi reagent has a sense strand consisting of a modified sequence of any of the modified sequences in Tables 4, 5, 6, or 10, and an antisense strand consisting of a modified sequence of any of the modified sequences in Tables 3 or 10. Some representative sequence pairings are illustrated by the duplex ID Nos shown in Tables 7A, 7B, 8, and 9.

[0124] In some embodiments, the TSLP RNAi reagent comprises, consists of, or is substantially composed of a double strand, said double strand being represented by any of the double strand ID Nos presented herein. In some embodiments, the TSLP RNAi reagent consists of any double strand ID No. presented herein. In some embodiments, the TSLP RNAi reagent comprises the sense and antisense nucleotide sequences of any double strand ID No. presented herein. In some embodiments, the TSLP RNAi reagent comprises the sense and antisense nucleotide sequences of any double strand ID No. presented herein, as well as a targeting group, a linker group, and / or other non-nucleotide groups, said targeting group, linker group, and / or other non-nucleotide groups being covalently linked (i.e., conjugated) to the sense or antisense strand. In some embodiments, the TSLP RNAi reagent comprises modified nucleotide sequences of the sense and antisense strands of any double strand ID No. presented herein. In some embodiments, the TSLP RNAi reagent comprises a modified nucleotide sequence of the sense and antisense strands of any duplex ID No. presented herein, as well as a targeting group, a linker group, and / or other non-nucleotide groups, wherein the targeting group, linker group, and / or other non-nucleotide groups are covalently linked to the sense or antisense strand.

[0125] In some implementations, TSLP RNAi reagent Include The antisense and sense strands have nucleotide sequences of any antisense / sense duplex from Tables 2, 7A, 7B, 8, 9, or 10, and contain a targeting group. In some embodiments, the TSLP RNAi reagent comprises an antisense and sense strands having nucleotide sequences of any antisense / sense duplex from Tables 2, 7A, 7B, 8, 9, or 10, and contains one or more αvβ6 integrin targeting ligands.

[0126] In some embodiments, the TSLP RNAi reagent comprises an antisense strand and a sense strand having the nucleotide sequence of any antisense / sense duplex from Tables 2, 7A, 7B, 8, 9, or 10, and contains a targeting group that is an integrin targeting ligand. In some embodiments, the TSLP RNAi reagent comprises an antisense strand and a sense strand having the nucleotide sequence of any antisense / sense duplex from Tables 2, 7A, 7B, 8, 9, or 10, and contains one or more αvβ6 integrin targeting ligands or clusters of αvβ6 integrin targeting ligands (e.g., a tridentate αvβ6 integrin targeting ligand).

[0127] In some implementations, the TSLP RNAi reagent comprises an antisense strand and a sense strand, which are modified nucleotide sequences having any antisense / sense duplexes as shown in Tables 7A, 7B, 8, 9, and 10.

[0128] In some implementations, the TSLP RNAi reagent comprises an antisense strand and a sense strand, having a modified nucleotide sequence of any antisense / sense duplex as described in Tables 7A, 7B, 8, 9, and 10, and contains an integrin targeting ligand.

[0129] In some implementations, the TSLP RNAi reagent comprises, is composed of, or is substantially composed of, any of the duplexes listed in Tables 7A, 7B, 8, 9, and 10.

[0130] Table 7A. Duplexes of TSLP RNAi reagents with corresponding sense and antisense strand IDs and sequence IDs for modified and unmodified nucleotide sequences (linkers or conjugates not shown).

[0131] Table 7B. Duplexes of TSLP RNAi reagents with corresponding sense and antisense strand IDs and sequence IDs for modified and unmodified nucleotide sequences. .

[0132] Table 8. Double strands of TSLP RNAi reagent conjugates with corresponding sense and antisense strand ID numbers and sequence ID numbers for modified and unmodified nucleotide sequences. (Accompanying targeting ligand conjugates are shown.) .

[0133] Table 9. Double-strand IDs of conjugates targeting sites on the TSLP (TSLP) gene Fused double chain AS ID SS ID Targeting the TSLP gene location (SEQ ID NO:1) AC001714 AM14179-AS CS001922 N / A AC002515 AM16334-AS CS003220 N / A AC003096 AM19258-AS CS003898 398 AC003097 AM19260-AS CS003900 410 AC003098 AM19262-AS CS003902 515 AC003099 AM19264-AS CS003904 570 AC003100 AM19266-AS CS003906 571 AC003101 AM19268-AS CS003908 568 AC003102 AM18311-AS CS003904 570 AC003128 AM19335-AS CS003954 520 AC003129 AM19337-AS CS003956 413 AC003130 AM19339-AS CS003958 406 AC003252 AM18285-AS CS003954 520 AC003253 AM19685-AS CS003954 520 AC003339 AM19938-AS CS003954 520 AC003340 AM19939-AS CS003954 520 AC003341 AM19335-AS CS004174 520 AC003342 AM19941-AS CS003954 520 AC003343 AM19942-AS CS003954 520 AC003344 AM19943-AS CS003954 520 AC003345 AM19944-AS CS003954 520 AC003346 AM19945-AS CS003954 520 AC003347 AM19946-AS CS003954 520 AC003371 AM19947-AS CS003906 571 AC003372 AM19266-AS CS004205 571 AC003373 AM19949-AS CS003906 571 AC003374 AM19950-AS CS003906 571 AC003375 AM19951-AS CS003906 571 AC003376 AM19952-AS CS003906 571 AC003377 AM19953-AS CS003906 571 AC003378 AM19954-AS CS003906 571 AC003379 AM19955-AS CS003906 571 AC003415 AM20176-AS CS004244 417 AC003416 AM20176-AS CS004246 417 AC003446 AM19941-AS CS004174 520 AC003447 AM19941-AS CS004280 520 AC003448 AM20299-AS CS003954 520 AC003449 AM20300-AS CS003954 520 AC003450 AM20314-AS CS003954 520 AC003451 AM20315-AS CS003954 520 AC003452 AM20315-AS CS004280 520 AC003453 AM20303-AS CS003954 520 AC003454 AM20308-AS CS003954 520 AC003455 AM20309-AS CS003954 520 AC003456 AM20310-AS CS003954 520 AC003457 AM20304-AS CS003954 520 AC003458 AM20305-AS CS003954 520 AC003459 AM20307-AS CS004291 520 AC003511 AM20487-AS CS003904 570 AC003537 AM20488-AS CS003906 571 AC003538 AM20489-AS CS003906 571 AC003539 AM20490-AS CS003906 571 AC003540 AM20491-AS CS003954 520 AC003541 AM19947-AS CS004392 571 AC003542 AM19947-AS CS004205 571 AC003543 AM20534-AS CS004393 571 AC003544 AM20536-AS CS004395 571 AC003545 AM20538-AS CS004397 571 AC003546 AM20539-AS CS004397 571 AC003547 AM20540-AS CS004397 571 AC003567 CA004416 CS003904 570 AC003568 CA004416 CS004420 570 AC003569 CA004417 CS003904 570 AC003570 CA004417 CS004420 570 AC003571 CA004418 CS004420 570 AC003572 CA004418 CS003904 570 AC003597 CA004450 CS004395 571 AC003598 CA004451 CS004393 571 AC003601 CA004452 CS004395 571 AC003602 CA004453 CS004393 571 AC003659 CA004518 CS004397 571 AC003660 CA004519 CS004395 571 AC003843 CA004288 CS004174 520 AC003924 CA004834 CS004393 571 AC004077 CA005033 CS004393 571 AC004078 CA005034 CS004393 571 AC004079 CA005037 CS005036 570 AC004082 CA005032 CS003906 571 AC004083 CA005035 CS003904 570 AC004358 CA005404 CS005405 571 AC004361 CA005404 CS003906 571 AC004363 CA005407 CS003906 571 AC004373 CA005413 CS003906 571 AC004374 CA005414 CS003906 571 AC004375 CA005415 CS003906 571 AC004376 CA005410 CS003906 571 AC004377 CA005411 CS003906 571 AC004378 CA005412 CS003906 571 AC004565 CA005630 CS005657 485 AC004566 CA005632 CS005658 626 AC004567 CA005634 CS005659 719 AC004568 CA005636 CS005660 773 AC004569 CA005638 CS005661 836 AC004570 CA005640 CS005662 863 AC004571 CA005642 CS005663 992 AC004572 CA005644 CS005664 1021 AC004573 CA005646 CS005665 1040 AC004574 CA005648 CS005666 1218 AC004644 CA005746 CS004393 571 AC004645 CA005746 CS005747 571 AC004646 CA005749 CS005748 571 AC004647 CA005750 CS004393 571 AC004648 CA005751 CS004393 571 AC004649 CA005752 CS004393 571 AC004816 CA005749 CS004393 571 AC004817 CA005958 CS005957 571 AC004818 CA005959 CS004393 571 AC004819 CA005959 CS005957 571 AC004820 CA005958 CS005960 571 AC004821 CA005958 CS004393 571 AC004837 CA005976 CS004393 571 AC004838 CA005977 CS004393 571 AC004908 CA006068 CS004393 571 AC004915 CA006074 CS004393 571 AC004916 CA006075 CS004395 571 AC004917 CA006076 CS004395 571 AC005191 CA006343 CS005747 571 AC005192 CA006345 CS006344 571 AC005193 CA006347 CS006346 571 AC005195 CA005407 CS006349 571 AC005196 CA006350 CS006349 571 AC005206 CA005958 CS005748 571 AC005233 CA006068 CS005748 571 AC005236 CA006383 CS004397 571 AC005249 CA006350 CS003906 571 AC005944 CA005056 CS003906 571 AC005945 CA004538 CS003906 571 AC005991 CA006074 CS005748 571

[0134] The double-stranded sequences, IDs AC001714 and AC002515, contain rat-specific sequences designed to target the rat TSLP transcript (NCBI GenBank XM_008772052.2) and are not homologous to the human TSLP gene.

[0135] In some embodiments, the TSLP RNAi reagent is prepared or provided as a salt, a mixed salt, or a free acid. In some embodiments, the TSLP RNAi reagent is prepared or provided as a pharmaceutically acceptable salt. In some embodiments, the TSLP RNAi reagent is prepared or provided as a pharmaceutically acceptable sodium or potassium salt. In some embodiments, the TSLP RNAi reagent is prepared or provided as a pharmaceutically acceptable sodium salt. After delivery to cells expressing the TSLP gene, the RNAi reagent described herein inhibits or knocks down the expression of one or more TSLP genes in vivo and / or in vitro.

[0136] Targeting groups, linking groups, pharmacokinetic / pharmacodynamic (PK / PD) modulators, and delivery mediators In some embodiments, the TSLP RNAi reagent contains or is conjugated to one or more non-nucleotide groups, including but not limited to targeting groups, linker groups, pharmacokinetic / pharmacodynamic (PK / PD) modulators, delivery polymers, or delivery mediators. Non-nucleotide groups can enhance the targeting, delivery, or attachment of the RNAi reagent. Non-nucleotide groups can be covalently linked to the 3' and / or 5' ends of the sense and / or antisense strands. In some embodiments, the TSLP RNAi reagent contains non-nucleotide groups linked to the 3' and / or 5' ends of the sense strand. In some embodiments, non-nucleotide groups are linked to the 5' end of the sense strand of the TSLP RNAi reagent. Non-nucleotide groups can be directly or indirectly linked to the RNAi reagent via adapters / linker groups. In some embodiments, non-nucleotide groups are linked to the RNAi reagent via unstable, cleavable, or reversible bonds or adapters.

[0137] In some embodiments, the non-nucleotide group enhances the pharmacokinetic or biodistribution properties of the RNAi reagent or conjugate to which it is attached, thereby improving the cell- or tissue-specific distribution and cell-specific uptake of the conjugate. In some embodiments, the non-nucleotide group enhances the endocytosis of the RNAi reagent.

[0138] Targeting groups or targeting moieties enhance the pharmacokinetic or biodistribution properties of the conjugates or RNAi reagents to which they are attached, thereby improving cell-specific (in some cases, organ-specific) distribution and cell-specific (or organ-specific) uptake of the conjugates or RNAi reagents. Targeting groups can be monovalent, divalent, trivalent, tetravalent, or have a higher potency for their target. Representative targeting groups include, but are not limited to, compounds with affinity for cell surface molecules, cell receptor ligands, haptens, antibodies, monoclonal antibodies, antibody fragments, and antibody mimics (which have affinity for cell surface molecules). In some embodiments, the targeting group is linked to the RNAi reagent using a linker such as a PEG linker, or one, two, or three debased and / or ribitol (debased ribose) residues (which can act as linkers in some cases).

[0139] Targeting groups, with or without a connector, may be attached to the 5′ or 3′ end of any sense and / or antisense strand disclosed in Tables 2, 3, 4, 5, 6, and 10.

[0140] The TSLP RNAi reagent described herein can be synthesized with a reactive group, such as an amino group (also referred to herein as an amine), at the 5' and / or 3' end. The reactive group can then be used to attach the target moiety using methods conventional in the art.

[0141] For example, in some embodiments, the TSLP RNAi reagent disclosed herein is synthesized having an NH2-C6 group at the 5' end of the sense strand of the RNAi reagent. The terminal amino group can then be reacted with a group, for example, including an αvβ6 integrin targeting ligand, to form a conjugate having that group. In some embodiments, the TSLP RNAi reagent disclosed herein is synthesized having one or more alkynyl groups at the 5' end of the sense strand of the RNAi reagent. The terminal alkynyl group can then be reacted with a group, for example, including an αvβ6 integrin targeting ligand, to form a conjugate having that group.

[0142] In some embodiments, the targeting group comprises an integrin targeting ligand. In some embodiments, the integrin targeting ligand is an αvβ6 integrin targeting ligand. The use of the αvβ6 integrin targeting ligand facilitates cell-specific targeting of cells having αvβ6 on their respective surfaces, and binding of the integrin targeting ligand can facilitate the entry of therapeutic agents, such as RNAi agents, to which it is attached into cells, such as epithelial cells, including lung epithelial cells and kidney epithelial cells. The integrin targeting ligand can be monomeric or monovalent (e.g., having a single integrin targeting moiety), or polymeric or multivalent (e.g., having multiple integrin targeting moieties). The targeting group can be attached to the 3' and / or 5' ends of RNAi oligonucleotides using methods known in the art. For example, the preparation of targeting groups, such as αvβ6 integrin targeting ligands, is described in International Patent Application Publication No. WO 2018 / 085415 and International Patent Application Publication No. WO 2019 / 089765, the contents of which are incorporated herein by reference in their entirety.

[0143] In some embodiments, the target group is linked to the TSLP RNAi reagent without the use of an additional adapter. In some embodiments, the target group is designed to have readily available adapters to facilitate bonding with the TSLP RNAi reagent. In some embodiments, when the composition includes two or more RNAi reagents, the same adapter can be used to link the two or more RNAi reagents to their respective target groups. In some embodiments, when the composition includes two or more RNAi reagents, different adapters are used to link the two or more RNAi reagents to their respective target groups.

[0144] In some embodiments, a linker group is conjugated to the RNAi reagent. The linker group facilitates the covalent connection of the reagent to a targeting group, pharmacokinetic modifier, delivery polymer, or delivery medium. The linker group may be attached to the 3' and / or 5' end of the sense or antisense strand of the RNAi reagent. In some embodiments, the linker group is attached to the sense strand of the RNAi reagent. In some embodiments, the linker group is conjugated to the 5' or 3' end of the sense strand of the RNAi reagent. In some embodiments, the linker group is conjugated to the 5' end of the sense strand of the RNAi reagent. Examples of linker groups include, but are not limited to: C6-SS-C6, 6-SS-6, reactive groups such as primary amines (e.g., NH2-C6) and alkynes, alkyl groups, debased residues / nucleotides, amino acids, triyne functionalized groups, ribitols, and / or PEG groups. Examples of certain linker groups are provided in Table 11.

[0145] A linker or connecting group is a connection between two atoms that links one chemical group (e.g., an RNAi reagent) or target segment to another chemical group (e.g., a targeting group, a pharmacokinetic modifier, or a delivery polymer) or target segment via one or more covalent bonds. Unstable bonds contain unstable bonds. Bonding may optionally include spacers that increase the distance between the two linked atoms. The spacers may further increase the flexibility and / or length of the bond. Spacers include, but are not limited to, alkyl, alkenyl, alkynyl, aryl, aralkyl, areneyl, and arynyl groups; each may contain one or more heteroatoms, heterocycles, amino acids, nucleotides, and sugars. Spacer groups are well known in the art, and the preceding list is not intended to limit the scope of this specification. In some embodiments, the TSLP RNAi reagent is conjugated to a polyethylene glycol (PEG) moiety or to a hydrophobic group having 12 or more carbon atoms, such as cholesterol or palmitoyl.

[0146] In some embodiments, the TSLP RNAi reagent is linked to one or more pharmacokinetic / pharmacodynamic (PK / PD) modulators. PK / PD modulators can increase the circulation time of the conjugated drug and / or increase the activity of the RNAi reagent by improving cell receptor binding, improving cellular uptake, and / or other means. Various PK / PD modulators suitable for RNAi reagents are known in the art. In some embodiments, the PK / PD modulator may be cholesterol or a cholesterol-based derivative, or in some cases, the PK / PD modulator may be composed of alkyl, alkenyl, alkynyl, aryl, aralkyl, areneyl, or arynyl groups, each of which may be linear, branched, cyclic, and / or substituted or unsubstituted. In some embodiments, attachment of these moieties is located at the 5' or 3' end of the sense chain, at the 2' position of the ribosome ring of any given nucleotide of the sense chain, and / or at any position on the sense chain to the phosphate or thiophosphate backbone.

[0147] The nucleotide sequences of any TSLP RNAi reagents listed in Tables 2, 3, 4, 5, 6, and 10, whether modified or unmodified, may contain 3' and / or 5' targeting groups, linker groups, and / or PK / PD modulators. Any TSLP RNAi reagent sequence listed in Tables 3, 4, 5, 6, and 10 or described elsewhere herein, containing 3' or 5' targeting groups, linker groups, and / or PK / PD modulators, may alternatively omit 3' or 5' targeting groups, linker groups, or PK / PD modulators, or may contain different 3' or 5' targeting groups, linker groups, or pharmacokinetic modulators, including but not limited to those depicted in Table 11. The duplexes of any TSLP RNAi reagents listed in Tables 7A, 7B, 8, 9, and 10, whether modified or unmodified, may further contain targeting groups or linker groups, including but not limited to those depicted in Table 11, and the targeting groups or linker groups may be attached to the 3' or 5' end of the sense or antisense strand of the TSLP RNAi reagent duplex.

[0148] Examples of certain modified nucleotides, capped moieties, and linker groups are provided in Table 11.

[0149] Table 11. Structures of nucleotides with various modifications, capped moieties, and linker groups (where...) (Indicator connection point)

[0150] Alternatively, other linking groups known in the art may be used. In many cases, the linking group is commercially available, or alternatively, incorporated into a commercially available nucleotide phosphoramide. (See, for example, International Patent Application Publication No. WO 2019 / 161213, which is incorporated herein by reference in its entirety).

[0151] In some implementations, TSLP RNAi reagents are delivered without conjugation to a targeting ligand or a pharmacokinetic / pharmacodynamic (PK / PD) modulator (referred to as "naked" or "naked RNAi reagents").

[0152] In some embodiments, the TSLP RNAi reagent is conjugated to a targeting group, a linker group, a PK regulator, and / or another non-nucleotide group to facilitate delivery of the TSLP RNAi reagent to selected cells or tissues, such as epithelial cells in vivo. In some embodiments, the TSLP RNAi reagent is conjugated to a targeting group, wherein the targeting group includes an integrin targeting ligand. In some embodiments, the integrin targeting ligand is an αvβ6 integrin targeting ligand. In some embodiments, the targeting group includes one or more αvβ6 integrin targeting ligands.

[0153] In some embodiments, a delivery medium may be used to deliver RNAi reagents to cells or tissues. The delivery medium is a compound that improves the delivery of RNAi reagents to cells or tissues. Delivery mediators may include, but are not limited to, polymers such as amphiphilic polymers, membrane-active polymers, peptides, melittin peptides, melittin-like peptides (MLPs), lipids, reversibly modified polymers or peptides, or reversibly modified membrane-active polyamines.

[0154] In some embodiments, RNAi reagents may be combined with lipids, nanoparticles, polymers, liposomes, micelles, DPCs, or other delivery systems in the art that can be used for nucleic acid delivery. RNAi reagents may also be chemically conjugated to targeting groups, lipids (including but not limited to cholesterol groups and cholesterol derivatives), encapsulated in nanoparticles, liposomes, micelles, conjugated to polymers or DPCs (see, for example, WO 2000 / 053722, WO 2008 / 022309, WO 2011 / 104169 and WO 2012 / 083185, WO 2013 / 032829, WO 2013 / 158141, each incorporated herein by reference), via iontophoresis, or by incorporation into other delivery media or systems available in the art, such as hydrogels, cyclodextrins, biodegradable nanocapsules, bioadhesive microspheres, or protein carriers. In some embodiments, the RNAi reagent can be conjugated to an antibody with affinity for lung epithelial cells. In some embodiments, the RNAi reagent can be linked to a targeting ligand with affinity for lung epithelial cells or a receptor present on lung epithelial cells.

[0155] Pharmaceutical compositions and formulations The TSLP RNAi reagents disclosed herein can be prepared as pharmaceutical compositions (or alternatively referred to as pharmaceutical formulations or agents). The pharmaceutical compositions disclosed herein comprise at least one TSLP RNAi reagent. These pharmaceutical compositions are specifically designed to inhibit the expression of TSLP mRNA in target cells, cell populations, tissues, or organisms. The pharmaceutical compositions can be used to treat subjects suffering from diseases, conditions, or illnesses that would benefit from a reduction in target mRNA levels or inhibition of target gene expression. The pharmaceutical compositions can be used to treat subjects at risk of developing diseases or illnesses that would benefit from a reduction in target mRNA levels or inhibition of target gene expression. In one embodiment, the method includes administering a TSLP RNAi reagent, as described herein and linked to a target ligand, to a subject to be treated. In some embodiments, one or more pharmaceutically acceptable excipients (including mediators, carriers, diluents, and / or delivery polymers) are incorporated into the pharmaceutical composition comprising the TSLP RNAi reagent to form a pharmaceutical formulation or agent suitable for in vivo delivery to subjects, including humans.

[0156] The pharmaceutical compositions and methods disclosed herein, including TSLP RNAi reagents, reduce the level of target mRNA in cells, cell populations, tissues, organs, or subjects, comprising inhibiting the expression of TSLP mRNA in the subject by administering a therapeutically effective amount of the TSLP RNAi reagent described herein. In some embodiments, the subject has been previously identified or diagnosed with a disease or condition that can be at least partially mediated by reduced TSLP expression. In some implementations, the subject has been previously diagnosed with one or more lung diseases, such as asthma (including allergic asthma), chronic obstructive pulmonary disease including but not limited to chronic bronchitis and emphysema, inflammatory lung diseases, interstitial lung disease (ILD), cystic fibrosis, various other types of fibrosis, infectious diseases (e.g., SARS-CoV-2), acute lung injury (e.g., acute respiratory distress syndrome (ARDS)), pulmonary hypertension, various lung cancers, chronic sinusitis with or without nasal polyps, autoimmune diseases including but not limited to systemic sclerosis (SSc), and various inflammatory diseases including but not limited to atopic dermatitis, chronic spontaneous urticaria, and eosinophilic esophagitis.

[0157] Embodiments of this disclosure include pharmaceutical compositions for delivering TSLP RNAi reagents to lung epithelial cells in vivo. Such pharmaceutical compositions may include, for example, TSLP RNAi reagents conjugated to a targeting group comprising an integrin-targeting ligand. In some embodiments, the integrin-targeting ligand is composed of an αvβ6 integrin ligand.

[0158] In some embodiments, the pharmaceutical composition including a TSLP RNAi reagent is used to treat or manage clinical presentations in subjects who would benefit from inhibition of TSLP expression. In some embodiments, a therapeutically or preventively effective amount of one or more pharmaceutical compositions is administered to a subject requiring such treatment. In some embodiments, administration of any disclosed TSLP RNAi reagent may be used to reduce the number, severity, and / or frequency of disease symptoms in a subject.

[0159] In some embodiments, the TSLP RNAi reagent is optionally combined with one or more additional (i.e., second, third, etc.) therapeutic agents. The second therapeutic agent may be another TSLP RNAi reagent (e.g., a TSLP RNAi reagent targeting a different sequence within the TSLP gene). In some embodiments, the second therapeutic agent may be an RNAi reagent targeting the TSLP gene. Additional therapeutic agents may also be small molecule drugs, antibodies, antibody fragments, and / or aptamers. The TSLP RNAi reagent, with or without one or more additional therapeutic agents, may be combined with one or more excipients to form a pharmaceutical composition.

[0160] The pharmaceutical composition comprising a TSLP RNAi reagent can be used to treat at least one symptom in a subject suffering from a disease or condition that would benefit from a reduction or inhibition of TSLP mRNA expression. In some embodiments, a therapeutically effective amount of one or more pharmaceutical compositions comprising a TSLP RNAi reagent is administered to the subject to treat the symptom. In other embodiments, a preventatively effective amount of one or more TSLP RNAi reagents is administered to the subject to prevent or inhibit at least one symptom.

[0161] In some embodiments, one or more of the TSLP RNAi reagents are administered to a mammal in a pharmaceutically acceptable carrier or diluent. In some embodiments, the mammal is a human.

[0162] The route of administration is the path by which the TSLP RNAi reagent comes into contact with the body. Generally, methods of administering drugs, oligonucleotides, and nucleic acids for the treatment of mammals are well known in the art and can be applied to the administration of the compositions described herein. The TSLP RNAi reagents disclosed herein can be administered via any suitable route in formulations appropriately tailored to a particular route. Thus, in some embodiments, the pharmaceutical compositions described herein are administered via inhalation, intranasal administration, intratracheal administration, or oropharyngeal aspiration. In some embodiments, the pharmaceutical compositions can be administered, for example, via intravenous, intramuscular, intradermal, subcutaneous, intra-articular, or intraperitoneal or local injection.

[0163] Pharmaceutical compositions comprising the TSLP RNAi reagent described herein can be delivered to cells, cell populations, tissues, or subjects using oligonucleotide delivery technologies known in the art. Generally, any suitable method recognized in the art for delivering nucleic acid molecules (in vitro or in vivo) can be adapted for use with the compositions described herein. For example, delivery can be made via local administration (e.g., direct injection, implantation, or local application), systemic administration, or subcutaneous, intravenous, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal, and intrathecal), intramuscular, percutaneous, airway (aerosol), nasal, oral, rectal, or local (including buccal and sublingual) administration. In some embodiments, the composition is administered via inhalation, intranasal administration, oropharyngeal aspiration administration, or intratracheal administration.

[0164] For example, in some embodiments, it is desirable that the TSLP RNAi reagent described herein inhibits the expression of the TSLP gene in the lung epithelium, and its administration via inhalation (e.g., through an inhaler device such as a metering inhaler, or a nebulizer such as a jet or vibrating mesh nebulizer, or a soft mist inhaler).

[0165] In some embodiments, the pharmaceutical compositions described herein comprise one or more pharmaceutically acceptable excipients. The pharmaceutical compositions described herein are formulated for administration to a subject.

[0166] As used herein, a pharmaceutical composition comprises a pharmacologically effective amount of at least one of the therapeutic compounds and one or more pharmaceutically acceptable excipients. Pharmaceutically acceptable excipients are substances other than the active pharmaceutical ingredient (API, therapeutic product, such as a TSLP RNAi reagent) that are intentionally included in a drug delivery system. Excipients do not exert or are not intended to exert therapeutic effects at the intended dosage. Excipients may act to: a) facilitate the processing of the drug delivery system during manufacturing, b) protect, support, or enhance the stability, bioavailability, or patient acceptability of the API, c) aid in product identification, and / or d) enhance any other property of the overall safety and effectiveness of API delivery during stoTSLP or use. Pharmaceutically acceptable excipients may or may not be inert substances.

[0167] Excipients include, but are not limited to: absorption enhancers, anti-adhesion agents, defoamers, antioxidants, adhesives, buffers, carriers, coating agents, pigments, delivery enhancers, delivery polymers, detergents, dextran, glucose, diluents, disintegrants, emulsifiers, extenders, fillers, flavoring agents, flow aids, wetting agents, lubricants, oils, polymers, preservatives, brine, salt, solvents, sugars, surfactants, suspending agents, sustained-release matrices, sweeteners, thickeners, stretching agents, mediators, waterproofing agents, and wetting agents.

[0168] Suitable pharmaceutical compositions for injection include sterile aqueous solutions (when water-soluble) or dispersions, as well as sterile powders for the provisional preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, antibacterial water, Cremophor® ELTM (BASF, Parsippany, NJ), or phosphate-buffered saline (PBS). It should be stable under the conditions of manufacture and storage and should be preservative against contamination by microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. Appropriate flowability can be maintained, for example, by using coatings such as lecithin, maintaining the desired particle size in the case of dispersions, and using surfactants. In many cases, it is preferable to include isotonic agents in the composition, such as sugars, polyols such as mannitol, sorbitol, and sodium chloride. Prolonged absorption of injectable compositions can be achieved by including agents that delay absorption, such as aluminum monostearate and gelatin, in the composition.

[0169] A sterile injectable solution can be prepared by incorporating the desired amount of the active compound with one or a combination of the ingredients listed above as needed into a suitable solvent, followed by filtration and sterilization. Generally, a dispersion is prepared by incorporating the active compound into a sterile medium containing a base dispersion medium and other desired ingredients from those listed above. In the case of sterile powders used to prepare sterile injectable solutions, preparation methods include vacuum drying and freeze-drying, which yields a powder of the active ingredient plus any other desired ingredients from its previously sterile filtered solution.

[0170] Formulations suitable for intra-articular administration can be in the form of sterile aqueous formulations of the drug, which can be in microcrystalline form, such as aqueous microcrystalline suspensions. Liposome formulations or biodegradable polymer systems can also be used to deliver drugs for intra-articular and intraocular administration.

[0171] Formulations suitable for inhalation can be prepared by incorporating the desired amount of active compound into a suitable solvent, followed by sterile filtration. Generally, formulations for inhalation are sterile solutions at physiological pH and have low viscosity (<5 cP). Salts may be added to the formulation to balance tonic tension. In some cases, surfactants or co-solvents may be added to increase the solubility of the active compound and improve aerosol properties. In some cases, excipients may be added to control viscosity to ensure the size and distribution of atomized droplets.

[0172] In some embodiments, a pharmaceutical formulation suitable for inhalation administration can be prepared in water for injection (sterile water) or an aqueous sodium phosphate buffer, including the TSLP RNAi reagents disclosed herein (e.g., TSLP RNAi reagents prepared in an aqueous solution of 0.5 mM sodium dihydrogen phosphate and 0.5 mM disodium hydrogen phosphate).

[0173] The active compound can be prepared together with a carrier that protects the compound from rapid elimination from the body, such as in controlled-release formulations, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid can be used. Methods for preparing such formulations will be readily apparent to those skilled in the art. Liposome suspensions can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, such as those described in U.S. Patent No. 4,522,811.

[0174] TSLP RNAi reagents can be formulated in the composition in dose-unit form for ease of administration and uniform dosage. A dose-unit form refers to physically discrete units suitable as a unit dose for a subject to be treated; each unit contains a predetermined amount of the active compound, calculated to bind with the desired drug carrier to produce the desired therapeutic effect. Specifications regarding the dose-unit form of this disclosure are specified and directly dependent on the unique characteristics of the active compound and the therapeutic effect to be achieved, as well as the inherent limitations in the field of formulating such active compounds for individualized treatment.

[0175] Pharmaceutical compositions may contain other additional components commonly found in pharmaceutical compositions. These additional components include, but are not limited to, antipruritic agents, astringents, local anesthetics, or anti-inflammatory agents (e.g., antihistamines, diphenhydramine, etc.). Cells, tissues, or isolated organs expressing or containing RNAi reagents as defined herein are also envisioned as potential candidates for use as “pharmaceutical compositions.” As used herein, “pharmacologically effective amount,” “therapeuticly effective amount,” or simply “effective amount” refers to the amount of RNAi reagent that produces a pharmacological, therapeutic, or preventative outcome.

[0176] In some embodiments, in addition to applying the RNAi reagent disclosed herein, the methods disclosed herein further include the step of applying a second therapeutic agent or treatment. In some embodiments, the second therapeutic agent is another TSLP RNAi reagent (e.g., a TSLP RNAi reagent targeting a different sequence within the TSLP target). In other embodiments, the second therapeutic agent may be a small molecule drug, an antibody, an antibody fragment, and / or an aptamer.

[0177] In some embodiments, compositions are described herein comprising a combination or cocktail of at least two TSLP RNAi reagents having different sequences. In some embodiments, the two or more TSLP RNAi reagents are each separately and independently linked to a target group. In some embodiments, the two or more TSLP RNAi reagents are each linked to a target group, said target group comprising or consisting of an integrin targeting ligand. In some embodiments, the two or more TSLP RNAi reagents are each linked to a target group, said target group comprising or consisting of an αvβ6 integrin targeting ligand.

[0178] This document describes compositions for delivering TSLP RNAi reagents to lung epithelial cells. Furthermore, this document generally describes compositions for delivering TSLP RNAi reagents to cells in vivo, including renal epithelial cells and / or epithelial cells in the GI or reproductive tract and / or ocular surface epithelial cells in the eye.

[0179] Generally, the effective amount of the TSLP RNAi reagent disclosed herein is in the range of about 0.0001 to about 20 mg / kg body weight / deposition dose, for example, about 0.001 to about 5 mg / kg body weight / deposition dose. In some embodiments, the effective amount of the TSLP RNAi reagent is in the range of about 0.01 mg / kg to about 3.0 mg / kg body weight / deposition dose. In some embodiments, the effective amount of the TSLP RNAi reagent is in the range of about 0.03 mg / kg to about 2.0 mg / kg body weight / deposition dose. In some embodiments, the effective amount of the TSLP RNAi reagent is in the range of about 0.01 to about 1.0 mg / kg deposition dose / body weight. In some embodiments, the effective amount of the TSLP RNAi reagent is in the range of about 0.50 to about 1.0 mg / kg deposition dose / body weight. The pulmonary deposition dose (PDD) is calculated according to methods known in the art. (See Wolff RK, Dorato M.A., Toxicologic Testing of Inhaled Pharmaceutical AerosolsCrit RevToxicol., 1993; 23(4):343-369; Tepper et al., International J. Toxicology, 2016, Vol. 35(4): 376-392). The amount administered is also likely to depend on such variables as the patient’s overall health condition, the relative biological efficacy of the delivered compound, the formulation of the drug, the presence and type of excipients in the formulation, and the route of administration. In addition, it should be understood that the initial dose administered may be increased beyond the above-mentioned upper limits to rapidly achieve the desired blood or tissue levels, or the initial dose may be less than the optimal dose. In some embodiments, a dose is administered daily. In some embodiments, a dose is administered weekly. In further embodiments, a dose is administered every two weeks, every three weeks, monthly, or quarterly (i.e., every three months).

[0180] For the purpose of treating a disease or for the formation of a pharmaceutical agent or composition for treating a disease, the pharmaceutical composition comprising a TSLPRNAi reagent described herein may be combined with an excipient or a second therapeutic agent or treatment, the second therapeutic agent or treatment including but not limited to: a second or other RNAi reagent, a small molecule drug, an antibody, an antibody fragment, a peptide and / or an aptamer.

[0181] When incorporated into pharmaceutically acceptable excipients or adjuvants, the TSLP RNAi reagent can be packaged into kits, containers, packages, or dispensers. The pharmaceutical compositions described herein can be packaged into dry powder or aerosol inhalers, other metered-dose inhalers, nebulizers, pre-filled syringes, or vials.

[0182] Treatment and inhibition methods for TSLP expression The TSLP RNAi reagents disclosed herein can be used to treat subjects (e.g., humans or other mammals) suffering from a disease or condition that will benefit from the administration of the RNAi reagent. In some embodiments, the RNAi reagents disclosed herein can be used to treat subjects (e.g., humans) who will benefit from a reduction in TSLP mRNA expression and / or inhibition and / or a reduction in TSLP cytokine levels.

[0183] In some embodiments, the RNAi reagents disclosed herein can be used to treat subjects (e.g., humans) with diseases or conditions for which the subjects would benefit from a reduction in TSLP cytokine levels. These diseases or conditions include, but are not limited to, chronic obstructive pulmonary disease (COPD) including but not limited to chronic bronchitis and emphysema, inflammatory lung diseases, interstitial lung disease (ILD), cystic fibrosis, various other types of fibrosis, infectious diseases (e.g., SARS-CoV-2), acute lung injury (e.g., acute respiratory distress syndrome (ARDS)), pulmonary hypertension, various lung cancers, chronic sinusitis with or without nasal polyps, autoimmune diseases including but not limited to systemic sclerosis (SSc), and various inflammatory diseases including but not limited to atopic dermatitis, chronic spontaneous urticaria, and eosinophilic esophagitis. In some embodiments, the disease is allergic asthma. In some embodiments, the subject has previously been diagnosed with asthma, or more specifically, allergic asthma, or another inflammatory lung disease. Treatment of the subject may include therapeutic and / or preventative treatment. Administer a therapeutically effective amount of any one or more TSLP RNAi reagents described herein to a subject. The subject may be a human, patient, or human patient. The subject may be an adult, adolescent, child, or infant. The pharmaceutical compositions described herein may be administered to humans or animals.

[0184] Increased TSLP cytokine levels are known to contribute to abnormal epithelial cell, fibroblast, and immune cell function and have been associated with fibrosis, particularly in lung tissue and cells. In some embodiments, the TSLP RNAi reagent is used to treat a subject for at least one symptom mediated at least partially by a decrease in TSLP cytokine levels. A therapeutically effective amount of any one or more of the TSLP RNAi reagents is administered to the subject. In some embodiments, a preventatively effective amount of any one or more of the RNAi reagents is administered to the subject, thereby treating the subject by preventing or suppressing at least one symptom.

[0185] In some embodiments, this disclosure provides methods for treating patients in need of a disease, symptom, condition, or pathological state that is at least partially mediated by TSLP gene expression, wherein said methods include administering any of the TSLP RNAi reagents described herein to the patient.

[0186] In some embodiments, the TSLP RNAi reagent is used to treat or manage a clinical presentation or pathological condition in a subject, wherein the clinical presentation or pathological condition is at least partially mediated by a decrease in TSLP expression. The subject is administered a therapeutically effective amount of one or more TSLP RNAi reagents described herein, or a composition containing a TSLP RNAi reagent. In some embodiments, the method includes administering a composition containing a TSLP RNAi reagent described herein to a subject to be treated.

[0187] In a further aspect, this disclosure features a method for treating (including preventative or preventive treatment) a disease or symptom that may be resolved by reducing TSLP cytokine levels, the method comprising administering a TSLP RNAi reagent to a subject in need of such a reagent, comprising an antisense strand of a sequence comprising any sequence contained in Tables 2, 3, or 10. Compositions for use in such methods are also described herein.

[0188] The TSLP RNAi reagent and / or compositions comprising the TSLP RNAi reagent can be used in methods for the therapeutic treatment of diseases or conditions caused by enhanced or elevated levels of the TSLP cytokine. Such methods include administering the TSLP RNAi reagent as described herein to a subject, such as a human or animal subject.

[0189] In another aspect, this disclosure provides a method for treating (including prophylactic treatment) a pathological state (e.g., condition or disease) at least partially mediated by TSLP expression, said method comprising administering to a subject a therapeutically effective amount of an RNAi reagent comprising an antisense strand of a sequence containing any of the sequences in Tables 2, 3 or 10.

[0190] In some embodiments, this document discloses methods for suppressing TSLP gene expression, wherein the methods include administering an RNAi reagent to cells comprising an antisense strand of a sequence containing any of the sequences in Tables 2, 3, or 10.

[0191] In some embodiments, this document discloses methods for treating (including prophylactic treatment) a pathological state at least partially mediated by TSLP expression, wherein the method comprises administering to a subject a therapeutically effective amount of an RNAi reagent comprising a sense strand of a sequence containing any sequence from Tables 2, 4, 5, 6, or 10.

[0192] In some embodiments, this document discloses methods for suppressing TSLP gene expression, wherein the methods include administering an RNAi reagent to cells comprising a sense strand of a sequence containing any of the sequences in Tables 2, 4, 5, 6, or 10.

[0193] In some embodiments, this document discloses methods for treating (including prophylactic treatment) a pathological state at least partially mediated by TSLP expression, wherein the method comprises administering to a subject a therapeutically effective amount of an RNAi reagent comprising a sense strand containing any sequence from Table 4, Table 5, Table 6, or Table 10, and an antisense strand containing any sequence from Table 3 or Table 10.

[0194] In some embodiments, this document discloses a method for suppressing TSLP gene expression, wherein the method includes administering an RNAi reagent to cells comprising a sense strand containing any sequence from Table 4, Table 5, Table 6, or Table 10, and an antisense strand containing any sequence from Table 3 or Table 10.

[0195] In some embodiments, this document discloses a method for inhibiting TSLP gene expression, wherein the method includes administering a TSLP RNAi reagent to a subject, comprising a sense strand consisting of a nucleobase sequence of any sequence from Tables 4, 5, 6, or 10, and an antisense strand consisting of a nucleobase sequence of any sequence from Table 3 or 10. In other embodiments, this document discloses a method for inhibiting TSLP gene expression, wherein the method includes administering a TSLP RNAi reagent to a subject, comprising a sense strand consisting of a modified sequence of any modified sequence from Tables 4, 5, 6, or 10, and an antisense strand consisting of a modified sequence of any modified sequence from Table 3 or 10.

[0196] In some embodiments, this document discloses methods for inhibiting TSLP gene expression in cells, wherein the methods include administering one or more TSLP RNAi reagents comprising a double-stranded structure of one of the double strands shown in Tables 7A, 7B, 8, 9 and 10.

[0197] In some implementations, relative to the corresponding levels in subjects before administration of the TSLP RNAi reagent or in different subjects who did not receive the TSLP RNAi reagent, the TSLP gene expression level and / or TSLP mRNA level in certain lung epithelial cells of subjects to which the TSLP RNAi reagent was administered was reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99%. In some implementations, compared to subjects who had not received the TSLP RNAi reagent or subjects to whom the TSLP RNAi reagent was administered, the levels of TSLP cytokines or circulating TSLP cytokines in certain epithelial cells of subjects to whom the TSLP RNAi reagent was administered were reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99%. Gene expression levels, cytokine or protein levels, and / or mRNA levels in the subjects may be reduced in the subjects' cells, cell populations, serum, and / or tissues. In some implementations, the TSLP cytokine levels in certain subjects to whom the TSLP RNAi reagent has been administered are reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98%, compared to subjects who were not given the TSLP RNAi reagent or who did not receive the TSLP RNAi reagent.

[0198] Decreases in gene expression, mRNA, and cytokine or protein levels can be evaluated using any method known in the art. Decreases or reductions in TSLP cytokine levels or TSLP mRNA levels are sometimes collectively referred to herein as a reduction, decrease, or inhibition of TSLP gene expression. The examples described herein illustrate known methods for evaluating TSLP inhibition.

[0199] Cells, tissues, organs and non-human organisms Cells, tissues, organs, and non-human organisms, including at least one TSLP RNAi reagent described herein, are considered. Cells, tissues, organs, or non-human organisms are prepared by delivering the RNAi reagent to the cell, tissue, organ, or non-human organism.

[0200] References Adhikary, P. P., et al. (2021). "TSLP as druggable target - a silver-lining for atopic diseases " Pharmacol Ther 217: 107648. Al-Shami, A., et al. (2005). "A role for TSLP in the development of inflammation in an asthma model." J Exp Med 202(6): 829-839. Chen, Z. et al. (2018). "Thymic stromal lymphopoietin contribution to the recruitment of circulating fibrocytes to the lung in a mouse model of chronic allergic asthma." J Asthma 55(9): 975-983. Corren, J., et al. (2017). "Tezepelumab in Adults with Uncontrolled Asthma." N Engl J Med 377(10): 936-946. Diver, S., et al. (2021). "Effect of tezepelumab on airway inflammatory cells, remodelling, and hyperresponsiveness in patients with moderate-to-severe uncontrolled asthma (CASCADE): a double-blind, randomised, placebo-controlled, phase 2 trial." Lancet Respir Med 9(11): 1299-1312. Gauvreau, G. M., et al. (2020). "Thymic stromal lymphopoietin: its role and potential as a therapeutic target in asthma." Expert Opin Ther Targets 24(8): 777-792. Hu, Y., et al. (2017). "TSLP signaling blocking alleviates E-cadherin dysfunction of airway epithelium in a HDM-induced asthma model." Cell Immunol 315: 56-63. Li, Y. L., et al. (2010). "Thymic stromal lymphopoietin promotes lung inflammation through activation of dendritic cells." J Asthma 47(2): 117-123. Menzies-Gow, A., et al. (2021). "Tezepelumab in Adults and Adolescents with Severe, Uncontrolled Asthma." N Engl J Med 384(19): 1800-1809. Pandey, A., et al. (2000). "Cloning of a receptor subunit required for signaling by thymic stromal lymphopoietin." Nat Immunol 1(1): 59-64. Parnes, J. R., et al. (2022). "Targeting TSLP in Asthma." J Asthma Allergy 15: 749-765. Pelaia, C., et al. (2021). "Tezepelumab: A Potential New Biological Therapy for Severe Refractory Asthma." Int J Mol Sci 22(9). Puzzovio, P. G., et al. (2022). "Tezepelumab administration in moderate-to-severe uncontrolled asthma: Is it all about eosinophils " J Allergy ClinImmunol 149(5): 1582-1584. Torgerson, D. G., et al. (2011). "Meta-analysis of genome-wide associationstudies of asthma in ethnically diverse North American populations." NatGenet 43(9): 887-892. Ying, S., et al. (2008). "Expression and cellular provenance of thymicstromal lymphopoietin and chemokines in patients with severe asthma andchronic obstructive pulmonary disease." J Immunol 181(4): 2790-2798. Ying, S., et al. (2005). "Thymic stromal lymphopoietin expression isincreased in asthmatic airways and correlates with expression of Th2-attracting chemokines and disease severity." J Immunol 174(12): 8183-8190. Yu, G., et al. (2019). "Thymic stromal lymphopoietin (TSLP) and Toluene-diisocyanate-induced airway inflammation: Alleviation by TSLP neutralizingantibody." Toxicol Lett 317: 59-67. Zhou, B., et al. (2005). "Thymic stromal lymphopoietin as a key initiator of allergic airway inflammation in mice." Nat Immunol 6(10): 1047-1053.

[0201] Other illustrative implementation schemes This document provides certain additional illustrative embodiments of the disclosed technology. These embodiments are illustrative only and do not limit the scope of this disclosure or the appended claims.

[0202] 1. An RNAi reagent for inhibiting the expression of the thymic stromal lymphopoietin gene, comprising: The antisense strand contains at least 17 adjacent nucleotides that differ from any of the sequences provided in Table 2 or Table 3 by 0 or 1 nucleotide; and A sense strand contains a nucleotide sequence that is at least partially complementary to the antisense strand.

[0203] 2. The RNAi reagent of embodiment 1, wherein the antisense strand comprises nucleotides 2-18 of any of the sequences provided in Table 2 or Table 3.

[0204] 3. The RNAi reagent of embodiment 1 or embodiment 2, wherein the sense strand comprises a nucleotide sequence of at least 17 adjacent nucleotides that differ from any of the sequences provided in Table 2 or Table 4 by 0 or 1 nucleotide, and wherein the sense strand has a region that is at least 85% complementary to the antisense strand on the 17 adjacent nucleotides.

[0205] 4. An RNAi reagent of any one of embodiments 1-3, wherein at least one nucleotide of the TSLP RNAi reagent is a modified nucleotide or includes a modified internucleotide bond.

[0206] 5. An RNAi reagent for any of the implementation schemes 1-4, wherein all or substantially all nucleotides are modified nucleotides.

[0207] 6. An RNAi reagent according to any one of embodiments 4-5, wherein the modified nucleotide is selected from: 2'-O-methyl nucleotide, 2'-fluoronucleotide, 2'-deoxynucleotide, 2',3'-cleaved nucleotide mimic, locked nucleotide, 2'-F-arabinonucleotide, 2'-methoxyethyl nucleotide, debased nucleotide, ribitol, reverse nucleotide, reverse 2'-O-methyl nucleotide, reverse 2'-deoxynucleotide, 2'-amino modified nucleotide, 2'-alkyl modified nucleotide, morpholinonucleotide, vinylphosphonate-containing nucleotide, cyclopropylphosphonate-containing nucleotide, and 3'-O-methyl nucleotide.

[0208] 7. The RNAi reagent of embodiment 5, wherein all or substantially all nucleotides are modified with 2'-O-methylnucleotides, 2'-fluoronucleotides, or combinations thereof.

[0209] 8. An RNAi reagent of any one of embodiments 1-7, wherein the antisense strand comprises a nucleotide sequence of any of the modified sequences provided in Table 3.

[0210] 9. An RNAi reagent of any one of embodiments 1-8, wherein the sense strand comprises a nucleotide sequence of any of the modified sequences provided in Table 4.

[0211] 10. The RNAi reagent of embodiment 1, wherein the antisense strand comprises a nucleotide sequence of any of the modified sequences provided in Table 3, and the sense strand comprises a nucleotide sequence of any of the modified sequences provided in Table 4.

[0212] 11. An RNAi reagent according to any one of embodiments 1-10, wherein the sense strand is 18 to 30 nucleotides in length and the antisense strand is 18 to 30 nucleotides in length.

[0213] 12. The RNAi reagent of embodiment 11, wherein the sense strand and antisense strand are each 18 to 27 nucleotides in length.

[0214] 13. The RNAi reagent of embodiment 12, wherein the sense strand and antisense strand are each 18 to 24 nucleotides in length.

[0215] 14. The RNAi reagent of embodiment 13, wherein the sense strand and antisense strand are each 21 nucleotides in length.

[0216] 15. The RNAi reagent of embodiment 14, wherein the RNAi reagent has two blunt ends.

[0217] 16. An RNAi reagent of any one of embodiments 1-15, wherein the sense strand comprises one or two terminal caps.

[0218] 17. An RNAi reagent of any one of embodiments 1-16, wherein the sense strand contains one or two reverse debasement residues.

[0219] 18. The RNAi reagent of embodiment 1, wherein the RNAi reagent comprises a sense strand and an antisense strand, the sense strand and the antisense strand forming a duplex having a structure having any one of the duplexes in Table 7A, Table 7B, Table 8, Table 9 or Table 10.

[0220] 19. The RNAi reagent of embodiment 18, wherein all or substantially all nucleotides are modified nucleotides.

[0221] 20. The RNAi reagent of embodiment 1, comprising an antisense strand, said antisense strand consisting of, substantially consisting of, or containing a nucleotide sequence, said nucleotide sequence being associated with the following nucleotide sequence (5' 3') differs by 0 or 1 nucleotide: AGACAUUUAUUGGUUGUGACC (SEQ ID NO: 836); AGACGUUUAUUGGUUGUGACC (SEQ ID NO: 853); UGACAUUUAUUGGUUGUGACC (SEQ ID NO: 837); UGACGUUUAUUGGUUGUGACC (SEQ ID NO: 856); AGACAUUUAUUGGUUGUGA (SEQ ID NO: 196); UGACAUUUUGGUUGUGA (SEQ ID NO: 197); UUAGCAUUUAUCUGAGUUU (SEQ ID NO: 137); UUAGCAUUUAUCUGAGUUC (SEQ ID NO: 139); UACAUUUAUUGGUUGUGAC (SEQ ID NO: 192); AGACAUUUAUUGGUUGUGACU (SEQ ID NO: 830); UUAGCAUUUAUCUGAGUUUCC (SEQ ID NO: 825); or UACAUUUAUUGGUUGUGACUU (SEQ ID NO: 826).

[0222] 21. The RNAi reagent of embodiment 20, wherein the sense strand consists of, is substantially composed of, or contains a nucleotide sequence, said nucleotide sequence being associated with the following nucleotide sequence (5' 3') differs by 0 or 1 nucleotide: GGUCACAACCAAUAAAUGUCU (SEQ ID NO: 872); GGUCACAACCAAUAAAUGUCA (SEQ ID NO: 873); UCACAACCAAUAAAUGUCU (SEQ ID NO: 461); UCACAACCAAUAAAUGUCA (SEQ ID NO: 462); AAACUCAGAUAAAUGCUAA (SEQ ID NO: 402); G(A 2N )ACUCAGAUAAAUGCUAA (SEQ ID NO: 871); GUCACAACCAAUAAAUGUA (SEQ ID NO: 457) AGUCACAACCAAUAAAUGUCU (SEQ ID NO: 864); GGAAACUCAGAUAAAUGCUAA (SEQ ID NO: 866); or (A 2N )AGUCACAACCAAUAAAUGUA (SEQ ID NO: 863), where (A 2N ) represents 2-aminoadenosine nucleotide.

[0223] 22. An RNAi reagent according to implementation scheme 20 or 21, wherein all or substantially all nucleotides are modified nucleotides.

[0224] 23. The RNAi reagent of embodiment 1, comprising an antisense strand, said antisense strand comprising, consisting of, or substantially consisting of a modified nucleotide sequence, said modified nucleotide sequence being associated with the following nucleotide sequence (5' 3') differs by 0 or 1 nucleotide: cPrpasGfsacauuuaUfuGfgUfuGfugacsc (SEQ ID NO: 649) cPrpasGfsaCfaUfuUfaUfuGfgUfuGfuGfaCfsu (SEQ ID NO: 609); cPrpasGfsacauuuaUfuGfgUfuGfugacsu (SEQ ID NO: 611); cPrpasGfsacguuuaUfuGfgUfuGfugacsc (SEQ ID NO: 681); cPrpasGfsacauuuAfuuGfgUfuGfugacsu (SEQ ID NO: 612); cPrpusUfsagcauuUfauCfuGfaGfuuucsc (SEQ ID NO: 603); cPrpusUfsagcauUfuauCfuGfaGfuuucsc (SEQ ID NO: 606); or cPrpusAfscsAfuUfuAfuUfgGfuUfgUfgAfcUfsu (SEQ ID NO: 594); Where a represents 2′-O-methyladenosine, c represents 2′-O-methylcytidine, g represents 2′-O-methylguanosine, and u represents 2′-O-methyluridine; Af represents 2′-fluoroadenosine, Cf represents 2′-fluorocytidine, Gf represents 2′-fluoroguanosine, and Uf represents 2′-fluorouridine; cPrpa represents 5′-cyclopropylphosphonate-2′-O-methyladenosine; cPrpu represents 5′-cyclopropylphosphonate-2′-O-methyluridine; s represents phosphate thioester bond; and all or substantially all nucleotides on the sense chain are modified nucleotides.

[0225] 24. The RNAi reagent of embodiment 1, wherein the sense strand comprises, consists of, or is substantially composed of a modified nucleotide sequence, said modified nucleotide sequence being associated with the following nucleotide sequence (5' 3') differs by 0 or 1 nucleotide: gsgucacaaCfCfAfauaaaugucu (SEQ ID NO: 714); asgucacaaCfCfAfauaaaugucu (SEQ ID NO: 702); gsgaaacucAfGfAfuaaaugcuaa (SEQ ID NO: 704); a_2NsagucacaAfCfCfaauaaaugua (SEQ ID NO: 701); Where a represents 2′-O-methyladenosine, c represents 2′-O-methylcytidine, g represents 2′-O-methylguanosine, and u represents 2′-O-methyluridine; Af represents 2′-fluoroadenosine, Cf represents 2′-fluorocytidine, Gf represents 2′-fluoroguanosine, and Uf represents 2′-fluorouridine; a_2N represents 2′-O-methyl-2-aminoadenosine; s represents thiophosphate bond; and all or substantially all nucleotides on the antisense strand are modified nucleotides.

[0226] 25. An RNAi reagent of any one of embodiments 20-24, wherein the sense strand further comprises a reverse debasement residue at the 3' end of the nucleotide sequence, at the 5' end of the nucleotide sequence, or at both.

[0227] 26. An RNAi reagent of any one of embodiments 1-25, wherein the RNAi reagent is linked to a target ligand.

[0228] 27. The RNAi reagent of embodiment 26, wherein the targeting ligand has an affinity for a cellular receptor expressed on epithelial cells.

[0229] 28. The RNAi reagent of embodiment 27, wherein the targeting ligand comprises an integrin targeting ligand.

[0230] 29. The RNAi reagent of embodiment 28, wherein the integrin targeting ligand is the αvβ6 integrin targeting ligand.

[0231] 30. The RNAi reagent of embodiment 29, wherein the targeting ligand comprises the following structure: Or its pharmaceutically acceptable salt, or Or its pharmaceutically acceptable salt. in Indicates the connection point with the RNAi reagent.

[0232] 31. An RNAi reagent according to any one of embodiments 26-29, wherein the targeting ligand has a structure selected from: ,in Indicates the connection point with the RNAi reagent.

[0233] 32. The RNAi reagent of embodiment 31, wherein the RNAi reagent is conjugated to a targeting ligand having the following structure: .

[0234] 33. An RNAi reagent according to any one of embodiments 26-32, wherein the targeting ligand is conjugated to the sense strand.

[0235] 34. The RNAi reagent of embodiment 33, wherein the targeting ligand is conjugated to the 5' end of the sense strand.

[0236] 35. An RNAi reagent of any one of embodiments 1-34, wherein the RNAi reagent is a pharmaceutically acceptable salt.

[0237] 36. The RNAi reagent of any one of embodiments 35, wherein the RNAi reagent is a sodium salt.

[0238] 37. A composition comprising an RNAi reagent of any one of embodiments 1-36, wherein the composition further comprises a pharmaceutically acceptable excipient.

[0239] 38. The composition of embodiment 37, further comprising a second RNAi agent capable of inhibiting the expression of the thymic stromal lymphopoietin gene.

[0240] 39. The composition of any one of embodiments 37-38, further comprising one or more additional therapeutic agents.

[0241] 40. A composition of any one of embodiments 37-39, wherein the composition is formulated for administration by inhalation.

[0242] 41. The composition of embodiment 40, wherein the composition is delivered by a metering inhaler, a jet sprayer, a vibrating mesh sprayer, or a soft mist inhaler.

[0243] 42. A composition of any one of embodiments 37-41, wherein the RNAi reagent is a sodium salt.

[0244] 43. A composition of any one of embodiments 37-42, wherein the pharmaceutically acceptable excipient is water for injection.

[0245] 44. The composition of any one of embodiments 37-42, wherein the pharmaceutically acceptable excipient is a buffered saline solution.

[0246] 45. A method for inhibiting TSLP gene expression in cells, the method comprising introducing an effective amount of an RNAi reagent of any one of embodiments 1-35 or a composition of any one of embodiments 37-45 into the cells.

[0247] 46. ​​The method of implementation scheme 45, wherein the cells are inside a subject.

[0248] 47. The method of implementation scheme 46, wherein the subject is a human subject.

[0249] 48. The method of any one of embodiments 45-47, wherein, after the application of the RNAi reagent, the expression of the thymic stromal lymphopoietin gene is suppressed by at least about 30%.

[0250] 49. A method for treating one or more symptoms or diseases associated with increased or elevated levels of TSLP cytokine activity, the method comprising administering to a human subject in need a therapeutically effective amount of a composition of any one of embodiments 37-44.

[0251] 50. The method of implementation scheme 49, wherein the disease is asthma, including but not limited to allergic asthma; chronic obstructive pulmonary disease, including but not limited to chronic bronchitis and emphysema; inflammatory lung diseases; interstitial lung disease (ILD); cystic fibrosis; various other types of fibrosis; infectious diseases (e.g., SARS-CoV-2); acute lung injury (e.g., acute respiratory distress syndrome (ARDS)); pulmonary hypertension; various lung cancers; chronic sinusitis with or without nasal polyps; autoimmune diseases, including but not limited to systemic sclerosis (SSc); and various inflammatory diseases, including but not limited to atopic dermatitis, chronic spontaneous urticaria, and eosinophilic esophagitis.

[0252] 51. The method of implementation scheme 50, wherein the disease is allergic asthma.

[0253] 52. The method of any one of embodiments 45-51, wherein the RNAi reagent is administered at a deposition dose of about 0.01 mg / kg to about 5.0 mg / kg of the subject's body weight.

[0254] 53. The method of any one of embodiments 45-52, wherein the RNAi reagent is administered at a deposition dose of about 0.03 mg / kg to about 2.0 mg / kg of the subject's body weight.

[0255] 54. The method of any one of embodiments 45-53, wherein the RNAi reagent is administered in two or more doses.

[0256] 55. The use of any one of the RNAi reagents in Implementation Schemes 1-36 for the treatment of diseases, conditions or symptoms mediated at least in part by TSLP cytokine activity and / or TSLP gene expression.

[0257] 56. Use of a composition according to any one of embodiments 37-44 for the treatment of at least a portion of a disease, condition, or symptom mediated by thymic stromal lymphopoietin cytokine activity and / or thymic stromal lymphopoietin gene expression.

[0258] 57. Use of a composition according to any one of embodiments 37-44 for manufacturing a pharmaceutical agent for treating at least a portion of a disease, condition, or symptom mediated by thymic stromal lymphopoietin cytokine and / or thymic stromal lymphopoietin gene expression.

[0259] 58. Use of any one of embodiments 55-57, wherein the disease is lung inflammation.

[0260] 59. A method for preparing an RNAi reagent according to any one of embodiments 1-36, comprising annealing the sense strand and antisense strand to form a double-stranded ribonucleic acid molecule.

[0261] 60. The method of embodiment 59, wherein the sense chain comprises a targeting ligand.

[0262] 61. The method of implementation 60, comprising conjugating a target ligand to a sense chain.

[0263] The implementation schemes and projects provided above will now be illustrated by the following non-limiting examples. Example

[0264] Example 1. Synthesis of TSLP RNAi reagent.

[0265] The double strands of the TSLP RNAi reagent disclosed herein were synthesized as follows: A. synthesis.The sense and antisense strands of the TSLP RNAi reagent were synthesized using a solid-phase phosphoramidite technique employed in oligonucleotide synthesis. Depending on scale, MerMade96E® (Bioautomation), MerMade12® (Bioautomation), or OP Pilot 100 (GE Healthcare) were used. Synthesis was performed on a solid support made of controlled-porosity glass (CPG, 500 Å or 600 Å, from Prime Synthesis, Aston, PA, USA). Monomers located at the 3' ends of the respective strands attached to the solid support served as the starting point for synthesis and were commercially available. All RNA and 2'-modified RNA phosphoramidite were purchased from Thermo Fisher Scientific (Milwaukee, WI, USA). Specifically, the 2'-O-methylphosphoramidite used comprised the following: (5'-O-dimethoxytriphenylmethyl-N... 6 -(benzoyl)-2'-O-methyl-adenosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphamide, 5'-O-dimethoxy-triphenylmethyl-N 45'-(acetyl)-2'-O-methylcytidine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphamide, 5'-O-dimethoxytriphenylmethyl-N2-(isobutyryl)-2'-O-methylguanosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphamide, and 5'-O-dimethoxytriphenylmethyl-2'-O-methyluridine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphamide. 2'-Deoxy-2'-fluorophosphamide carries the same protecting group as 2'-O-methylRNAphosphamide (amidite). 5'-Dimethoxytriphenylmethyl-2'-O-methylinosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphamide was purchased from Glen Research. (Virginia). Reverse debasing (3'-O-dimethoxytriphenylmethyl-2'-deoxyribose-5'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphamide was purchased from ChemGenes (Wilmington, MA, USA). The following UNA phosphoramids were used: 5'-(4,4'-dimethoxytriphenylmethyl)-N6-(benzoyl)-2',3'-open-ring-adenosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphamide, 5'(4,4'-dimethoxytriphenylmethyl)-N-acetyl-2',3'-open-ring-cytosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphamide, 5'-(4,4'-dimethoxytriphenylmethyl)-N-acetyl-2',3'-open-ring-cytosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphamide, 5'-(4,4'-dimethoxy... (Triphenylmethyl)-N-isobutyryl-2',3'-open-ring-guanosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramide, and 5'-(4,4'-dimethoxytriphenylmethyl)-2',3'-open-ring-uridine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramide. The TFA-linked phosphoramide was also commercially available (ThermoFisher). Linker L6 as propargyl-PEG5-NHS was purchased from BroadPharm. (Catalogue # BP-20907), and coupled with the NH2-C6 group from the amino-linked phosphoramidite using standard coupling conditions to form -L6-C6-. In each case, the thiophosphate bond was introduced using the conditions set forth herein as specified. Cyclopropylphosphonate phosphoramidite was synthesized according to International Patent Application Publication No. WO 2017 / 214112 (see also Altenhofer et al., Chem. Communications (Royal Soc. Chem.), 57(55):6808-6811 (July 2021)).

[0266] The triyne-containing phosphoramide was dissolved in anhydrous dichloromethane or anhydrous acetonitrile (50 mM), while all other phosphoramides were dissolved in anhydrous acetonitrile (50 mM), and a molecular sieve (3 Å) was added. 5-Benzylthio-1H-tetrazole (BTT, 250 mM acetonitrile solution) or 5-ethylthio-1H-tetrazole (ETT, 250 mM acetonitrile solution) was used as the activating agent solution. Coupling times were 10 min (RNA), 90 s (2' O-Me), and 60 s (2' F). To introduce thiophosphate bonding, a 100 mM solution of 3-phenyl-1,2,4-dithiozolin-5-one (POS, from PolyOrg, Inc., Leominster, MA, USA) in anhydrous acetonitrile was used.

[0267] Alternatively, a triyne moiety is introduced post-synthesis (see section E below). For this pathway, the sense chain is functionalized with a 5' and / or 3' terminal nucleotide containing a primary amine. The TFA-linked phosphorous amide is dissolved in anhydrous acetonitrile (50 mM), and a molecular sieve (3 Å) is added. 5-Benzylthio-1H-tetrazole (BTT, 250 mM acetonitrile solution) or 5-ethylthio-1H-tetrazole (ETT, 250 mM acetonitrile solution) is used as the activator solution. Coupling times are 10 min (RNA), 90 s (2' O-Me), and 60 s (2' F). To introduce thiophosphate bonding, a 100 mM solution of 3-phenyl-1,2,4-dithiozoline-5-one (POS, derived from PolyOrg, Inc., Leominster, MA, USA) in anhydrous acetonitrile is used.

[0268] B. Cutting and deprotection of support-bonded oligomers After solid-phase synthesis, the dried solid support was treated with a 1:1 volume solution of 40% by weight aqueous methylamine and 28% to 31% ammonium hydroxide solution (Aldrich) at 30°C for 1.5 hours. The solution was evaporated, and the solid residue was reconstituted in water (see below).

[0269] C. Purification. The crude oligomers were purified by anion-exchange HPLC using a TSKgel SuperQ-5PW 13µm column and a Shimadzu LC-8 system. Buffer A consisted of 20 mM Tris, 5 mM EDTA, pH 9.0, and 20% acetonitrile, while Buffer B was identical to Buffer A with the addition of 1.5 M sodium chloride. UV traces were recorded at 260 nm. Appropriate fractions were combined and run on size-resistance HPLC using a GE Healthcare XK 16 / 40 column packed with Sephadex G25 Fine, with a run buffer of 100 mM ammonium bicarbonate, pH 6.7, and 20% acetonitrile. Alternatively, the combined fractions were desalted and exchanged via tangential flow filtration into a suitable buffer or solvent system.

[0270] D. Annealing The complementary strands were mixed to form the RNAi reagent by combining equimolar amounts of RNA solutions (sense and antisense) in 1× PBS (phosphate-buffered saline, 1×, Corning, Cellgro). Some of the RNAi reagent was lyophilized and stored at -15 to -25°C. The duplex concentration was determined by measuring the absorbance of the solution in 1× PBS on a UV-Vis spectrometer. The duplex concentration was then determined by multiplying the absorbance of the solution at 260 nm by a conversion factor (0.050 mg / (mL∙cm)) and a dilution factor.

[0271] E. Concatenation of triyne joints In some embodiments, the triyne linker serves as a sense chain conjugation of the phosphorus amide with the RNAi reagent on the resin (see Example 1 for the synthesis of exemplary triyne linker phosphorus amides). G For information on the conjugation of phosphorusamide, please refer to Example 1. A In other embodiments, the triyne connector may be attached to the sense chain after cleavage from the resin as described below: Before or after annealing, in some embodiments, a 5' or 3' amine-functionalized sense chain is attached to the triyne connector. Exemplary triyne connector structures that can be used to form the constructs disclosed herein are as follows: To conjugate the triyne linker with the annealed duplex, the amine-functionalized duplex was dissolved at ~50-70 mg / mL in 90% DMSO / 10% H2O. 40 equivalents of triethylamine were added, followed by 3 equivalents of triyne-PNP. After completion, the conjugate was precipitated twice in a 1x phosphate-buffered saline / acetonitrile (1:14 ratio) solvent system and dried.

[0272] F. Synthesis of the targeting ligand SM6.1 ((S)-3-(4-(4-((14-azido-3,6,9,12-tetraoxatetradecyl)oxy)naphth-1-yl)phenyl)- 3-(2-(4-((4-methylpyridin-2-yl)amino)butyramido)acetamido)propionic acid) Compound 5 (tert-butyl(4-methylpyridin-2-yl)carbamate) (0.501 g, 2.406 mmol, 1 equivalent) was dissolved in DMF (17 mL). NaH (0.116 mg, 3.01 mmol, 1.25 equivalent, 60% dispersion in oil) was added to the mixture. The mixture was stirred for 10 minutes, and then compound 20 (ethyl 4-bromobutyrate (0.745 g, 3.82 mmol, 0.547 mL)) (Sigma 167118) was added. After 3 hours, the reaction was quenched with ethanol (18 mL) and concentrated. The concentrate was dissolved in DCM (50 mL), washed with a saturated aqueous solution of NaCl (1 x 50 mL), dried over Na₂SO₄, filtered, and concentrated. The product was purified on a silica gel column using a DCM solution with a gradient of 0–5% methanol.

[0273] Compound 21 (0.80 g, 2.378 mmol) was dissolved in 100 mL acetone: 0.1 M NaOH [1:1]. The reaction was monitored by TLC (5% ethyl acetate in hexane). The organic matter was concentrated away, and the residue was acidified to pH 3–4 with 0.3 M citric acid (40 mL). The product was extracted with DCM (3 x 75 mL). The organic matter was combined, dried over Na₂SO₄, filtered, and concentrated. The product was used without further purification.

[0274] At 0°C, diisopropylethylamine (2.06 mL, 11.85 mmol, 3 equivalents) was added to anhydrous DMF (10 mL) containing compound 22 (1.1 g, 3.95 mmol, 1 equivalent), compound 45 (595 mg, 4.74 mmol, 1.2 equivalents), and TBTU (1.52 g, 4.74 mmol, 1.2 equivalents). The reaction mixture was heated to room temperature and stirred for 3 hours. The reaction was quenched with saturated NaHCO3 solution (10 mL). The aqueous phase was extracted with ethyl acetate (3 x 10 mL), and the organic phases were combined, dried over anhydrous Na2SO4, and concentrated. The products were separated by CombiFlash® using silica gel as the stationary phase. LC-MS: calculated as [M+H]+ 366.20, found as 367.

[0275] At 0°C, K₂CO₃ (2.48 g, 17.93 mmol, 2 equivalents) was added to an anhydrous DMF (10 mL) solution of compound 61 (2 g, 8.96 mmol, 1 equivalent) and compound 62 (2.13 mL, 17.93 mmol, 2 equivalents). The reaction mixture was heated to room temperature and stirred overnight. The reaction was quenched with water (10 mL). The aqueous phase was extracted with ethyl acetate (3 x 10 mL), and the organic phases were combined, dried over anhydrous Na₂SO₄, and concentrated. The products were separated using CombiFlash® with silica gel as the stationary phase.

[0276] At 0°C, lithium hydroxide monohydrate (0.61 g, 14.53 mmol, 3 equivalents) was added aliquoted to a solution of compound 60 (1.77 g, 4.84 mmol, 1 equivalent) in THF (5 mL) and H₂O (5 mL). The reaction mixture was heated to room temperature. After stirring at room temperature for 3 hours, the reaction mixture was acidified to pH 3.0 with HCl (6 N). The aqueous phase was extracted with ethyl acetate (3 x 20 mL), and the organic layers were combined, dried over Na₂SO₄, and concentrated. LC-MS: calculated as [M+H] + 352.18, found to be 352.

[0277] At 78°C, a hexane solution of n-BuLi (3.6 mL, 9.0 mmol, 1.5 equivalence) was added dropwise to an anhydrous THF (20 mL) solution of compound 63 (1.88 g, 6.0 mmol, 1.0 equivalence). The reaction was maintained at -78°C for 1 hour. Then, triisopropyl borate (2.08 mL, 9.0 mmol, 1.5 equivalence) was added to the mixture at -78°C. The reaction was then heated to room temperature and stirred for another 1 hour. The reaction was quenched with a saturated NH4Cl solution (20 mL) and the pH was adjusted to 3. The aqueous phase was extracted with EtOAc (3 x 20 mL), and the organic phases were combined, dried over Na2SO4, and concentrated.

[0278] Compound 12 (300 mg, 0.837 mmol, 1.0 equivalent), compound 65 (349 mg, 1.256 mmol, 1.5 equivalent), XPhos Pd G2 (13 mg, 0.0167 mmol, 0.02 equivalent), and K3PO4 (355 mg, 1.675 mmol, 2.0 equivalent) were mixed in a round-bottom flask. The flask was sealed with a screw cap and diaphragm, then evacuated and backfilled with nitrogen (this process was repeated a total of 3 times). THF (8 mL) and water (2 mL) were then added via syringe. The mixture was bubbled with nitrogen for 20 minutes and the reaction was kept overnight at room temperature. The reaction was quenched with water (10 mL), and the aqueous phase was extracted with ethyl acetate (3 × 10 mL). The organic phase was dried over Na2SO4, concentrated, and purified using silica gel as the stationary phase via CombiFlash®, eluting with a 15% EtOAc solution in hexane. LC-MS: Calculated as [M+H]+ 512.24, found to be 512.56.

[0279] Compound 66 (858 mg, 1.677 mmol, 1.0 equivalent) was cooled in an ice bath. A dioxane solution of HCl (8.4 mL, 33.54 mmol, 20 equivalent) was added to the flask. The reaction was heated to room temperature and stirred for 1 hour. The solvent was removed by a rotary evaporator, and the product was used directly without further purification. LC-MS: calculated [M+H]+ 412.18, found 412.46.

[0280] At 0°C, diisopropylethylamine (0.744 mL, 4.268 mmol, 3 equivalents) was added to anhydrous DMF (15 mL) solutions of compound 64 (500 mg, 1.423 mmol, 1 equivalent), compound 67 (669 mg, 1.494 mmol, 1.05 equivalents), and TBTU (548 mg, 0.492 mmol, 1.2 equivalents). The reaction mixture was heated to room temperature and stirred for 1 hour. The reaction was quenched with saturated aqueous solution of NaHCO3 (10 mL), and the product was extracted with ethyl acetate (3 x 20 mL). The organic phases were combined, dried over Na2SO4, and concentrated. The product was purified using CombiFlash® with silica gel as the stationary phase and eluted with DCM solution of 3–4% methanol. The yield was 96.23%. LC-MS: calculated as [M+H]+ 745.35, found as 746.08.

[0281] At room temperature, 10% Pd / C (0.15 g, 50% H2O) was added to a 10 mL solution of compound 68 (1.02 g, 1.369 mmol, 1 equivalent) in ethyl acetate. The reaction mixture was heated to room temperature, and the reaction was monitored by LC-MS. The reaction was maintained at room temperature overnight. The solid was filtered through Celite® and the solvent was removed by rotary evaporator. The product was used directly without further purification. LC-MS: [M+H]+ 655.31, found at 655.87.

[0282] At 0°C, K₂CO₃ (42 mg, 0.305 mmol, 2 equivalents) was added to an anhydrous DMF (2 mL) solution of compound 69 (100 mg, 0.152 mmol, 1 equivalent) and azide-PEG5-OTs (128 mg, 0.305 mmol, 2 equivalents). The reaction mixture was stirred at 80°C for 6 hours. The reaction was quenched with saturated NaHCO₃ solution, and the aqueous layer was extracted with ethyl acetate (3 x 10 mL). The organic phases were combined, dried over Na₂SO₄, and concentrated. LC-MS: calculated as [M+H]⁺ 900.40, found as 901.46.

[0283] At room temperature, lithium hydroxide (5 mg, 0.197 mmol, 3.0 equivalent) was added to a solution of compound 72 (59 mg, 0.0656 mmol, 1.0 equivalent) in THF (2 mL) and water (2 mL). The mixture was stirred for another 1 hour at room temperature. The pH was adjusted to 3.0 with HCl (6N), and the aqueous phase was extracted with EtOAc (3 x 10 mL). The organic phases were combined, dried over Na2SO4, and concentrated. TFA (0.5 mL) and DCM (0.5 mL) were added to the residue, and the mixture was stirred for another 3 hours at room temperature. The solvent was removed by rotary evaporator. LC-MS: calculated as [M+H]+ 786.37, found as 786.95.

[0284] Synthesis of G. TriAlk 14 TriAlk14 and (TriAlk14)s, as shown in Table 11 above, may be synthesized using the synthetic routes shown below. Compound 14 may be added to the sense chain as a phosphoramidite using standard oligonucleotide synthesis techniques, or compound 22 may be conjugated to the sense chain containing an amine in an amide coupling reaction.

[0285] Add 500 mL of DCM and 4 (75.0 g, 0.16 mol) to a 3-L jacketed reactor. Cool the internal temperature of the reaction to 0°C and add TBTU (170.0 g, 0.53 mol). Then treat the suspension dropwise with amine 5 (75.5 g, 0.53 mol), keeping the internal temperature below 5°C. Then slowly treat the reaction with DIPEA (72.3 g, 0.56 mol), keeping the internal temperature below 5°C. After the addition is complete, heat the reaction to 23°C over 1 hour and allow stirring for 3 hours. Add 10% of the kicker charge of all three reagents and allow stirring for another 3 hours. The reaction is considered complete when <1% of 4 remains. Wash the reaction mixture with saturated ammonium chloride solution (2 x 500 mL) and once with saturated sodium bicarbonate solution (500 mL). Then dry the organic layer on sodium sulfate and concentrate it to an oil. The crude oil weighed 188 g and contained 72% C6 by QNMR. The crude oil was then carried to the next step. Regarding C6... 46 H 60 N4O 11 The calculated mass is 845.0 m / z. The found [M+H] is 846.0.

[0286] 121.2 g of crude oil containing 72 wt% compound 6 (86.0 g, 0.10 mol) was dissolved in DMF (344 mL) and treated with TEA (86 mL, 20 v / v%) while maintaining an internal temperature below 23 °C. The solution was then analyzed by HPLC method 1 (…). Figure 2 The formation of dibenzo-fullene (DBF) consumed relative to Fmoc-amine 6 was monitored, and the reaction was completed within 10 hours. Glutaric anhydride (12.8 g, 0.11 mol) was added to the solution, and intermediate amine 7 was converted to compound 8 within 2 hours. After completion, DMF and TEA were removed under reduced pressure at 30°C to give 100 g of crude oil. Due to the high solubility of compound 7 in water, aqueous post-treatment could not be used, and chromatography was the only way to remove DBF, TMU, and glutaric anhydride. The crude oil (75 g) was purified in triplicate on a Teledyne ISCO Combi-flash® purification system. The crude oil (25 g) was loaded onto a 330 g silica gel column and eluted from 0–20% methanol / DCM over 30 minutes to give 42 g of compound 8 (54% yield after 3 steps). (Regarding C...) 36 H 55 N4O 12The calculated mass is 736.4 m / z. The found [M+H] is 737.0.

[0287] Compound 8 (42.0 g, 0.057 mol) was co-stripped with 10 volumes of acetonitrile prior to use to remove any residual methanol from the chromatography solvent. The oil was redissolved in DMF (210 mL) and cooled to 0°C. The solution was treated with 4-nitrophenol (8.7 g, 0.063 mol), followed by EDC-hydrochloride (12.0 g, 0.063 mol), and the reaction was found to be complete within 10 hours. The solution was cooled to 0°C, and 10 volumes of ethyl acetate, followed by 10 volumes of saturated ammonium chloride solution, were added, maintaining the internal temperature below 15°C. The layers were allowed to separate, and the ethyl acetate layer was washed with brine. The combined aqueous layers were extracted twice with 5 volumes of ethyl acetate. The combined organic layers were dried over sodium sulfate and concentrated to oil. The crude oil (55 g) was purified in triplicate on a Teledyne ISCO Combi-Flash® purification system. The crude oil (25 g) was loaded onto a 330 g silica gel column and eluted from 0–10% methanol / DCM over 30 minutes to give 22 g of pure compound 9 (compound 22) (50% yield). Regarding C... 42 H 59 N5O 14 The calculated mass is 857.4 m / z. The found [M+H] is 858.0.

[0288] A solution of ester 9 (49.0 g, 57.1 mmol) and 6-amino-1-hexanol (7.36 g, 6.28 mmol) in dichloromethane (3 volumes) was treated dropwise with triethylamine (11.56 g, 111.4 mmol). The reaction was monitored by observing the disappearance of compound 9 on HPLC method 1, and it was found that the reaction was completed within 10 minutes. The crude reaction mixture was diluted with 5 volumes of dichloromethane and washed with saturated ammonium chloride (5 volumes) and brine (5 volumes). The organic layer was dried over sodium sulfate and concentrated to an oil. The crude oil was purified using a Teledyne ISCO Combi-flash® purification system on a 330 g silica gel column. 4-Nitrophenol was eluted with 100% ethyl acetate and washed from the column for 10 minutes with 20% methanol / DCM to give a colorless oil (39 g, 81% yield). (Note: C...) 42 H 69 N5O 12 The calculated mass is 836.0 m / z. The found [M+H] is 837.0.

[0289] Alcohol 10 was co-stripped twice with 10 volumes of acetonitrile to remove any residual methanol from the chromatography solvent, and then co-stripped once with anhydrous dichloromethane (KF < 60 ppm) to remove trace amounts of water. Alcohol 10 (2.30 g, 2.8 mmol) was dissolved in 5 volumes of anhydrous dichloromethane (KF < 50 ppm) and treated with diisopropylammonium tetrazolium (188 mg, 1.1 mmol). The solution was cooled to 0°C and treated dropwise with 2-cyanoethyl N,N,N',N'-tetraisopropylphosphonamide (1.00 g, 3.3 mmol). The solution was removed from the ice bath and stirred at 20°C. The reaction was found to be complete within 3–6 hours. The reaction mixture was cooled to 0°C and treated with 10 volumes of a 1:1 solution of saturated ammonium bicarbonate / brine, then heated to ambient temperature over 1 minute and allowed to stir for another 3 minutes at 20°C. The two-phase mixture was transferred to a separatory funnel and 10 volumes of dichloromethane were added. The organic layer was separated and washed with 10 volumes of saturated sodium bicarbonate solution to hydrolyze the unreacted diphosphorus reagent. The organic layer was dried over sodium sulfate and concentrated to an oil to give 3.08 g of 94% by weight compound 14. (Regarding C...) 51 H 86 N7O 13 The calculated mass of P is 1035.6 m / z. The found [M+H] = 1036.

[0290] H. Target ligand conjugation.Before or after annealing, the 5' or 3' tridentate alkyne-functionalized sense chain is conjugated with the target ligand. The following example describes the conjugation of the target ligand with the annealed duplex: 0.5 M tris(3-hydroxypropyltriazolylmethyl)amine (THPTA), 0.5 M copper(II) sulfate pentahydrate (Cu(II)SO4·5H2O), and a 2 M solution of sodium ascorbate were prepared in deionized water. A 75 mg / mL solution of the target ligand in DMSO was prepared. 25 µL of 1 M HEpes pH 8.5 buffer was added to a 1.5 mL centrifuge tube containing the trikyne-functionalized duplex (3 mg, 75 µL, 40 mg / mL deionized water, ~15,000 g / mol). After vortexing, 35 µL of DMSO was added, and the solution was vortexed. Add the targeting ligand to the reaction (6 equivalents / dichain, 2 equivalents / alkyne, ~15 μL) and vortex the solution. Check the pH using pH paper and confirm it is ~8. In a separate 1.5 mL centrifuge tube, mix 50 µL of 0.5 M THPTA with 10 µL of 0.5 M Cu(II)SO4·5H2O, vortex, and incubate at room temperature for 5 minutes. After 5 minutes, add the THPTA / Cu solution (7.2 µL, 6 equivalents 5:1 THPTA:Cu) to the reaction vial and vortex. Immediately afterwards, add 2 M ascorbate (5 µL, 50 equivalents / dichain, 16.7 / alkyne) to the reaction vial and vortex. Once the reaction is complete (usually within 0.5–1 hour), immediately purify the reaction by non-denaturing anion exchange chromatography.

[0291] Example 2. In vivo administration of TSLP knockdown delivered via an intratracheal microneedle in a rat airway inflammation model Anti-inflammatory effect.

[0292] On days 1 and 3 of the study, male Sprague Dawley rats were administered a 5 mg / kg dose of either a rat-specific RNAi reagent (designated AC001714) linked to a Tri-SM6.1-αvβ6 integrin-targeting ligand or a saline medium. A 200 µL volume was loaded into a syringe connected to a microneedling device (PennCentury, Philadelphia, PA) for intratracheal administration.

[0293] AC001714 contains a rat-specific sequence designed to target the rat TSLP transcript (NCBI GenBank XM_008772052.2), and is not homologous to the human TSLP gene, and is chemically modified as follows: Modified semantic chain (5') 3’)： Tri-SM6.1-αvb6-(TA14)-gsa_2NaucaaaCfCfUfcacaaauucus(invAb) (SEQ IDNO: 782) Modified antisense chain (5') 3’)： cPrpasGfsasAfuUfuGfuGfaGfgUfuUfgAfuUfsc (SEQ ID NO: 587).

[0294] On day 14, rats were administered a single intratracheal dose of 400 µg / rat of Alternaria alternifolia prepared in phosphate-buffered saline (PBS). Alternaria alternata Rats in group 1 were attacked with PBS only.

[0295] Table 12. Rat-specific TSLP RNAi reagents and administration methods used in Example 2. Group ID AC double strand numbering Animals / Groups Harvest / Execution Day Group 1 (Saline IT, Days 1 & 3) (PBSIT, Day 14) N / A 4 Day 15 Group 2 (Saline IT days 1 & 3) (Alternaria () IT day 14) N / A 7 Day 15 Group 3 (Saline IT on days 1 and 3) (Alternaria IT on day 14) N / A 7 Day 16 Group 4 (Saline IT on days 1 and 3) (Alternaria IT on day 14) N / A 5 Day 17 Group 5 (IT dose 5.0 mg / kg AC001714 on days 1 and 3) / (Alternaria IT on day 14) AC001714 7 Day 15 Group 6 (IT dose 5.0 mg / kg AC001714 on days 1 and 3) / (Alternaria IT on day 14) AC001714 5 Day 16 Group 7 (IT dose 5.0 mg / kg AC001714 on days 1 and 3) / (Alternaria IT on day 14) AC001714 5 Day 17

[0296] Rats were anesthetized with isoflurane / O2 24, 48, or 72 hours after Alternaria administration (i.e., day 15, 16, or 17), blood was drawn, and euthanasia was performed by exsanguination. The number of days for sacrifice / euthanasia is shown in Table 12 above. Tracheal intubation was performed, and bronchoalveolar lavage fluid (BAL) was collected after washing with 2 x 5 mL of ice-cold PBS. The BAL samples were rotated downwards, cells were resuspended with 1 mL of ice-cold PBS, and aliquots were mixed with Turk's solution (1:1 ratio), and total cells were counted using hemocytomers. Cytospins were prepared, stained, and cell classification and counting were performed. The supernatant was used for cytokine measurements. The right lung lobe was used to determine rTSLP mRNA expression, and the left lung lobe was collected in 4% PFA / PBS for histology (trichrome staining and Sirius red staining, RNAscope).

[0297] Rat TSLP mRNA expression was quantified by probe-based quantitative PCR, normalized to rat B2M expression, and expressed as a score (geometric mean, + / - 95% confidence interval) in the mediator control group.

[0298] Table 13. Mean relative rat TSLP mRNA expression at sacrifice (i.e., day 15, 16, or 17) in Example 2 Group ID Average relative rTSLP mRNA expression Low (error) High (error) Group 1 (Saline IT on days 1 and 3) (PBS IT on day 14) 1.000 0.228 0.296 Group 2 (Saline IT days 1 & 3) (Alternaria IT day 14) 0.787 0.149 0.183 Group 3 (Saline IT on days 1 and 3) (Alternaria IT on day 14) 1.072 0.151 0.176 Group 4 (Saline IT on days 1 and 3) (Alternaria IT on day 14) 0.828 0.121 0.142 Group 5 (IT dose 5.0 mg / kg AC001714 on days 1 and 3) / (Alternaria IT on day 14) 0.387 0.098 0.131 Group 6 (IT dose 5.0 mg / kg AC001714 on days 1 and 3) / (Alternaria IT on day 14) 0.379 0.102 0.139 Group 7 (IT dose 5.0 mg / kg AC001714 on days 1 and 3) / (Alternaria IT on day 14) 0.459 0.095 0.121

[0299] As shown in Table 13 above, the groups administered AC001714 (i.e., groups 5, 6, and 7) showed a reduction of approximately 45-65% in rTSLP mRNA at their respective times of sacrifice, relative to the respective control groups (groups 2, 3, and 4).

[0300] Granulocytes (both eosinophils and neutrophils) are well-known markers of cellular inflammation. For BAL samples, total and differentiated cells were counted, and the number of inflammatory cells was determined. The effect of rTSLP inhibition by the rat-specific TSLP RNAi reagent disclosed herein on eosinophilic inflammation induced by Alternaria extract was evaluated. When compared with their respective controls, groups 5–7 (treated with the rat-specific TSLP RNAi reagent) showed significant reductions in total BAL cell counts, lymphocytes, and neutrophils across all time points. Furthermore, a significant reduction in eosinophils was observed at the 72-hour time point (group 7) compared to group 4. In addition, total BAL protein was significantly reduced at both the 24-hour and 72-hour time points (groups 5 and 7) compared to the controls groups 2 and 4, respectively.

[0301] Other biomarkers, such as IL-18 and VEGF, also indicate cellular inflammation. In the *Alternaria*-attacked groups, administration of rat-specific RNAi reagents (groups 5, 6, and 7) resulted in reductions in these pro-inflammatory biomarkers compared to groups not treated with the RNAi reagent. This study provides physiological support in a rat model that approximately 45% or more reduction in TSLP gene expression can provide phenotypic improvement to alleviate lung inflammation and thus potentially treat diseases such as allergic asthma.

[0302] Example 3. In vivo administration of TSLP knockdown delivered via an intratracheal microneedle in a rat airway inflammation model Anti-inflammatory effect.

[0303] On days 1 and 3 of the study, male Brown-Norway rats were administered a 5 mg / kg dose of a rat-specific RNAi agent (designated AC001714 or AC002515) linked to a Tri-SM6.1-αvβ6 integrin-targeting ligand, or a saline medium. Additionally, a “RISC-blocking” RNAi trigger was used, comprising a construct similar to AC001714, including the same targeting ligand, but including chemical modifications designed to prevent antisense strand loading into the RISC, thus serving as a negative control. A 200 µL volume was loaded into a syringe connected to a microneedling device (PennCentury, Philadelphia, PA) for intratracheal administration.

[0304] AC001714 comprises a rat-specific sequence designed to target the rat TSLP transcript (NCBI GenBank XM_008772052.2) and is not homologous to the human TSLP gene. Its chemical structure is shown in Example 2 above.

[0305] AC002515 is also designed to target rat-specific sequences at different locations on the rat TSLP transcript (NCBI GenBank XM_008772052.2), which are not homologous to the human TSLP gene and are chemically modified as follows: Modified semantic chain (5') 3’)： Tri-SM6.1-αvb6-(TA14)-csugaaacuGfAfGfagaaaugguas(invAb) (SEQ ID NO:783) Modified antisense chain (5') 3’)： cPrpusAfscsCfaUfuucucUfcAfgUfuUfcasg (SEQ ID NO: 588) On day 14, rats were challenged with a single intratracheal dose of 500 µg / rat of Alternaria alternifolia prepared in PBS. Rats in group 1 were administered PBS only as a control.

[0306] Table 14. Rat-specific TSLP RNAi reagents and administration methods used in Example 3. Group ID AC double strand numbering Animals / Groups Harvest / Execution Day Group 1 (Saline IT on days 1 and 3) (PBS IT on day 15) N / A 6 Day 16 Group 2 (Saline IT on days 1 and 3) (Alternaria IT on day 15) N / A 6 Day 16 Group 3 (Saline IT on days 1 and 3) (IT dose on days 1 and 3: 5.0 mg / kg, trigger for RISC blockade) / (Alternaria IT on day 15) RISC-blocking RNAi triggers 6 Day 16 Group 4 (IT dose 5.0 mg / kg AC001714 on days 1 and 3) / (Alternaria IT on day 15) AC001714 7 Day 16 Group 5 (IT dose 5.0 mg / kg AC002515 on days 1 and 3) / (Alternaria IT on day 15) AC002515 7 Day 16

[0307] Twenty-four hours after Alternaria administration (i.e., day 16), rats were anesthetized with isoflurane / O2, blood was drawn, and euthanasia was performed by exsanguination. The number of days for sacrifice / euthanasia is shown in Table 14 above. Tracheal intubation was performed, and bronchoalveolar lavage fluid (BAL) was collected after washing with 2 x 5 mL of ice-cold PBS. The BAL samples were rotated downwards, cells were resuspended with 1 mL of ice-cold PBS, and aliquots were mixed with Turk's solution (1:1 ratio), and total cells were counted via a hemocytometer. Cell smears were prepared, stained, and cell classification and counting were performed. The supernatant was used for cytokine measurements. The right lung lobe was used to determine rTSLP mRNA expression, and the left lung lobe was collected in 4% PFA / PBS for histology (trichrome staining and Sirius red staining, RNAscope).

[0308] Rat TSLP mRNA expression was quantified by probe-based quantitative PCR, normalized to rat B2M expression, and expressed as a score (geometric mean, + / - 95% confidence interval) in the mediator control group.

[0309] Table 15. Mean relative rat TSLP mRNA expression at sacrifice (i.e., day 16) in Example 3 Group ID Average relative rTSLP mRNA expression Low (error) High (error) Group 1 (Saline IT on days 1 and 3) (PBS IT on day 15) 1.232 0.224 0.273 Group 2 (Saline IT on days 1 and 3) (Alternaria IT on day 15) 1.000 0.143 0.167 Group 3 (Saline IT on days 1 and 3) (IT dose on days 1 and 3: 5.0 mg / kg, trigger for RISC blockade) / (Alternaria IT on day 15) 0.953 0.144 0.170 Group 4 (IT dose 5.0 mg / kg AC001714 on days 1 and 3) / (Alternaria IT on day 15) 0.382 0.109 0.153 Group 5 (IT dose 5.0 mg / kg AC002515 on days 1 and 3) / (Alternaria IT on day 15) 0.598 0.096 0.115

[0310] As shown in Table 15 above, the groups treated with AC001714 (group 4) and AC002515 (group 5) each showed a reduction in TSLP mRNA, with AC001714 showing approximately 62% inhibition. This is also shown in... Figure 6A middle.

[0311] IL-13 and IL-33 are Th2 cytokines and are known indicators of inflammation in the lungs. Rat IL-13 mRNA expression and rat IL-33 mRNA expression were similarly quantified by probe-based quantitative PCR, normalized for rat B2M expression, and expressed as scores in the mediator control group (geometric mean, + / - 95% confidence interval).

[0312] Table 16. Mean relative rat IL-13 mRNA expression at sacrifice (i.e., day 16) in Example 3 Group ID Average relative rIL-13 mRNA expression Low (error) High (error) Group 1 (Saline IT on days 1 and 3) (PBS IT on day 15) 1.000 0.279 0.387 Group 2 (Saline IT on days 1 and 3) (Alternaria IT on day 15) 4.018 2.735 8.564 Group 3 (Saline IT on days 1 and 3) (IT dose on days 1 and 3: 5.0 mg / kg, trigger for RISC blockade) / (Alternaria IT on day 15) 10.727 4.676 8.290 Group 4 (IT dose 5.0 mg / kg AC001714 on days 1 and 3) / (Alternaria IT on day 15) 1.637 0.856 1.793 Group 5 (IT dose 5.0 mg / kg AC002515 on days 1 and 3) / (Alternaria IT on day 15) 1.151 0.652 1.506

[0313] Table 17. Mean relative rat IL-33 mRNA expression at sacrifice (i.e., day 16) in Example 3 Group ID Average relative rIL-33 mRNA expression Low (error) High (error) Group 1 (Saline IT on days 1 and 3) (PBS IT on day 15) 1.000 0.286 0.401 Group 2 (Saline IT on days 1 and 3) (Alternaria IT on day 15) 1.366 0.395 0.556 Group 3 (Saline IT on days 1 and 3) (IT dose on days 1 and 3: 5.0 mg / kg, trigger for RISC blockade) / (Alternaria IT on day 15) 1.710 0.215 0.246 Group 4 (IT dose 5.0 mg / kg AC001714 on days 1 and 3) / (Alternaria IT on day 15) 0.848 0.297 0.458 Group 5 (IT dose 5.0 mg / kg AC002515 on days 1 and 3) / (Alternaria IT on day 15) 0.792 0.172 0.220

[0314] As shown in Tables 16 and 17 above, the groups treated with AC001714 (Group 4) and AC002515 (Group 5) after being challenged by *Alternaria* showed cytokine levels maintained at similar levels to the untreated group (Group 1), indicating a preventative effect. In contrast, both the *Alternaria* group without RNAi treatment (Group 2) and the *Alternaria* group treated with an RNAi trigger that could not inhibit rTSLP gene expression by RISC showed significant increases in IL-13 and IL-33, indicating pneumonia. This IL-13 mRNA level was also observed in... Figure 6B In the middle, and IL-33 is shown in Figure 6C middle.

[0315] Furthermore, as noted in the previous examples, granulocytes (both eosinophils and neutrophils) are well-known markers of cellular inflammation. For BAL samples, total cells and differentiated cells were counted, and the number of inflammatory cells was determined. The effect of rTSLP inhibition by the rat-specific TSLP RNAi reagent disclosed herein on eosinophilic inflammation induced by Alternaria extract was evaluated. Groups 4 and 5 (treated with the rat-specific TSLP RNAi reagent) showed a significant reduction in lymphocytes. The negative control group (group 3) did not show such changes, confirming that the reduction was due to a decrease in TSLP mRNA. Furthermore, a trend toward decreased BAL total protein, eosinophil, and total BAL cell counts was observed only in the two treatment groups (groups 4 and 5). In addition, soluble collagen content was significantly reduced in both treatment groups (groups 4 and 5) relative to the Alternaria control (group 2).

[0316] Other biomarkers, such as IL-13, IL-5, leptin, MCP-1, RATES, TNF-α, and IP-10, also indicate cellular inflammation. In the Alternaria attack groups, compared with the groups without RNAi reagent (Group 2) and the negative control trigger group (Group 3), the administration of rat-specific RNAi reagents (Groups 4 and 5) resulted in a trend showing a reduction in each of these pro-inflammatory biomarkers.

[0317] As shown in Figure 6D, compared with the Alternaria control group without RNAi reagent (Group 2) and the Alternaria group with negative control RISC blocking (Group 3), the rat-specific TSLP RNAi reagent significantly reduced BAL soluble collagen (Groups 4 and 5). Statistical significance is expressed as p < 0.05.

[0318] As shown in Figures 6E (BAL IL-5) and 6F (BAL IL-13), the rat-specific TSLP RNAi reagent (groups 4 and 5) also achieved a reduction in IL-5 and IL-13 compared with the Alternaria control group without RNAi reagent (group 2) and the Alternaria group with negative control RISC blocking (group 3).

[0319] Double-stranded RNAscope staining of TSLP and ITGB6 confirmed TSLP expression in airway epithelium. Co-staining of TSLP RNAscope and Sftpc IHC confirmed TSLP expression in alveolar type 2 cells.

[0320] Example 4. AAV9-CAG-hTSLP AAV mouse model.

[0321] The following procedure was used to evaluate TSLP RNAi reagents in an AAV mouse model. To evaluate certain TSLP RNAi reagents, an AAV9-CAG-hTSLP (adeno-associated virus) mouse model was used. The transgenic sequence included human TSLPCDS with a 3' UTR. Female C57BL / 6 mice aged 6 to 8 weeks were transduced with human TSLP using AAV with serotype 9 (specifically, AAV9-CAG-hTSLP) and with eGFP using AAV9-CAG-eGFP. AAV was administered intratracheally to the mice several weeks prior to intratracheal administration of the TSLP RNAi reagent or control. The genome of the AAV9-CAG-hTSLP.UTRs construct contained the human TSLP cDNA sequence (GenBank NM_033035.5). eGFP was used as a control to normalize human TSLP mRNA expression by qPCR. AAV-hTSLP mouse model was established by intratracheal (IT) delivery of 2e10 GC AAV mixed in 50 µL of PBS into mice. Lung tissue was collected 2–3 weeks after RNAi reagent administration.

[0322] Human TSLP mRNA expression in lung tissue was measured using qPCR.

[0323] On days 1 and 3, each mouse was given 50 μL of AAV solution containing 2e10 GC (genome copies) of AAV9-CAG-eGFP and 2e10 GC of AAV9-CAG-hTSLP in PBS, or a mediator control (PBS). On days 30 and 31, according to Table 18 below, each mouse was given 50 μL intratracheally of different dose levels of TSLP RNAi reagent prepared in isotonic saline, or a mediator control (isotonic saline without RNAi reagent). Mice were humanely euthanized and harvested on day 44.

[0324] Table 18. Target locations and dosing groups in Example 4.

[0325] Each TSLP RNAi reagent comprises a modified nucleotide conjugated to an αvβ6 integrin targeting ligand at the 5' end of the sense strand, having the modified sequence shown in the double-stranded structure described herein. (For specific modification and structural information relating to TSLP RNAi reagents including Tri-SM6.1-αvβ6, see Tables 3, 4, 5, 6, 7A, 7B, 8, 9, 10, and 11). Each TSLP RNAi reagent in groups 3–8 comprises a nucleotide sequence designed to repress TSLP gene expression by targeting specific sites on TSLP mRNAs as shown in Table 18 above. (For the TSLP mRNA sequences mentioned, see, for example, SEQ ID NO:1 and Table 2.)

[0326] Five (5) mice in each group were tested (n=5), except for group 1, which tested only 4 mice. TSLP mRNA expression levels were determined by qPCR. Data from the experiments are shown in Table 19 below: Table 19. Mean relative TSLP normalized to control in AAV-hTSLP mice from Example 4. Group ID Average relative hTSLP mRNA expression Low (error) High (error) Group 1 (PBS IT days 1 & 3) (Saline IT days 30 & 31) N / A Group 2 (AAV days 1 & 3) (Saline IT days 30 & 31) 1.000 0.097 0.108 Group 3 (AAV IT on days 1 and 3) (0.5 mg / kg AC003096 IT on days 30 and 31) 0.826 0.159 0.197 Group 4 (AAV IT on days 1 and 3) (0.5 mg / kg AC003097 IT on days 30 and 31) 0.737 0.187 0.250 Group 5 (AAV IT on days 1 and 3) (0.5 mg / kg AC003098 IT on days 30 and 31) 0.882 0.145 0.174 Group 6 (AAV IT on days 1 and 3) (0.5 mg / kg AC003099 IT on days 30 and 31) 0.701 0.050 0.054 Group 7 (AAV IT on days 1 and 3) (0.5 mg / kg AC003100 IT on days 30 and 31) 0.576 0.085 0.099 Group 8 (AAV IT on days 1 and 3) (0.5 mg / kg AC003101 IT on days 30 and 31) 0.930 0.158 0.191 Group 9 (AAV IT on days 1 and 3) (0.5 mg / kg AC003128 IT on days 30 and 31) 0.522 0.092 0.112 Group 10 (AAV IT on days 1 and 3) (0.5 mg / kg AC003129 IT on days 30 and 31) 0.745 0.093 0.106 Group 11 (AAV IT on days 1 and 3) (0.5 mg / kg AC003130 IT on days 30 and 31) 0.697 0.198 0.277

[0327] As shown in Table 19 above, each TSLP RNAi reagent showed a certain reduction in hTSLP expression compared to the control. Of particular note was that group 7 (AC003100, targeting TSLP gene position 571) showed an approximately 42% reduction in hTSLP mRNA (0.576), and group 9 (AC003128, targeting TSLP gene position 520) showed an approximately 48% reduction (0.522) at day 44, providing substantially greater knockdown than the other TSLP RNAi reagents tested.

[0328] Example 5. AAV9-CAG-hTSLP AAV mouse model.

[0329] To evaluate certain TSLP RNAi reagents, the same AAV9-CAG-hTSLP (adeno-associated virus) mouse model discussed in Example 4 was used.

[0330] Human TSLP mRNA expression in mouse lung tissue was measured by qPCR.

[0331] On days 1 and 3, each mouse was given 50 μL of AAV solution containing 2e10 GC (genome copies) of AAV9-CAG-eGFP and 3e10 GC of AAV9-CAG-hTSLP in PBS, or a vector control (PBS). On day 15, according to Table 20 below, each mouse was given 50 μL intratracheally of different dose levels of TSLP RNAi reagent prepared in isotonic saline, or a vector control (isotonic saline without RNAi reagent). Mice were humanely euthanized and harvested on day 31.

[0332] Table 20. Target location and administration group for Example 5.

[0333] Each TSLP RNAi reagent comprises a modified nucleotide conjugated to an αvβ6 integrin targeting ligand at the 5' end of the sense strand, having the modified sequence shown in the double-stranded structure described herein. (For specific modification and structural information relating to TSLP RNAi reagents including Tri-SM6.1-αvβ6, see Tables 3, 4, 5, 6, 7A, 7B, 8, 9, 10, and 11). The TSLP RNAi reagents in groups 3–8 each comprise a nucleotide sequence designed to repress TSLP gene expression by targeting specific sites on TSLP mRNAs as shown in Table 20 above. (For the TSLP mRNA sequences mentioned, see, for example, SEQ ID NO:1 and Table 2.)

[0334] Five (5) mice in each group were tested (n=5), except for group 1, in which only 4 mice were tested. Left lung lobes were collected in 4% PFA for histological analysis. Right lower lobe lobes were collected for human TSLP protein measurement via the Meso Scale Discovery (MSD) Assay. All remaining right lobes were collected for TSLP mRNA expression measurement via qPCR. Data from the experiments are shown in Table 21 below: Table 21. Mean relative TSLP normalized to control in AAV-hTSLP mice from Example 5. Group ID Average relative hTSLP mRNA expression Low (error) High (error) Group 1 (PBS IT days 1 & 3) (Saline IT day 15) N / A Group 2 (AAV Days 1 & 3) (Saline IT Day 15) 1.000 0.077 0.083 Group 3 (AAV IT on days 1 and 3) (3.0 mg / kg AC003100 IT on day 15) 0.448 0.077 0.092 Group 4 (AAV IT on days 1 and 3) (1.5 mg / kg AC003100 IT on day 15) 0.484 0.055 0.062 Group 5 (AAV IT on days 1 and 3) (0.75 mg / kg AC003100 IT on day 15) 0.642 0.078 0.088 Group 6 (AAV IT on days 1 and 3) (3.0 mg / kg AC003128 IT on day 15) 0.562 0.098 0.118 Group 7 (AAV IT on days 1 and 3) (1.5 mg / kg AC003128 IT on day 15) 0.705 0.149 0.190 Group 8 (AAV IT on days 1 and 3) (0.75 mg / kg AC003128 IT on day 15) 0.800 0.074 0.082 Group 9 (AAV IT on days 1 and 3) (3.0 mg / kg AC003099 IT on day 15) 0.518 0.100 0.124 Group 10 (AAV IT on days 1 and 3) (3.0 mg / kg AC003252 IT on day 15) 0.576 0.124 0.157 Group 11 (AAV IT on days 1 and 3) (3.0 mg / kg AC003253 IT on day 15) 0.508 0.127 0.170

[0335] As shown in Table 21 above, the TSLP RNAi reagents each showed a certain reduction in hTSLP expression compared to the control, with further dose-response observed for AC003100 and AC003128. Group 2 (3.0 mg / kg AC003100, targeting TSLP gene position 571) showed an approximately 55% reduction in hTSLP mRNA (0.448). Furthermore, hTSLP protein expression in the right lower lobe of collected mouse lung tissue was measured by MSD assay for some of the dosing groups, and data from certain samples showed… Figure 2 In the middle. For example Figure 2 As shown in the figure, an 82% reduction in hTSLP protein was observed from group 6 (3 mg / kg AC003128), which targets the TSLP gene at position 520; significant reductions in hTSLP protein were also demonstrated with other groups.

[0336] Example 6. AAV9-CAG-hTSLP AAV mouse model.

[0337] To evaluate certain TSLP RNAi reagents, the same AAV9-CAG-hTSLP (adeno-associated virus) mouse model discussed in Example 4 was used.

[0338] Human TSLP mRNA expression in mouse lung tissue was measured by qPCR.

[0339] On days 1 and 3, each mouse was given 50 μL of AAV solution containing 2e10 GC (genome copies) of AAV9-CAG-eGFP and 3e10 GC of AAV9-CAG-hTSLP in PBS, or a vector control (PBS). On days 17 and 20, each mouse was given 50 μL intratracheally of 1.5 mg / kg of TSLP RNAi reagent prepared in isotonic saline, or a vector control (isotonic saline without RNAi reagent), according to Table 22 below. Mice were humanely euthanized and harvested on day 31.

[0340] Table 22. Target locations and administration groups in Example 6.

[0341] Each TSLP RNAi reagent comprises a modified nucleotide conjugated to an αvβ6 integrin targeting ligand at the 5' end of the sense strand, having the modified sequence shown in the double-stranded structure described herein. (For specific modification and structural information relating to TSLP RNAi reagents including Tri-SM6.1-αvβ6, see Tables 3, 4, 5, 6, 7A, 7B, 8, 9, 10, and 11). Each TSLP RNAi reagent in groups 3–8 comprises a nucleotide sequence designed to repress TSLP gene expression by targeting specific sites on TSLP mRNA as shown in Table 22 above. (For the TSLP mRNA sequences mentioned, see, for example, SEQ ID NO:1 and Table 2.)

[0342] Five (5) mice in each group were tested (n=5), except for group 1, which tested only 4 mice. TSLP mRNA expression levels were determined by qPCR. Data from the experiments are shown in Table 23 below: Table 23. Mean relative TSLP normalized to control in AAV-hTSLP mice from Example 6. Group ID Average relative hTSLP mRNA expression Low (error) High (error) Group 1 (PBS IT days 1 & 3) (Saline IT days 17 & 20) N / A Group 2 (AAV days 1 & 3) (Saline IT days 17 & 20) 1.000 0.232 0.302 Group 3 (AAV IT on days 1 and 3) (1.5 mg / kg AC003128 IT on days 17 and 20) 0.685 0.183 0.249 Group 4 (AAV IT on days 1 and 3) (1.5 mg / kg AC003341 IT on days 17 and 20) 0.512 0.130 0.174 Group 5 (AAV IT on days 1 and 3) (1.5 mg / kg AC003342 IT on days 17 and 20) 0.453 0.077 0.093 Group 6 (AAV IT on days 1 and 3) (1.5 mg / kg AC003343 IT on days 17 and 20) 0.552 0.207 0.332 Group 7 (AAV IT on days 1 and 3) (1.5 mg / kg AC003344 IT on days 17 and 20) 0.495 0.116 0.151 Group 8 (AAV IT on days 1 and 3) (1.5 mg / kg AC003345 IT on days 17 and 20) 0.434 0.086 0.108 Group 9 (AAV IT on days 1 and 3) (1.5 mg / kg AC003346 IT on days 17 and 20) 0.613 0.188 0.271 Group 10 (AAV IT on days 1 and 3) (1.5 mg / kg AC003347 IT on days 17 and 20) 0.595 0.173 0.243 Group 11 (AAV IT on days 1 and 3) (1.5 mg / kg AC003100 IT on days 17 and 20) 0.847 0.229 0.313

[0343] As shown in Table 23 above, each of the tested TSLP RNAi reagents showed a decrease in hTSLP expression compared to the control. Specifically, group 5 (AC003342 at 1.5 mg / kg, targeting TSLP gene position 520) showed an approximately 55% decrease in hTSLP mRNA (0.453), and group 8 (AC003345 at 1.5 mg / kg, also targeting TSLP gene position 520) showed an approximately 57% decrease in hTSLP mRNA (0.434).

[0344] Example 7. AAV9-CAG-hTSLP AAV mouse model.

[0345] To evaluate certain TSLP RNAi reagents, the same AAV9-CAG-hTSLP (adeno-associated virus) mouse model discussed in Example 4 was used.

[0346] Human TSLP mRNA expression in mouse lung tissue was measured by qPCR.

[0347] On days 1 and 3, each mouse was given 50 μL of AAV solution containing 2e10 GC (genome copies) of AAV9-CAG-eGFP and 3e10 GC of AAV9-CAG-hTSLP in PBS, or a vector control (PBS). On days 15 and 18, each mouse was given 50 μL intratracheally of 1.5 mg / kg of TSLP RNAi reagent prepared in isotonic saline, or a vector control (isotonic saline without RNAi reagent), according to Table 22 below. Mice were humanely euthanized and harvested on day 31.

[0348] Table 24. Target locations and dosing groups in Example 7.

[0349] Each TSLP RNAi reagent comprises a modified nucleotide conjugated to an αvβ6 integrin targeting ligand at the 5' end of the sense strand, having the modified sequence shown in the double-stranded structure herein. (For specific modification and structural information relating to TSLP RNAi reagents including Tri-SM6.1-αvβ6, see Tables 3, 4, 5, 6, 7A, 7B, 8, 9, 10, and 11). The TSLP RNAi reagents in groups 3–8 each comprise a nucleotide sequence designed to repress TSLP gene expression by targeting specific sites on TSLP mRNAs as shown in Table 24 above. (For the TSLP mRNA sequences mentioned, see, for example, SEQ ID NO:1 and Table 2.)

[0350] Five (5) mice in each group were tested (n=5), except for group 1, in which only 4 mice were tested. Left lung lobes were collected in 4% PFA for histological analysis. Right lower lobe lobes were collected for human TSLP protein measurement via the Meso Scale Discovery (MSD) Assay. All remaining right lobes were collected for TSLP mRNA expression measurement via qPCR. Data from the experiments are shown in Table 25 below: Table 25. Mean relative TSLP normalized to control in AAV-hTSLP mice from Example 7. Group ID Average relative hTSLP mRNA expression Low (error) High (error) Group 1 (PBS IT days 1 & 3) (Saline IT days 17 & 20) N / A Group 2 (AAV days 1 & 3) (Saline IT days 17 & 20) 1.000 0.128 0.146 Group 3 (AAV IT on days 1 and 3) (1.5 mg / kg AC003100 IT on days 15 and 18) 0.372 0.040 0.045 Group 4 (AAV IT on days 1 and 3) (1.5 mg / kg AC003371 IT on days 15 and 18) 0.363 0.108 0.154 Group 5 (AAV IT on days 1 and 3) (1.5 mg / kg AC003372 IT on days 15 and 18) 0.474 0.086 0.105 Group 6 (AAV IT on days 1 and 3) (1.5 mg / kg AC003373 IT on days 15 and 18) 0.750 0.126 0.151 Group 7 (AAV IT on days 1 and 3) (1.5 mg / kg AC003374 IT on days 15 and 18) 0.335 0.037 0.041 Group 8 (AAV IT on days 1 and 3) (1.5 mg / kg AC003375 IT on days 15 and 18) 0.329 0.048 0.056 Group 9 (AAV IT on days 1 and 3) (1.5 mg / kg AC003376 IT on days 15 and 18) 0.395 0.086 0.109 Group 10 (AAV IT on days 1 and 3) (1.5 mg / kg AC003377 IT on days 15 and 18) 0.432 0.064 0.074 Group 11 (AAV IT on days 1 and 3) (1.5 mg / kg AC003378 IT on days 15 and 18) 0.411 0.060 0.070 Group 12 (AAV IT on days 1 and 3) (1.5 mg / kg AC003379 IT on days 15 and 18) 0.327 0.046 0.053

[0351] As shown in Table 25 above, each of the tested TSLP RNAi reagents showed a reduction in hTSLP expression compared to the control. Specifically, several TSLP RNAi reagents targeting the TSLP transcript at position 571 achieved more than 60% hTSLP mRNA inhibition, with AC003371 achieving a 64% mRNA knockdown (Group 4, 0.363), AC003374 achieving a 66% mRNA knockdown (Group 7, 0.335), and AC003375 achieving a 67% mRNA knockdown (Group 8, 0.329). Furthermore, hTSLP protein expression in the right lower lobe of collected mouse lung tissue was measured by MSD assay for each treatment group, and data from some samples showed… Figure 3A and 3B In the middle. For example Figure 3A and 3B As shown in the figure, a reduction of more than 90% in hTSLP protein was observed from group 4 (3 mg / kg AC003371), which targets the TSLP gene at position 571; significant reductions in hTSLP protein were also demonstrated in the other groups.

[0352] Example 8. In vivo aerosol administration of rat-specific TSLP RNAi reagent in rats.

[0353] On day 1 of the study, male Sprague Dawley rats were administered a single targeted deposition dose of rat-specific RNAi reagent AC001714 (whose chemical structure is described in Example 2) at a dose of 1.5 mg / kg, or a single dose of isotonic saline.

[0354] Aerosols were delivered to a rodent monolayer nasal inhalation exposure chamber (CH Technologies) using a jet nebulizer (Misty Max 10). One port was equipped with a filter housing, allowing evaluation of the aerosol concentration of the RNAi reagent. Exposure time was adjusted to target a dose level of 1.5 mg / kg using a hypothetical minute respiratory rate based on allometric scaling with respect to rodent body weight, along with the aerosol concentration quantified by the filter and RNAi reagent. Actual lung deposition dose (PDD) is listed in Table 26. Table 26. Rat-specific TSLP RNAi reagents and administration methods used in Example 8. Group ID AC double strand numbering Animals / Groups Harvest / Execution Day Group 1 (Day 1 of saline PDD) N / A 5 Day 28 Group 2 (PDD dose on day 1: 1.66 mg / kg AC001714) AC001714 5 Day 28 Group 3 (Day 1 of saline PDD) N / A 5 Day 56 Group 4 (PDD dose on day 1: 1.66 mg / kg AC001714) AC001714 5 Day 56 Group 5 (Day 1 of saline PDD) N / A 5 Day 84 Group 6 (PDD dose on day 1: 1.66 mg / kg AC001714) AC001714 5 Day 84 Group 7 (Day 1 of saline PDD) N / A 5 Day 112 Group 8 (PDD dose on day 1: 1.82 mg / kg AC001714) AC001714 5 Day 112 Group 9 (Day 1 of saline PDD) N / A 5 Day 140 Group 10 (PDD dose on day 1: 1.82 mg / kg AC001714) AC001714 5 Day 140 Group 11 (Day 1 of saline PDD) N / A 5 Day 168 Group 12 (PDD dose on day 1: 1.82 mg / kg AC001714) AC001714 5 Day 168

[0355] Five (5) rats were administered the drug to each group. Rats were sacrificed according to Table 26, and total RNA was isolated from both lungs after collection and homogenization. Rat TSLP mRNA expression was quantified by probe-based quantitative PCR, normalized to rat B2M expression, and expressed as a fraction of the mediator control group (geometric mean, + / - 95% confidence interval).

[0356] Table 27. Mean relative TSLP mRNA expression at sacrifice in rats in Example 8 Group ID Average relative rTSLP mRNA expression Low (error) High (error) Group 1 (isotonic saline; sacrificed on day 28) 1.000 0.242 0.292 Group 2 (1.5 mg / kg AC001714; sacrificed on day 28) 0.657 0.097 0.114 Group 3 (isotonic saline; sacrificed on day 56) 1.000 0.173 0.142 Group 4 (1.5 mg / kg AC001714; sacrificed on day 56) 0.729 0.119 0.142 Group 5 (isotonic saline; sacrificed on day 84) 0.798 0.107 0.160 Group 6 (1.5 mg / kg AC001714; sacrificed on day 84) 0.572 0.064 0.047 Group 7 (isotonic saline; sacrificed on day 112) 0.882 0.262 0.397 Group 8 (1.5 mg / kg AC001714; sacrificed on day 112) 0.726 0.082 0.095 Group 9 (isotonic saline; sacrificed on day 140) 0.853 0.274 0.391 Group 10 (1.5 mg / kg AC001714; sacrificed on day 140) 1.171 0.494 0.990 Group 11 (Isotonic saline; sacrificed on day 168) 0.909 0.165 0.282 Group 12 (1.5 mg / kg AC001714; sacrificed on day 168) 1.017 0.175 0.174

[0357] As shown in the data in Table 27 above, even when administered by inhalation, meaningful inhibition of TSLP gene expression was evident until at least day 84 using this specific rat-specific RNAi reagent tool (AC001714) employing integrin-targeting ligands.

[0358] Example 9. In vivo intratracheal administration of rat-specific TSLP RNAi reagent in rats.

[0359] As per Table 28 below, on days 1 and 3 of the study, male Sprague Dawley rats were administered 200 μL of (i) isotonic saline, or (ii) 5 mg / kg of the rat-specific RNAi reagent AC001714, the chemical structure of which is described in Example 2, or (iii) a “RISC-blocking” RNAi trigger comprising a construct similar to AC001714, including the same targeting ligand, but including chemical modifications designed to prevent antisense strand loading into the RISC, thus serving as a negative control. Table 28. Rat-specific TSLP RNAi reagents and administration methods used in Example 9. Group ID AC double strand numbering Animals / Groups Harvest / Execution Day Group 1 (Saline IT treatment, days 1 and 3) N / A 5 Day 15 Group 2 (Saline IT treatment, days 1 and 3) N / A 5 Day 29 Group 3 (Saline IT treatment, days 1 and 3) N / A 5 Day 43 Group 4 (Saline IT treatment, days 1 and 3) N / A 5 Day 57 Group 5 (IT dose 5.0 mg / kg on days 1 and 3, AC001714) AC001714 5 Day 15 Group 6 (negative control RNAi trigger with RISC blockade at an IT dose of 5.0 mg / kg on days 1 and 3) AC001714 5 Day 29 Group 7 (IT dose 5.0 mg / kg on days 1 and 3, AC001714) AC001714 5 Day 29 Group 8 (IT dose 5.0 mg / kg on days 1 and 3, AC001714) AC001714 5 Day 43 Group 9 (IT dose 5.0 mg / kg on days 1 and 3, AC001714) AC001714 5 Day 57

[0360] Five (5) rats were administered the drug to each group. Rats were sacrificed according to Table 28, and total RNA was isolated from both lungs after collection and homogenization. Rat TSLP mRNA expression was quantified by probe-based quantitative PCR, normalized to rat B2M expression, and expressed as a fraction of the mediator control group (geometric mean, + / - 95% confidence interval).

[0361] Table 29. Mean relative TSLP mRNA expression at sacrifice in rats in Example 9 Group ID Average relative rTSLP mRNA expression Low (error) High (error) Group 1 (Saline IT treatment on days 1 and 3; euthanasia on day 15) 1.000 0.137 0.159 Group 2 (Saline IT treatment on days 1 and 3; euthanasia on day 29) 1.000 0.139 0.162 Group 3 (Saline IT treatment on days 1 and 3; euthanasia on day 43) 1.000 0.207 0.261 Group 4 (Saline IT treatment on days 1 and 3; euthanasia on day 57) 1.000 0.227 0.294 Group 5 (IT dose of 5.0 mg / kg AC001714 on days 1 and 3; sacrificed on day 15) 0.506 0.088 0.106 Group 6 (negative control RNAi trigger with RISC blocking at an IT dose of 5.0 mg / kg on days 1 and 3; sacrificed on day 29) 0.640 0.223 0.342 Group 7 (IT dose of 5.0 mg / kg AC001714 on days 1 and 3; sacrificed on day 29) 0.495 0.067 0.078 Group 8 (IT dose of 5.0 mg / kg AC001714 on days 1 and 3; sacrificed on day 43) 0.394 0.146 0.232 Group 9 (IT dose of 5.0 mg / kg AC001714 on days 1 and 3; sacrificed on day 57) 0.371 0.132 0.204

[0362] As shown in the data in Table 29 above, meaningful inhibition of TSLP gene expression was evident up to at least day 57 by employing this specific rat-specific RNAi reagent tool (AC001714; groups 5, 7, 8, and 9) using integrin-targeting ligands.

[0363] Example 10. In vivo intratracheal administration of rat-specific TSLP RNAi reagent in rats.

[0364] As per Table 30 below, on days 1 and 3 of the study, male Brown Norway rats were administered 200 μL of (i) isotonic saline, or (ii) 5 mg / kg of the rat-specific RNAi reagent AC001714, the chemical structure of which is described in Example 2, or (iii) a “RISC-blocking” RNAi trigger comprising a construct similar to AC001714, including the same targeting ligand, but including chemical modifications designed to prevent antisense strand loading into the RISC, thus serving as a negative control. Table 30. Rat-specific TSLP RNAi reagents and administration methods used in Example 10.

[0365] On day 13, rats were challenged with a single intratracheal dose of 500 µg / rat of Alternaria alternifolia prepared in phosphate-buffered saline (PBS). Rats in group 1 were administered PBS only as a control.

[0366] Two or 24 hours after Alternaria administration (i.e., day 13 or 14), rats were anesthetized with isoflurane / O2, blood was drawn, and then humanely euthanized by exsanguination. The number of days for sacrifice / euthanasia is shown in Table 30 above. Tracheal intubation was performed, and bronchoalveolar lavage fluid (BAL) was collected after washing with 2 x 5 mL of ice-cold PBS. The BAL samples were rotated downwards, cells were resuspended with 1 mL of ice-cold PBS, and aliquots were mixed with Turk's solution (1:1 ratio), and total cells were counted via a hemocytometer. Cell smears were prepared, stained, and cell classification and counting were performed. The supernatant was used for cytokine measurements. The right lung lobe was used to determine rTSLP mRNA expression, and the left lung lobe was collected in 4% PFA / PBS for histology (trichrome staining and Sirius red staining, RNAscope).

[0367] Rat TSLP mRNA expression was quantified by probe-based quantitative PCR, normalized to rat B2M expression, and expressed as a score (geometric mean, + / - 95% confidence interval) in the mediator control group.

[0368] Table 31. Mean relative rat TSLP mRNA expression at sacrifice (i.e., day 13 or 14) in Example 10 Group ID Average relative rTSLP mRNA expression Low (error) High (error) Group 1 (Saline IT on days 1 and 3) (PBS IT on day 13) 1.000 0.208 0.263 Group 2 (Saline IT on days 1 and 3) (Alternaria IT on day 13) 1.088 0.174 0.207 Group 3 (Saline IT on days 1 and 3) (Alternaria IT on day 13) 1.016 0.211 0.267 Group 4 (IT dose 5.0 mg / kg on days 1 and 3, trigger for RISC blockade) / (Alternaria IT on day 13) 1.172 0.237 0.298 Group 5 (IT dose 5.0 mg / kg AC001714 on days 1 and 3) / (Alternaria IT on day 13) 0.538 0.071 0.082 Group 6 (IT dose 5.0 mg / kg on days 1 and 3, trigger for RISC blockade) / (Alternaria IT on day 13) 0.725 0.106 0.125 Group 7 (IT dose 5.0 mg / kg AC001714 on days 1 and 3) / (Alternaria IT on day 13) 0.524 0.104 0.130

[0369] As shown in Table 31 above, compared with the respective control groups, the groups administered AC001714 (i.e., groups 5 and 7) each showed a significant reduction in rTSLP mRNA at their respective sacrifice times. These results were also shown in... Figure 4A middle.

[0370] Granulocytes, such as eosinophils, are well-known markers of cellular inflammation. For BAL samples, total and differentiated cells were counted, and the number of inflammatory cells was determined. The effect of rTSLP inhibition via the rat-specific TSLP RNAi reagent disclosed herein on eosinophilic inflammation induced by Alternaria extract was evaluated. Total BAL cell and eosinophil counts are shown in... Figure 4B and 4C In comparison to their respective controls, groups 5 and 7 (treated with rat-specific TSLP RNAi reagent) showed significant reductions in total BAL cell counts and eosinophil counts across all time points. Figure 4B As shown, a significant decrease in eosinophils was observed at 2 hours and 24 hours post-Alternaria challenge (groups 5 and 7, respectively), compared to groups 2 and 3. Furthermore, as... Figure 4C As shown, compared with the control groups 2 and 3, the total number of BAL cells was significantly reduced at 2 hours and 24 hours after Alternaria infection (groups 5 and 7, respectively). Statistical significance was indicated by p < 0.0001 (**** p-value).

[0371] This study provides physiological support in a rat model that reduced TSLP gene expression (rTSLP mRNA) can provide phenotypic improvement to reduce lung inflammation and thus potentially treat diseases such as allergic asthma.

[0372] Example 11. AAV9-CAG-hTSLP AAV mouse model.

[0373] To evaluate certain TSLP RNAi reagents, the same AAV9-CAG-hTSLP (adeno-associated virus) mouse model discussed in Example 4 was used.

[0374] Human TSLP mRNA expression in mouse lung tissue was measured by qPCR.

[0375] On days 1 and 5, each mouse was given 50 μL of AAV solution containing 2e10 GC (genome copies) of AAV9-CAG-eGFP and 3e10 GC of AAV9-CAG-hTSLP in PBS, or a vector control (PBS). On days 20 and 22, each mouse was given 50 μL intratracheally of 1.0 mg / kg of TSLP RNAi reagent prepared in isotonic saline, or a vector control (isotonic saline without RNAi reagent), according to Table 32 below. Mice were euthanized and harvested on day 32.

[0376] Table 32. Target location and administration group of Example 11.

[0377] Each TSLP RNAi reagent comprises a modified nucleotide conjugated to an αvβ6 integrin targeting ligand at the 5' end of the sense strand, having the modified sequence shown in the double-stranded structure herein. (For specific modification and structural information relating to TSLP RNAi reagents including Tri-SM6.1-αvβ6, see Tables 3, 4, 5, 6, 7A, 7B, 8, 9, 10, and 11). The TSLP RNAi reagents in groups 2–8 each comprise a nucleotide sequence designed to repress TSLP gene expression by targeting specific sites on TSLP mRNAs as shown in Table 32 above. (For the TSLP mRNA sequences mentioned, see, for example, SEQ ID NO:1 and Table 2.)

[0378] Five (5) mice in each group were tested (n=5). The left lung lobe was collected in 4% PFA for histological analysis. The right lower lobe was collected for human TSLP protein measurement by Meso Scale Discovery (MSD) Assay. All remaining right lobes were collected for TSLP mRNA expression measurement by qPCR. Data from the experiments are shown in Table 33 below: Table 33. Mean relative TSLP normalized to control in AAV-hTSLP mice from Example 11. Group ID Average relative hTSLP mRNA expression Low (error) High (error) Group 1 (AAV IT Days 1 & 5) (Saline IT Days 17 & 20) 1.000 0.147 0.172 Group 2 (AAV IT on days 1 and 5) (1.0 mg / kg AC003374 IT on days 20 and 22) 0.330 0.071 0.090 Group 3 (AAV IT on days 1 and 5) (1.0 mg / kg AC004077 IT on days 20 and 22) 0.657 0.120 0.146 Group 4 (AAV IT on days 1 and 5) (1.0 mg / kg AC004078 IT on days 20 and 22) 0.476 0.067 0.078 Group 5 (AAV IT on days 1 and 5) (1.0 mg / kg AC003567 IT on days 20 and 22) 0.452 0.064 0.074 Group 6 (AAV IT on days 1 and 5) (1.0 mg / kg AC003511 IT on days 20 and 22) 0.547 0.101 0.123 Group 7 (AAV IT on days 1 and 5) (1.0 mg / kg AC004079 IT on days 20 and 22) 0.687 0.141 0.178 Group 8 (AAV IT on days 1 and 5) (1.0 mg / kg AC003602 IT on days 20 and 22) 0.380 0.079 0.100

[0379] As shown in Table 33 above, compared with the control (Group 1), each of the tested TSLP RNAi reagents (Groups 2-8) showed a reduction in hTSLP expression. Specifically, several TSLP RNAi reagents targeting the TSLP transcript at position 571 achieved more than 60% hTSLP mRNA inhibition, with AC003374 achieving a ~67% knockdown (Group 2, 0.330) and AC003602 achieving a ~62% knockdown (Group 8, 0.380). These results are also shown in... Figure 6A middle.

[0380] Furthermore, for each treatment group, the expression of hTSLP protein in the right lower lobe of collected mouse lung tissue was measured by MSD assay, and data from some samples showed that... Figure 6B and 6C In the middle. For example Figure 6B As shown, AC003374 and AC003602 (groups 2 and 8, respectively) achieved ~88% and ~77% reductions in human TSLP protein in the lungs of AAV-transduced mice, respectively, at 1.0 mg / kg. Furthermore, as... Figure 6C As shown, both AC003374 and AC002603 (groups 2 and 8, respectively) achieved a ~81% reduction in human TSLP protein in the serum of AAV-transduced mice.

[0381] Example 12. TSLP RNAi reagent in AAV9-CAG-hTSLP AAV mouse model.

[0382] To evaluate certain TSLP RNAi reagents, the same AAV9-CAG-hTSLP (adeno-associated virus) mouse model discussed in Example 4 was used.

[0383] Human TSLP mRNA expression in mouse lung tissue was measured by qPCR.

[0384] On days 1 and 3, each female C57Bl / 6 mouse was given 50 μL of AAV solution containing 2e10 GC (genome copies) of AAV9-CAG-eGFP and 3e10 GC of AAV9-CAG-hTSLP in PBS. On days 14 and 17, each mouse was given 50 μL intratracheally of TSLP RNAi reagent prepared in isotonic saline at doses of 0.4 mg / kg, 0.75 mg / kg, or 1.5 mg / kg, or a mediator control (isotonic saline without RNAi reagent). Mice were euthanized and harvested on day 28.

[0385] Table 34. Target locations and administration groups in Example 12.

[0386] Each TSLP RNAi reagent comprises a modified nucleotide conjugated to an αvβ6 integrin targeting ligand at the 5' end of the sense strand, having the modified sequence shown in the double-stranded structure described herein. (For specific modification and structural information relating to TSLP RNAi reagents including Tri-SM6.1-αvβ6, see Tables 3, 4, 5, 6, 7A, 7B, 8, 9, 10, and 11). Each TSLP RNAi reagent in groups 2–8 comprises a nucleotide sequence designed to repress TSLP gene expression by targeting specific sites on TSLP mRNAs as shown in Table 34 above. (For the TSLP mRNA sequences mentioned, see, for example, SEQ ID NO:1 and Table 2.)

[0387] For each test group, five (5) mice (n=5) were used. The left lung lobe was collected in 4% PFA for histological analysis. The right lower lobe was collected for human TSLP protein measurement via Meso Scale Discovery (MSD) Assay. All remaining right lobes were collected for TSLP mRNA expression measurement via qPCR. Data from the experiments are shown in Table 35 below: Table 35. Mean relative TSLP normalized to control in AAV-hTSLP mice from Example 12. Group ID Average relative hTSLP mRNA expression Low (error) High (error) Group 1 (AAV IT Days 1 & 3) (Saline IT Days 14 & 17) 1.000 0.189 0.233 Group 2 (AAV IT on days 1 and 3) (0.4 mg / kg AC003374 on days 14 and 17) 0.550 0.110 0.138 Group 3 (AAV IT on days 1 and 3) (0.75 mg / kg AC003374 on days 14 and 17) 0.382 0.052 0.060 Group 4 (AAV IT on days 1 and 3) (1.5 mg / kg AC003374 on days 14 and 17) 0.376 0.065 0.078 Group 5 (AAV IT on days 1 and 3) (0.4 mg / kg AC003456 on days 14 and 17) 0.544 0.124 0.160 Group 6 (AAV IT on days 1 and 3) (0.75 mg / kg AC003456 on days 14 and 17) 0.614 0.120 0.150 Group 7 (AAV IT on days 1 and 3) (1.5 mg / kg AC003456 on days 14 and 17) 0.583 0.105 0.128 Group 8 (AAV IT on days 1 and 3) (0.75 mg / kg AC003342 on days 14 and 17) 0.576 0.137 0.180

[0388] As shown in Table 35 above, the tested TSLP RNAi reagents (groups 2-8) each showed a decrease in hTSLP expression compared to the control (group 1). In particular, AC003374 (target site 571) achieved a ~62% inhibition of TSLP mRNA (0.376) at 1.5 mg / kg.

[0389] Example 13. TSLP RNAi reagent in AAV9-CAG-hTSLP AAV mouse model.

[0390] To evaluate certain TSLP RNAi reagents, the same AAV9-CAG-hTSLP (adeno-associated virus) mouse model discussed in Example 4 was used.

[0391] Human TSLP mRNA expression in mouse lung tissue was measured by qPCR.

[0392] On days 1 and 3, each female C57Bl / 6 mouse was given 50 μL of AAV solution containing 2e10 GC (genome copies) of AAV9-CAG-eGFP and 3e10 GC of AAV9-CAG-hTSLP in PBS. On days 17 and 20, each mouse was given 50 μL intratracheally of TSLPRNAi reagent prepared at 0.5 mg / kg or 1.0 mg / kg in isotonic saline, or a mediator control (isotonic saline without RNAi reagent), according to Table 36 below. Mice were humanely euthanized and harvested on day 29.

[0393] Table 36. Target locations and dosing groups in Example 13.

[0394] Each TSLP RNAi reagent comprises a modified nucleotide conjugated to an αvβ6 integrin targeting ligand at the 5' end of the sense strand, having the modified sequence shown in the double-stranded structure herein. (For specific modification and structural information relating to TSLP RNAi reagents including Tri-SM6.1-αvβ6, see Tables 3, 4, 5, 6, 7A, 7B, 8, 9, 10, and 11). Each TSLP RNAi reagent in groups 2–8 comprises a nucleotide sequence designed to repress TSLP gene expression by targeting specific sites on TSLP mRNAs as shown in Table 36 above. (For the TSLP mRNA sequences mentioned, see, for example, SEQ ID NO:1 and Table 2.)

[0395] For each test group, five (5) mice (n=5) were used. The left lung lobe was collected in 4% PFA for histological analysis. The right lower lobe was collected for human TSLP protein measurement via Meso Scale Discovery (MSD) Assay. All remaining right lobes were collected for TSLP mRNA expression measurement via qPCR. Data from the experiments are shown in Table 37 below: Table 37. Mean relative TSLP normalized to control in AAV-hTSLP mice from Example 13. Group ID Average relative hTSLP mRNA expression Low (error) High (error) Group 1 (AAV IT Days 1 & 3) (Saline IT Days 17 & 20) 1.000 0.102 0.114 Group 2 (AAV IT on days 1 and 3) (0.5 mg / kg AC003374 IT on days 17 and 20) 0.969 0.108 0.121 Group 3 (AAV IT on days 1 and 3) (1.0 mg / kg AC003374 IT on days 17 and 20) 0.435 0.059 0.068 Group 4 (AAV IT on days 1 and 3) (0.5 mg / kg AC003376 IT on days 17 and 20) 0.697 0.120 0.144 Group 5 (AAV IT on days 1 and 3) (1.0 mg / kg AC003376 IT on days 17 and 20) 0.709 0.118 0.141 Group 6 (AAV IT on days 1 and 3) (0.5 mg / kg AC003602 IT on days 17 and 20) 0.733 0.204 0.283 Group 7 (AAV IT on days 1 and 3) (1.0 mg / kg AC003602 IT on days 17 and 20) 0.440 0.092 0.117 Group 8 (AAV IT on days 1 and 3) (0.5 mg / kg AC003601 IT on days 17 and 20) 0.748 0.184 0.245

[0396] As shown in Table 37 above, the tested TSLP RNAi reagents (groups 2-8) each showed a decrease in hTSLP expression compared to the control (group 1). In particular, AC003602 achieved a ~56% inhibition of TSLP mRNA (0.440) at 1.0 mg / kg.

[0397] Example 14. TSLP RNAi reagent in AAV9-CAG-hTSLP AAV mouse model.

[0398] To evaluate certain TSLP RNAi reagents, the same AAV9-CAG-hTSLP (adeno-associated virus) mouse model discussed in Example 4 was used.

[0399] Human TSLP mRNA expression in mouse lung tissue was measured by qPCR.

[0400] On days 1 and 3, each female C57Bl / 6 mouse was given 50 μL of AAV solution containing 2e10 GC (genome copies) of AAV9-CAG-eGFP and 2e10 GC of AAV9-CAG-hTSLP in PBS. On days 17 and 21, each mouse was given 50 μL intratracheally of 1.5 mg / kg of TSLP RNAi reagent prepared in isotonic saline, or a mediator control (isotonic saline without RNAi reagent), according to Table 38 below. Mice were humanely euthanized and harvested on day 31.

[0401] Table 38. Target locations and dosing groups in Example 14.

[0402] Each TSLP RNAi reagent comprises a modified nucleotide conjugated at the 5' end of the sense strand to an αvβ6 integrin targeting ligand, having the modified sequence shown in the double-stranded structure described herein. (For specific modification and structural information relating to TSLP RNAi reagents including Tri-SM6.1-αvβ6, see Tables 3, 4, 5, 6, 7A, 7B, 8, 9, 10, and 11). Each TSLP RNAi reagent in groups 2–8 comprises a nucleotide sequence designed to repress TSLP gene expression by targeting specific sites on TSLP mRNAs as shown in Table 38 above. (For the TSLP mRNA sequences mentioned, see, for example, SEQ ID NO:1 and Table 2.) For each test group, five (5) mice (n=5) were used. The left lung lobe was collected in 4% PFA for histological analysis. The right lower lobe was collected for human TSLP protein measurement via the Meso Scale Discovery (MSD) Assay. All remaining right lobes were collected for TSLP mRNA expression measurement via qPCR. Data from the experiments are shown in Table 39 below: Table 39. Mean relative TSLP normalized to control in AAV-hTSLP mice from Example 14. Group ID Average relative hTSLP mRNA expression Low (error) High (error) Group 1 (AAV IT Days 1 & 3) (Saline IT Days 17 & 21) 1.000 0.373 0.595 Group 2 (AAV IT on days 1 and 3) (1.5 mg / kg AC003374 IT on days 17 and 21) 0.402 0.129 0.191 Group 3 (AAV IT on days 1 and 3) (1.5 mg / kg AC003602 IT on days 17 and 21) 0.325 0.090 0.124 Group 4 (AAV IT on days 1 and 3) (1.5 mg / kg AC003096 IT on days 17 and 21) 0.525 0.116 0.149 Group 5 (AAV IT on days 1 and 3) (1.5 mg / kg AC003098 IT on days 17 and 21) 0.370 0.133 0.207 Group 6 (AAV IT on days 1 and 3) (1.5 mg / kg AC003129 IT on days 17 and 21) 0.451 0.098 0.125 Group 7 (AAV IT on days 1 and 3) (1.5 mg / kg AC003101 IT on days 17 and 21) 0.378 0.179 0.339 Group 8 (AAV IT on days 1 and 3) (1.5 mg / kg AC004361 IT on days 17 and 21) 0.280 0.077 0.107

[0403] As shown in Table 39 above, the tested TSLP RNAi reagents (groups 2-8) each showed a reduction in hTSLP expression compared to the control (group 1). Specifically, AC003602 achieved ~67% inhibition of TSLP mRNA (0.325) at 1.5 mg / kg, and AC004361 (also targeting position 571 of the TSLP gene) achieved ~72% inhibition of TSLP mRNA (0.280) at 1.5 mg / kg.

[0404] Example 15. TSLP RNAi reagent in AAV9-CAG-hTSLP AAV mouse model.

[0405] To evaluate certain TSLP RNAi reagents, the same AAV9-CAG-hTSLP (adeno-associated virus) mouse model discussed in Example 4 was used.

[0406] Human TSLP mRNA expression in mouse lung tissue was measured by qPCR.

[0407] On days 1 and 4, each female C57Bl / 6 mouse was given 50 μL of AAV solution containing 2e10 GC (genome copies) of AAV9-CAG-eGFP and 3e10 GC of AAV9-CAG-hTSLP in PBS. On days 20 and 22, each mouse was given 50 μL intratracheally of 1.0 mg / kg of TSLP RNAi reagent prepared in isotonic saline, or a mediator control (isotonic saline without RNAi reagent), according to Table 40 below. Mice were humanely euthanized and harvested on day 32.

[0408] Table 40. Target location and administration group of Example 15.

[0409] Each TSLP RNAi reagent comprises a modified nucleotide conjugated to an αvβ6 integrin targeting ligand at the 5' end of the sense strand, having the modified sequence shown in the double-stranded structure herein. (For specific modification and structural information relating to TSLP RNAi reagents including Tri-SM6.1-αvβ6, see Tables 3, 4, 5, 6, 7A, 7B, 8, 9, 10, and 11). Each TSLP RNAi reagent in groups 2–8 comprises a nucleotide sequence designed to repress TSLP gene expression by targeting specific sites on TSLP mRNAs as shown in Table 40 above. (For the TSLP mRNA sequences mentioned, see, for example, SEQ ID NO:1 and Table 2.)

[0410] For each test group, five (5) mice (n=5) were used. The left lung lobe was collected in 4% PFA for histological analysis. The right lower lobe was collected for human TSLP protein measurement via Meso Scale Discovery (MSD) Assay. All remaining right lobes were collected for TSLP mRNA expression measurement via qPCR. Data from the experiments are shown in Table 41 below: Table 41. Mean relative TSLP normalized to control in AAV-hTSLP mice from Example 15. Group ID Average relative hTSLP mRNA expression Low (error) High (error) Group 1 (AAV IT Days 1 & 4) (Saline IT Days 20 & 22) 1.000 0.182 0.223 Group 2 (AAV IT on days 1 and 4) (1.0 mg / kg AC003602 IT on days 20 and 22) 0.424 0.099 0.130 Group 3 (AAV IT on days 1 and 4) (1.0 mg / kg AC004376 IT on days 20 and 22) 0.371 0.084 0.108 Group 4 (AAV IT on days 1 and 4) (1.0 mg / kg AC004363 IT on days 20 and 22) 0.359 0.094 0.127 Group 5 (AAV IT on days 1 and 4) (1.0 mg / kg AC004373 IT on days 20 and 22) 0.411 0.091 0.116 Group 6 (AAV IT on days 1 and 4) (1.0 mg / kg AC004374 IT on days 20 and 22) 0.552 0.145 0.196 Group 7 (AAV IT on days 1 and 4) (1.0 mg / kg AC004358 IT on days 20 and 22) 0.383 0.109 0.152 Group 8 (AAV IT on days 1 and 4) (1.0 mg / kg AC004361 IT on days 20 and 22) 0.381 0.090 0.117

[0411] As shown in Table 41 above, compared with the control (Group 1), the tested TSLP RNAi reagents (Groups 2-8) each showed a decrease in hTSLP expression.

[0412] Furthermore, for each treatment group, the expression of hTSLP protein in the right lower lobe of collected mouse lung tissue was measured by MSD assay, and data from some samples showed that... Figure 7 In the middle. For example Figure 7 As shown, at 1.0 mg / kg, AC004376 achieved a ~79% reduction in human TSLP protein in the lungs of AAV-transduced mice, while AC004363 and AC004361 both achieved a 73% reduction.

[0413] Example 16. TSLP RNAi reagent in AAV9-CAG-hTSLP AAV mouse model.

[0414] To evaluate certain TSLP RNAi reagents, the same AAV9-CAG-hTSLP (adeno-associated virus) mouse model discussed in Example 4 was used.

[0415] Human TSLP mRNA expression in mouse lung tissue was measured by qPCR.

[0416] On days 1 and 3, each female C57Bl / 6 mouse was given 50 μL of AAV solution containing 2e10 GC (genome copies) of AAV9-CAG-eGFP and 3e10 GC of AAV9-CAG-hTSLP in PBS. On days 17 and 20, each mouse was given 50 μL intratracheally of 1.0 mg / kg of TSLP RNAi reagent prepared in isotonic saline, or a mediator control (isotonic saline without RNAi reagent), according to Table 42 below. Mice were humanely euthanized and harvested on day 31.

[0417] Table 42. Target locations and dosing groups in Example 16.

[0418] Each TSLP RNAi reagent comprises a modified nucleotide conjugated to an αvβ6 integrin targeting ligand at the 5' end of the sense strand, having the modified sequence shown in the double-stranded structure herein. (For specific modification and structural information relating to TSLP RNAi reagents including Tri-SM6.1-αvβ6, see Tables 3, 4, 5, 6, 7A, 7B, 8, 9, 10, and 11). The TSLP RNAi reagents in groups 2–8 each comprise a nucleotide sequence designed to repress TSLP gene expression by targeting specific sites on TSLP mRNA as shown in Table 42 above. (For the TSLP mRNA sequences mentioned, see, for example, SEQ ID NO:1 and Table 2.)

[0419] For each test group, five (5) mice (n=5) were used. The left lung lobe was collected in 4% PFA for histological analysis. The right lower lobe was collected for human TSLP protein measurement via Meso Scale Discovery (MSD) Assay. All remaining right lobes were collected for TSLP mRNA expression measurement via qPCR. Data from the experiments are shown in Table 43 below: Table 43. Mean relative TSLP normalized to control in AAV-hTSLP mice from Example 16. Group ID Average relative hTSLP mRNA expression Low (error) High (error) Group 1. (AAV IT Days 1 & 3) (Saline IT Days 17 & 20) 1.000 0.157 0.187 Group 2. (AAV IT on days 1 and 3) (1.0 mg / kg AC003602 IT on days 17 and 20) 0.476 0.091 0.112 Group 3. (AAV IT on days 1 and 3) (1.0 mg / kg AC004644 IT on days 17 and 20) 0.404 0.099 0.131 Group 4. (AAV IT on days 1 and 3) (1.0 mg / kg AC004645 IT on days 17 and 20) 0.355 0.047 0.055 Group 5. (AAV IT on days 1 and 3) (1.0 mg / kg AC004646 IT on days 17 and 20) 0.406 0.067 0.081 Group 6. (AAV IT on days 1 and 3) (1.0 mg / kg AC004647 IT on days 17 and 20) 0.541 0.113 0.143 Group 7. (AAV IT on days 1 and 3) (1.0 mg / kg AC004816 IT on days 17 and 20) 0.509 0.084 0.100 Group 8. (AAV IT on days 1 and 3) (1.0 mg / kg AC004363 IT on days 17 and 20) 0.376 0.097 0.130

[0420] As shown in Table 43 above, compared with the control (Group 1), each of the tested TSLP RNAi reagents (Groups 2-8) showed a decrease in hTSLP expression. In particular, AC004363 achieved ~62% inhibition of TSLP mRNA at 1.0 mg / kg.

[0421] Furthermore, for each treatment group, the expression of hTSLP protein in the right lower lobe of collected mouse lung tissue was measured by MSD assay, and data from some samples showed that... Figure 8 In the middle. For example Figure 8 As shown, at 1.0 mg / kg, AC003602 achieved a ~84% reduction in human TSLP protein in the lungs of AAV-transduced mice, and AC004645 achieved a ~83% reduction.

[0422] Example 17. TSLP RNAi reagent in AAV9-CAG-hTSLP AAV mouse model.

[0423] To evaluate certain TSLP RNAi reagents, the same AAV9-CAG-hTSLP (adeno-associated virus) mouse model discussed in Example 4 was used.

[0424] Human TSLP mRNA expression in mouse lung tissue was measured by qPCR.

[0425] On days 1 and 4, each female C57Bl / 6 mouse was given 50 μL of AAV solution containing 2e10 GC (genome copies) of AAV9-CAG-eGFP and 3e10 GC of AAV9-CAG-hTSLP in PBS. On days 22 and 25, each mouse was given 50 μL intratracheally of TSLP RNAi reagent prepared at 1.0 mg / kg in isotonic saline, or a mediator control (isotonic saline without RNAi reagent), as per the groups listed in Table 44 below. Mice were humanely euthanized and harvested on day 36.

[0426] Table 44. Target locations and dosing groups in Example 17.

[0427] Each TSLP RNAi reagent comprises a modified nucleotide conjugated to an αvβ6 integrin targeting ligand at the 5' end of the sense strand, having the modified sequence shown in the double-stranded structure herein. (For specific modification and structural information relating to TSLP RNAi reagents including Tri-SM6.1-αvβ6, see Tables 3, 4, 5, 6, 7A, 7B, 8, 9, 10, and 11). The TSLP RNAi reagents in groups 2–8 each comprise a nucleotide sequence designed to repress TSLP gene expression by targeting specific sites on TSLP mRNA as shown in Table 44 above. (For the TSLP mRNA sequences mentioned, see, for example, SEQ ID NO:1 and Table 2.)

[0428] For each test group, five (5) mice (n=5) were used. The left lung lobe was collected in 4% PFA for histological analysis. The right lower lobe was collected for human TSLP protein measurement via the Meso Scale Discovery (MSD) Assay. All remaining right lobes were collected for TSLP mRNA expression measurement via qPCR. Data from the experiments are shown in Table 45 below: Table 45. Mean relative TSLP normalized to control in AAV-hTSLP mice from Example 17. Group ID Average relative hTSLP mRNA expression Low (error) High (error) Group 1. (AAV IT Days 1 & 4) (Saline IT Days 22 & 25) 1.000 0.055 0.059 Group 2. (AAV IT on days 1 and 4) (1.0 mg / kg AC003602 IT on days 22 and 25) 0.375 0.052 0.060 Group 3. (AAV IT on days 1 and 4) (1.0 mg / kg AC004363 IT on days 22 and 25) 0.359 0.081 0.104 Group 4. (AAV IT on days 1 and 4) (1.0 mg / kg AC004376 IT on days 22 and 25) 0.324 0.066 0.083 Group 5. (AAV IT on days 1 and 4) (1.0 mg / kg AC004816 IT on days 22 and 25) 0.559 0.119 0.151 Group 6. (AAV IT on days 1 and 4) (1.0 mg / kg AC004644 IT on days 22 and 25) 0.501 0.078 0.092 Group 7. (AAV IT on days 1 and 4) (1.0 mg / kg AC004646 IT on days 22 and 25) 0.655 0.046 0.050

[0429] As shown in Table 45 above, compared with the control (Group 1), the tested TSLP RNAi reagents (Groups 2-8) each showed a decrease in hTSLP expression. Specifically, AC004376 achieved ~67% inhibition of TSLP mRNA at 1.0 mg / kg (0.324), and AC003602 achieved ~62% inhibition of TSLP mRNA at 1.0 mg / kg (0.375).

[0430] Example 18. TSLP RNAi reagent in AAV9-CAG-hTSLP AAV mouse model.

[0431] To evaluate certain TSLP RNAi reagents, the same AAV9-CAG-hTSLP (adeno-associated virus) mouse model discussed in Example 4 was used.

[0432] Human TSLP mRNA expression in mouse lung tissue was measured by qPCR.

[0433] On days 1 and 4, each female C57Bl / 6 mouse was given 50 μL of AAV solution containing 2e10 GC (genome copies) of AAV9-CAG-eGFP and 2e10 GC of AAV9-CAG-hTSLP in PBS. On days 20 and 22, each mouse was given 50 μL intratracheally of TSLP RNAi reagent prepared at 1.5 mg / kg in isotonic saline, or a mediator control (isotonic saline without RNAi reagent), according to Table 46 below. Mice were humanely euthanized and harvested on day 34.

[0434] Table 46. Target location and administration group of Example 18.

[0435] Each TSLP RNAi reagent comprises a modified nucleotide conjugated to an αvβ6 integrin targeting ligand at the 5' end of the sense strand, having the modified sequence shown in the double-stranded structure herein. (For specific modification and structural information relating to TSLP RNAi reagents including Tri-SM6.1-αvβ6, see Tables 3, 4, 5, 6, 7A, 7B, 8, 9, 10, and 11). Each TSLP RNAi reagent in groups 2–8 comprises a nucleotide sequence designed to repress TSLP gene expression by targeting specific sites on TSLP mRNAs as shown in Table 46 above. (For the TSLP mRNA sequences mentioned, see, for example, SEQ ID NO:1 and Table 2.)

[0436] For each test group, five (5) mice (n=5) were used. The left lung lobe was collected in 4% PFA for histological analysis. The right lower lobe was collected for human TSLP protein measurement via the Meso Scale Discovery (MSD) Assay. All remaining right lobes were collected for TSLP mRNA expression measurement via qPCR. Data from the experiments are shown in Table 47 below: Table 47. Mean relative TSLP normalized to control in AAV-hTSLP mice from Example 18. Group ID Average relative hTSLP mRNA expression Low (error) High (error) Group 1. (AAV IT Days 1 & 4) (Saline IT Days 20 & 22) 1.000 0.314 0.458 Group 2. (AAV IT on days 1 and 4) (1.5 mg / kg AC004565 IT on days 20 and 22) 0.683 0.170 0.227 Group 3. (AAV IT on days 1 and 4) (1.5 mg / kg AC004566 IT on days 20 and 22) 0.448 0.125 0.174 Group 4. (AAV IT on days 1 and 4) (1.5 mg / kg AC004567 IT on days 20 and 22) 0.659 0.150 0.194 Group 5. (AAV IT on days 1 and 4) (1.5 mg / kg AC004568 IT on days 20 and 22) 0.400 0.091 0.097 Group 6. (AAV IT on days 1 and 4) (1.5 mg / kg AC004569 IT on days 20 and 22) 0.465 0.069 0.082 Group 7. (AAV IT on days 1 and 4) (1.5 mg / kg AC004570 IT on days 20 and 22) 0.564 0.160 0.224 Group 8. (AAV IT on days 1 and 4) (1.5 mg / kg AC003602 IT on days 20 and 22) 0.399 0.164 0.279

[0437] As shown in Table 47 above, the tested TSLP RNAi reagents (groups 2-8) each showed a reduction in hTSLP expression compared to the control (group 1). In particular, AC003602 and AC004568 achieved ~60% inhibition of TSLP mRNA at 1.5 mg / kg (0.399 and 0.400, respectively).

[0438] Furthermore, for each treatment group, the expression of hTSLP protein in the right lower lobe of collected mouse lung tissue was measured by MSD assay, and data from some samples showed that... Figure 9A and 9B In the middle. For example Figure 9A As shown, at 1.5 mg / kg, AC004565 achieved a ~88% reduction in human TSLP protein in the lungs of AAV-transduced mice. Figure 9B As shown, at 1.5 mg / kg, AC003602 achieved a ~83% reduction in human TSLP protein in the serum of AAV-transduced mice, and AC004566 achieved a ~66% reduction.

[0439] Example 19. TSLP RNAi reagent in AAV9-CAG-hTSLP AAV mouse model.

[0440] To evaluate certain TSLP RNAi reagents, the same AAV9-CAG-hTSLP (adeno-associated virus) mouse model discussed in Example 4 was used.

[0441] Human TSLP mRNA expression in mouse lung tissue was measured by qPCR.

[0442] On days 1 and 4, each female C57Bl / 6 mouse was given 50 μL of AAV solution containing 2e10 GC (genome copies) of AAV9-CAG-eGFP and 2e10 GC of AAV9-CAG-hTSLP in PBS. On days 18 and 20, each mouse was given 50 μL intratracheally of 1.5 mg / kg of TSLP RNAi reagent prepared in isotonic saline, or a mediator control (isotonic saline without RNAi reagent), according to Table 48 below. Mice were humanely euthanized and harvested on day 32.

[0443] Table 48. Target location and administration group of Example 19.

[0444] Each TSLP RNAi reagent comprises a modified nucleotide conjugated to an αvβ6 integrin targeting ligand at the 5' end of the sense strand, having the modified sequence shown in the double-stranded structure herein. (For specific modification and structural information relating to TSLP RNAi reagents including Tri-SM6.1-αvβ6, see Tables 3, 4, 5, 6, 7A, 7B, 8, 9, 10, and 11). The TSLP RNAi reagents in groups 2–8 each comprise a nucleotide sequence designed to repress TSLP gene expression by targeting specific sites on TSLP mRNAs as shown in Table 48 above. (For the TSLP mRNA sequences mentioned, see, for example, SEQ ID NO:1 and Table 2.)

[0445] For each test group, five (5) mice (n=5) were used. The left lung lobe was collected in 4% PFA for histological analysis. The right lower lobe was collected for human TSLP protein measurement via the Meso Scale Discovery (MSD) Assay. All remaining right lobes were collected for TSLP mRNA expression measurement via qPCR. Data from the experiments are shown in Table 49 below: Table 49. Mean relative TSLP normalized to control in AAV-hTSLP mice from Example 19. Group ID Average relative hTSLP mRNA expression Low (error) High (error) Group 1. (AAV IT Days 1 & 4) (Saline IT Days 18 & 20) 1.000 0.097 0.107 Group 2. (AAV IT on days 1 and 4) (1.5 mg / kg AC004569 IT on days 18 and 20) 0.713 0.103 0.120 Group 3. (AAV IT on days 1 and 4) (1.5 mg / kg AC004570 IT on days 18 and 20) 0.665 0.140 0.178 Group 4. (AAV IT on days 1 and 4) (1.5 mg / kg AC004571 IT on days 18 and 20) 0.506 0.078 0.093 Group 5. (AAV IT on days 1 and 4) (1.5 mg / kg AC004572 IT on days 18 and 20) 0.534 0.086 0.103 Group 6. (AAV IT on days 1 and 4) (1.5 mg / kg AC004573 IT on days 18 and 20) 0.383 0.086 0.111 Group 7. (AAV IT on days 1 and 4) (1.5 mg / kg AC004574 IT on days 18 and 20) 0.400 0.038 0.042 Group 8. (AAV IT on days 1 and 4) (1.5 mg / kg AC003602 IT on days 18 and 20) 0.404 0.044 0.049

[0446] As shown in Table 49 above, compared with the control (Group 1), the tested TSLP RNAi reagents (Groups 2-8) each showed a decrease in hTSLP expression.

[0447] Furthermore, for each treatment group, the expression of hTSLP protein in the right lower lobe of collected mouse lung tissue was measured by MSD assay, and data from some samples showed that... Figure 10A and 10B In the middle. For example Figure 10A As shown, at 1.5 mg / kg, AC003602 achieved a ~87% reduction in human TSLP protein in the lungs of AAV-transduced mice, and AC004573 achieved a ~79% reduction. Figure 10B As shown, at 1.5 mg / kg, AC003602 achieved a ~76% reduction in human TSLP protein in the serum of AAV-transduced mice, and AC004574 achieved a ~65% reduction.

[0448] Example 20. TSLP-SEAP mouse model.

[0449] To evaluate the TSLP RNAi reagent, a TSLP-SEAP mouse model was used. Female C57bl6 / Albino mice were transiently transfected in vivo via hydrodynamic tail vein (HTV) injection of a plasmid containing nucleotides 179-2610 of the TSLP cDNA sequence (GenBank NM_033035.5 (SEQ ID NO:1)) inserted into the 3' UTR of the SEAP (secretory human placental alkaline phosphatase) reporter gene. The TSLP-SEAP mouse model was established by HTV injection of 20 μg of plasmid containing TSLP cDNA in Ringer's solution at 10% of the animal's body weight. Following TSLP-SEAP transfection, the mice were subsequently administered the TSLP RNAi reagent. Inhibition of TSLP gene expression by the TSLP RNAi reagent resulted in a concomitant inhibition of SEAP expression. SEAP expression levels were measured using the Phospha-Light™ SEAP Reporter Gene Assay System (ThermoFisher catalog #T1016). Serum SEAP expression levels were measured prior to treatment, and mice were grouped according to mean SEAP levels.

[0450] Analysis: SEAP levels may be measured at different times before and after TSLP RNAi reagent administration.

[0451] i) Serum collection: Mice were anesthetized with 2-3% isoflurane, and blood samples were collected from the submandibular region into serum separation tubes (Sarstedt AG & Co., Nümbrecht, Germany). The blood was allowed to coagulate at ambient temperature for 20 minutes. The tubes were centrifuged at 8,000 × g for 3 minutes to separate the serum, which was then stored at 4°C.

[0452] ii) Serum SEAP Levels: Serum was collected and measured using the Phospha-Light™ SEAP Reporter Gene Assay System (ThermoFisher) according to the manufacturer's instructions. Serum SEAP levels for each animal were normalized against a control group of mice injected with saline to account for non-treatment-related decreases in TSLP sequence expression for this model. First, the SEAP level for each animal at a given time point was divided by that animal's pre-treatment expression level (“pre-treatment”) to determine the “pre-treatment normalized” expression ratio. The expression at a given time point was then normalized against the control group by dividing the “pre-treatment normalized” ratio for an individual animal by the mean “pre-treatment normalized” ratio for all mice in the saline control group. Alternatively, in some embodiments described herein, serum SEAP levels for each animal were evaluated only by normalization against pre-treatment levels.

[0453] To evaluate the activity of TSLP RNAi reagents in a SEAP model as described in the examples below, certain TSLP RNAi reagents were conjugated to a targeting ligand containing N-acetylgalactosamine having a chemical structure called NAG37 (see Table 11 for structural information), as shown in Tables 5, 6, and 10. NAG37 is known to have a high affinity for desialylate glycoprotein receptors, which are abundantly expressed on liver cells (including hepatocytes) (see International Patent Application Publication No. WO2018044350A1). The NAG37-conjugated TSLP RNAi reagents were used to assess SEAP expression in the liver.

[0454] Example 21. In vivo administration of TSLP RNAi reagent in TSLP-SEAP mice.

[0455] The TSLP-SEAP model described in Example 20 above was used. On day -21, four (n=4) female C57bl / 6 albino mice were administered 20 μg pMIR0962 TSLP-SEAP via hydrodynamic tail vein (HTV) injection. On day 1, the mice were administered via subcutaneous (SQ) injection at a volume of 250 μL / 25 g body weight, using isotonic saline or TSLP RNAi reagent prepared in saline (at 0.5 mg / kg, 1.0 mg / kg, or 1.5 mg / kg). The administration regimen was as shown in Table 50 below.

[0456] Table 50. Administration of the mouse animals in Example 21. Group Dosage (RNAi reagent) Target location of TSLP (Seq ID No. 1) route of administration 1 brine N / A SQ injection on day 1 2 0.5 mg / kg AC003679 571 SQ injection on day 1 3 1.0 mg / kg AC003679 571 SQ injection on day 1 4 1.5 mg / kg AC003679 571 SQ injection on day 1 5 0.5 mg / kg AC003989 520 SQ injection on day 1 6 1.0 mg / kg AC003989 520 SQ injection on day 1 7 1.5 mg / kg AC003989 520 SQ injection on day 1 8 0.5 mg / kg AC003923 571 SQ injection on day 1 9 1.0 mg / kg AC003923 571 SQ injection on day 1 10 0.5 mg / kg AC003920 571 SQ injection on day 1 11 1.0 mg / kg AC003920 571 SQ injection on day 1 12 1.5 mg / kg AC003920 571 SQ injection on day 1

[0457] To evaluate the efficacy of the TSLP RNAi reagent and SEAP assay in this embodiment, AC003679 was conjugated with NAG37 (see Table 11 for structural information); NAG37 is known to have high affinity for desialylate glycoprotein receptors, which are abundantly expressed on liver cells (including hepatocytes). AC003679 was chemically modified as follows: Modified semantic chain (5') 3’)： (NAG37)s(invAb)sagucacaaCfCfAfauaaaugucus(invAb) (SEQ ID NO: 775) Modified antisense chain (5') 3’)： asGfsacauuuaUfuGfgUfuGfugacsu (SEQ ID NO: 652).

[0458] To evaluate the efficacy of the TSLP RNAi reagent and SEAP assay in this embodiment, AC003989 was conjugated with NAG37 (see Table 11 for structural information); NAG37 is known to have high affinity for desialylate glycoprotein receptors, which are abundantly expressed on liver cells (including hepatocytes). AC003989 was chemically modified as follows: Modified semantic chain (5') 3’)： (NAG37)s(invAb)sggaaacucAfGfAfuaaaugcuaas(invAb) (SEQ ID NO: 774) Modified antisense chain (5') 3’)： cPrpusUfsagCfauuUfauCfuGfaguuucsc (SEQ ID NO: 628).

[0459] To evaluate the efficacy of the TSLP RNAi reagent and SEAP assay in this embodiment, AC003920 was conjugated with NAG37 (see Table 11 for structural information); NAG37 is known to have high affinity for desialylate glycoprotein receptors, which are abundantly expressed on liver cells (including hepatocytes). AC003920 was chemically modified as follows: Modified semantic chain (5') 3’)： (NAG37)s(invAb)sggucacaaCfCfAfauaaaugucus(invAb) (SEQ ID NO: 760) Modified antisense chain (5') 3’)： asGfsacauuuaUfuGfgUfuGfugacsc (SEQ ID NO: 653).

[0460] Serum was collected at days -7, 1, 8, 15, and 22. SEAP expression levels were determined according to the procedure described in Example 20 above. Data from the experiments are shown in Table 51 below, where mean SEAP reflects the normalized mean of SEAP.

[0461] Table 51. Mean SEAP normalized for pre-treatment and saline control mice in TSLP-SEAP mice of Example 21.

[0462] Compared to the saline-controlled group 1, groups 2–12 showed a reduction in SEAP-TSLP at all time points (days 8, 15, and 22). More specifically, in this model, AC003920 achieved ~97% inhibition at 1.5 mg / kg on day 22.

[0463] Example 22. In vivo administration of TSLP knockdown delivered via an intratracheal microneedle in a rat airway inflammation model Anti-inflammatory effect.

[0464] On days 1 and 3 of the study, male Brown-Norway rats were administered a 5 mg / kg dose of a rat-specific RNAi agent (designated AC001714 or AC002515) linked to a Tri-SM6.1-αvβ6 integrin-targeting ligand, or a saline medium. Additionally, a “RISC-blocking” RNAi trigger was used, comprising a construct similar to AC001714, including the same targeting ligand, but including chemical modifications designed to prevent antisense strand loading into the RISC, thus serving as a negative control. A 200 µL volume was loaded into a syringe connected to a microneedling device (PennCentury, Philadelphia, PA) for intratracheal administration.

[0465] AC001714 and AC002515 comprise rat-specific sequences designed to target the rat TSLP transcript (NCBI GenBank XM_008772052.2) and are not homologous to the human TSLP gene. Their chemical structures are shown in Examples 2 and 3 above.

[0466] On day 15, rats were challenged with a single intratracheal dose of 500 µg / rat of Alternaria alternifolia prepared in PBS. Rats in group 1 were administered PBS only as a control.

[0467] Table 52. Rat-specific TSLP RNAi reagents and administration methods used in Example 22. Group ID AC double strand numbering Animals / Groups Harvest / Execution Day Group 1 (Saline IT on days 1 and 3) (PBS IT on day 15) N / A 5 Day 16 Group 2 (Saline IT on days 1 and 3) (Alternaria IT on day 15) N / A 5 Day 16 Group 3 (Saline IT on days 1 and 3) (IT dose on days 1 and 3: 5.0 mg / kg, trigger for RISC blockade) / (Alternaria IT on day 15) RISC-blocking RNAi triggers 5 Day 16 Group 4 (IT dose 5.0 mg / kg AC001714 on days 1 and 3) / (Alternaria IT on day 15) AC001714 5 Day 16 Group 5 (IT dose 5.0 mg / kg AC002515 on days 1 and 3) / (Alternaria IT on day 15) AC002515 5 Day 16

[0468] Twenty-four hours after Alternaria administration (i.e., day 16), rats were anesthetized with isoflurane / O2, blood was drawn, and euthanasia was performed by exsanguination. The number of days for sacrifice / euthanasia is shown in Table 14 above. Tracheal intubation was performed, and bronchoalveolar lavage fluid (BAL) was collected after washing with 2 x 5 mL of ice-cold PBS. The BAL samples were rotated downwards, cells were resuspended with 1 mL of ice-cold PBS, and aliquots were mixed with Turk's solution (1:1 ratio), and total cells were counted via a hemocytometer. Cell smears were prepared, stained, and cell classification and counting were performed. The supernatant was used for cytokine measurements. The right lung lobe was used to determine rTSLP mRNA expression, and the left lung lobe was collected in 4% PFA / PBS for histology (trichrome staining and Sirius red staining, RNAscope).

[0469] Rat lungs were inflated, fixed in 4% PFA, and the mRNA was processed for in situ hybridization and immunohistochemistry. TSLP RNAscope showed TSLP expression in the airways and alveoli. Z-stacked confocal scans showed that TSLP transcripts were retained in the nucleus, demonstrating that silencing cytoplasmic TSLP mRNA did not reduce the pre-mRNA retained in the nucleus.

[0470] Example 23. Passive uptake of TSLP RNAi reagent in human precision cut lung slices (PCLS).

[0471] Precision cut tissue sections (PCLS) represent an in vitro model and tool for studying the structure and function of the lung in its natural 3D environment, allowing for in vitro examination of natural interactions between cells, molecules, and the extracellular matrix (ECM) (Alsafadi HN et al., Am J Respir Cell Mol Biol 62 (6): 681-691 (2020)). PCLS can be generated from various anatomical locations of the lung (distal and proximal) and from different species (including rodents, pigs, monkeys, and humans). To validate the efficacy of RNAi reagents for silencing human TSLP mRNA, fresh agarose-filled lung sections from a (1) healthy human donor were used for examination.

[0472] Add saline or TSLP RNAi reagent to the cell culture medium, with daily medium changes. PCLS were cultured in the medium from day 1 to day 7 and harvested on day 8. PCLS were cultured and administered TSLP RNAi reagent according to Table 53 below.

[0473] RNAi reagent AC003609, a "RISC blocking" RNAi reagent, includes chemical modifications designed to prevent the antisense strand from being loaded into the RISC, and thus serves as a negative control.

[0474] Table 53. Dosing groups and dosing regimens of the TSLP RNAi reagent from Example 23. Group ID Dosing regimen # PCLS samples (n=) / group Group 1. Salt water Treatment in cell culture medium once daily for 7 days n = 6 Group 2. AC003374 10 µM Treatment in cell culture medium once daily for 7 days n = 6 Group 3. AC003374 1 µM Treatment in cell culture medium once daily for 7 days n = 6 Group 4. AC003374 0.1 µM Treatment in cell culture medium once daily for 7 days n = 6 Group 5. AC003602 10 µM Treatment in cell culture medium once daily for 7 days n = 6 Group 6. AC003602 1 µM Treatment in cell culture medium once daily for 7 days n = 6 Group 7. AC003602 0.1 µM Treatment in cell culture medium once daily for 7 days n = 6 Group 8. AC003546 10 µM Treatment in cell culture medium once daily for 7 days n = 6 Group 9. AC003546 1 µM Treatment in cell culture medium once daily for 7 days n = 6 Group 10. AC003546 0.1 µM Treatment in cell culture medium once daily for 7 days n = 6 Group 11. AC003609 10 µM Treatment in cell culture medium once daily for 7 days n = 6

[0475] PPIA was used as an endogenous control gene. TSLP mRNA expression was quantified by qPCR and normalized for the first group of samples treated with saline. The relative expression data from qPCR are shown in Table 54 below.

[0476] Table 54. Relative TSLP expression in PCLS normalized to media controls in Example 23.

[0477] Efficient passive uptake of the TSLP RNAi reagent was observed. PCLS cultures treated with the TSLP RNAi reagent showed significant silencing of hTSLP mRNA. Groups 2–10 showed TSLP inhibition on day 8. More specifically, ~80% inhibition (0.198) was achieved on day 8 with AC003546 at 10 µM. Furthermore, dose responses were observed for AC003374, AC003602, and AC003546.

[0478] Example 24. Passive uptake of TSLP RNAi reagent in human precision cut lung slices (PCLS).

[0479] Precision cut tissue sections (PCLS) represent an in vitro model and tool for studying the structure and function of the lung in its natural 3D environment, allowing for in vitro examination of natural interactions between cells, molecules, and the extracellular matrix (ECM) (Alsafadi HN et al., Am J Respir Cell Mol Biol 62 (6): 681-691 (2020)). PCLS can be generated from various anatomical locations of the lung (distal and proximal) and from different species (including rodents, pigs, monkeys, and humans). To validate the efficacy of RNAi reagents in silencing human TSLP mRNA, fresh agarose-filled lung sections from asthma patient donors were used for examination.

[0480] Add saline or TSLP RNAi reagent to the cell culture medium, with daily medium changes. PCLS were cultured in the medium from day 1 to day 7 and harvested on day 8. PCLS were cultured and administered TSLP RNAi reagent according to Table 55 below.

[0481] Table 55. Dosage groups and dosing regimens of the TSLP RNAi reagent from Example 24. Group ID Dosing regimen # PCLS samples (n =) / group Group 1. Salt water Treatment in cell culture medium once daily for 7 days n = 6 Group 2. AC003253 10 µM Treatment in cell culture medium once daily for 7 days n = 6 Group 3. AC003253 1 µM Treatment in cell culture medium once daily for 7 days n = 6 Group 4. AC003253 0.1 µM Treatment in cell culture medium once daily for 7 days n = 6 Group 5. AC003374 10 µM Treatment in cell culture medium once daily for 7 days n = 6 Group 6. AC003374 1 µM Treatment in cell culture medium once daily for 7 days n = 6 Group 7. AC003374 0.1 µM Treatment in cell culture medium once daily for 7 days n = 6 Group 8. AC003546 10 µM Treatment in cell culture medium once daily for 7 days n = 6 Group 9. AC003546 1 µM Treatment in cell culture medium once daily for 7 days n = 6 Group 10. AC003546 0.1 µM Treatment in cell culture medium once daily for 7 days n = 6 Group 11. AC001651 10 µM Treatment in cell culture medium once daily for 7 days n = 6

[0482] AC001651 is an RNAi reagent designed to initiate RISC and inhibit gene expression of different genes, rather than targeting the hTSLP gene.

[0483] B2M was used as an endogenous control gene. TSLP mRNA expression was quantified by qPCR and normalized for the first group of samples treated with saline. The relative expression data from qPCR are shown in Table 56 below.

[0484] Table 56. Relative TSLP expression in PCLS normalized to media controls in Example 24.

[0485] Efficient passive uptake of the TSLP RNAi reagent was observed. PCLS cultures treated with the TSLP RNAi reagent showed silencing of hTSLP mRNA. Groups 2–6 and 8–10 showed TSLP inhibition on day 8. Groups 7 and 11 showed negligible inhibition. More specifically, ~63% inhibition (0.362) was achieved on day 8 with AC003374 at 10 µM. Furthermore, dose responses were observed for both AC003253 and AC003374.

[0486] Example 25. TSLP RNAi reagent in AAV9-CAG-hTSLP AAV mouse model.

[0487] To evaluate certain TSLP RNAi reagents, the same AAV9-CAG-hTSLP (adeno-associated virus) mouse model discussed in Example 4 was used.

[0488] Human TSLP mRNA expression in mouse lung tissue was measured by qPCR.

[0489] On days -17 and -14, each female C57Bl / 6 mouse was given 50 μL of AAV solution containing 2e10 GC (genome copy) of AAV9-CAG-eGFP and 2e10 GC of AAV9-CAG-hTSLP in PBS. On days 1 and 3, each mouse was given 50 μL (at 0.75, 1.5, or 3.0 mg / kg) of TSLP RNAi reagent prepared in isotonic saline, or a mediator control (isotonic saline without RNAi reagent), via intratracheal administration, according to Table 57. Mice were humanely euthanized and harvested on day 15.

[0490] Table 57. Dosage groups in Example 25.

[0491] Each TSLP RNAi reagent comprises a modified nucleotide conjugated to the αvβ6 integrin targeting ligand at the 5' end of the sense strand, having the modified sequence shown in the double-stranded structure described herein. (For specific modification and structural information relating to TSLP RNAi reagents including Tri-SM6.1-αvβ6, see Tables 3, 4, 5, 6, 7A, 7B, 8, 9, 10, and 11).

[0492] Five (5) mice were tested in each group (n=5). Serum samples and the right lower lobe were collected for human TSLP protein measurement by Meso Scale Discovery (MSD) Assay. The left lobe and all remaining right lobes were collected for TSLP mRNA expression measurement by qPCR, using eGFP as an endogenous control gene, and normalized for group 1. Data from the experiments are shown in Table 58 below: Table 58. Mean relative TSLP normalized to control in AAV-hTSLP mice from Example 25. Group ID Average relative hTSLP mRNA expression Low (error) High (error) Group 1. (AAV IT days -17 and -14) (Saline IT days 1 and 3) 1.000 0.130 0.150 Group 2. (AAV IT on days -17 and -14) (0.75 mg / kg AC003374 IT on days 1 and 3) 0.351 0.042 0.047 Group 3. (AAV IT on days -17 and -14) (1.5 mg / kg AC003374 IT on days 1 and 3) 0.385 0.038 0.042 Group 4. (AAV IT on days -17 and -14) (3.0 mg / kg AC003374 IT on days 1 and 3) 0.340 0.068 0.086 Group 5. (AAV IT on days -17 and -14) (0.75 mg / kg AC004361 IT on days 1 and 3) 0.412 0.084 0.106 Group 6. (AAV IT on days -17 and -14) (1.5 mg / kg AC004361 IT on days 1 and 3) 0.397 0.072 0.088 Group 7. (AAV IT on days -17 and -14) (3.0 mg / kg AC004361 IT on days 1 and 3) 0.300 0.048 0.058 Group 8. (AAV IT on days -17 and -14) (1.5 mg / kg AC005945 IT on days 1 and 3) 0.397 0.051 0.058

[0493] As shown in Table 58 above, compared with the control (Group 1), each of the tested TSLP RNAi reagents (Groups 2-8) showed a decrease in hTSLP expression. A dose response was also observed for AC004361.

[0494] Furthermore, for each treatment group, the expression of hTSLP protein in the right lower lobe of collected mouse lung tissue was measured by MSD assay, and data from some samples showed that... Figure 11A and 11B In the middle. For example Figure 11A As shown, AC003374 achieved a ~89% reduction in human TSLP protein in AAV-transduced mouse lungs at a dose of 2 x 3.0 mg / kg, and AC004361 achieved a ~94% reduction at a dose of 2 x 3.0 mg / kg. A dose-response to AC004361 was observed in mouse lungs. Figure 11B As shown, AC003374 achieved a ~90% reduction in human TSLP protein in the serum of AAV-transduced mice at a dose of 2 x 3.0 mg / kg, and AC004361 achieved a ~86% reduction at a dose of 2 x 3.0 mg / kg. Dose-response interactions were observed in mouse serum for both AC003374 and AC004361.

[0495] Example 26. TSLP RNAi reagent in AAV9-CAG-hTSLP AAV mouse model.

[0496] To evaluate certain TSLP RNAi reagents, the same AAV9-CAG-hTSLP (adeno-associated virus) mouse model discussed in Example 4 was used.

[0497] Human TSLP mRNA expression in mouse lung tissue was measured by qPCR.

[0498] On days -17 and -14, each female C57Bl / 6 mouse was given 50 μL of AAV solution containing 2e10 GC (genome copy) of AAV9-CAG-eGFP and 2e10 GC of AAV9-CAG-hTSLP in PBS. On days 1 and 3, each mouse was given 50 μL (at 0.75, 1.5, or 3.0 mg / kg) of TSLP RNAi reagent prepared in isotonic saline, or a mediator control (isotonic saline without RNAi reagent), via intratracheal administration, according to Table 59 below. Mice were humanely euthanized and harvested on day 15.

[0499] RNAi reagent AC005329, a "RISC blocking" RNAi reagent, includes chemical modifications designed to prevent the antisense strand from being loaded into the RISC, and thus serves as a negative control.

[0500] Table 59. Dosing groups in Example 26.

[0501] Each TSLP RNAi reagent comprises a modified nucleotide conjugated to the αvβ6 integrin targeting ligand at the 5' end of the sense strand, having the modified sequence shown in the double-stranded structure described herein. (For specific modification and structural information relating to TSLP RNAi reagents including Tri-SM6.1-αvβ6, see Tables 3, 4, 5, 6, 7A, 7B, 8, 9, 10, and 11).

[0502] Five (5) mice were tested in each group (n=5). Serum samples and the right lower lobe were collected for human TSLP protein measurement via Meso Scale Discovery (MSD) Assay. The left lobe and all remaining right lobes were collected for TSLP mRNA expression measurement via qPCR, using eGFP as an endogenous control gene, and normalized for group 1. Data from the experiments are shown in Table 60 below: Table 60. Mean relative TSLP normalized to control in AAV-hTSLP mice from Example 26. Group ID Average relative hTSLP mRNA expression Low (error) High (error) Group 1. (AAV IT -17, -14 days) (Saline IT -1, 3 days) 1.000 0.224 0.288 Group 2. (AAV IT on days -17 and -14) (0.75 mg / kg AC003374 IT on days 1 and 3) 0.602 0.168 0.233 Group 3. (AAV IT on days -17 and -14) (1.5 mg / kg AC003374 IT on days 1 and 3) 0.521 0.092 0.112 Group 4. (AAV IT on days -17 and -14) (3.0 mg / kg AC003374 IT on days 1 and 3) 0.340 0.073 0.094 Group 5. (AAV IT on days -17 and -14) (0.75 mg / kg AC004361 IT on days 1 and 3) 0.440 0.046 0.051 Group 6. (AAV IT on days -17 and -14) (1.5 mg / kg AC004361 IT on days 1 and 3) 0.350 0.055 0.065 Group 7. (AAV IT on days -17 and -14) (3.0 mg / kg AC004361 IT on days 1 and 3) 0.366 0.117 0.171 Group 8. (AAV IT on days -17 and -14) (3.0 mg / kg AC005329 IT on days 1 and 3) 0.877 0.178 0.223

[0503] As shown in Table 60 above, the RNAi reagents tested in groups 2–7 showed a decrease in hTSLP expression compared to the control (group 1). A dose response was also observed for AC003374.

[0504] Furthermore, for each treatment group, the expression of hTSLP protein in the right lower lobe of collected mouse lung tissue was measured by MSD assay, and data from some samples showed that... Figure 12A and 12B In the middle. For example Figure 12A As shown, AC003374 achieved a ~94% reduction in human TSLP protein in AAV-transduced mouse lungs at a dose of 2 x 3.0 mg / kg, and AC004361 achieved a ~92% reduction at a dose of 2 x 3.0 mg / kg. A dose-response to AC003374 was also observed in mouse lungs. Figure 12B As shown, AC003374 achieved a ~91% reduction in human TSLP protein in the serum of AAV-transduced mice at a dose of 2 x 1.5 mg / kg, and AC004361 achieved a ~92% reduction at a dose of 2 x 1.5 mg / kg.

[0505] Example 27. In vivo administration of TSLP RNAi reagent in B-hTSLP / hTSLPR humanized TSLP knock-in mice use.

[0506] To evaluate certain TSLP RNAi reagents, the B-hTSLP / hTSLPR mouse model was used. (C57BL / 6-) Tslp tm1 (TSLP) Crlf2 tm2 (CRLF2) / Bcgen (strain name), also known as B-hTSLP / hTSLPR mice (generic name), purchased and received from Biocytogen (catalog #121269). The background mice were of the C57BL / 6 strain. In B-hTSLP / hTSLPR mice, exons 1-5 of the mouse TSLP gene encoding the full-length protein were replaced with human TSLP exons 1-4, containing nucleobases 179-658 of human TSLP. The extracellular and transmembrane regions of the human thymic stromal lymphopoietin receptor (TSLPR) gene and the cytoplasmic region of the mouse TSLPR gene were constructed into a chimeric CDS vector and inserted into mouse exon 2. The mice expressed chimeric TSLP and TSLPR proteins, while mouse TSLP or TSLPR was no longer expressed.

[0507] On days 1 and 3, five (n=5) male B-hTSLP / hTSLPR mice were administered the TSLP RNAi reagent (5.0 mg / kg) via intratracheal (IT) at a dose volume of 50 μL, either in saline (as a mediator control) or in isotonic saline. Administration was performed according to Table 61 below.

[0508] RNAi reagent AC005329, a "RISC blocking" RNAi reagent, includes chemical modifications designed to prevent the antisense strand from being loaded into the RISC, and thus serves as a negative control.

[0509] Table 61. Dosage groups in Example 27. Group RNAi reagents Dosing regimen Day of Execution #Animals(n =) 1 brine Days 1 and 3: IT Implementation Day 15 n = 5 2 AC003374 5.0 mg / kg Days 1 and 3: IT Implementation Day 15 n = 5 3 AC004361 5.0 mg / kg Days 1 and 3: IT Implementation Day 15 n = 5 4 AC005329 5.0 mg / kg Days 1 and 3: IT Implementation Day 15 n = 5 5 brine Days 1 and 3: IT Implementation Day 29 n = 5 6 AC003374 5.0 mg / kg Days 1 and 3: IT Implementation Day 29 n = 5 7 AC004361 5.0 mg / kg Days 1 and 3: IT Implementation Day 29 n = 5 8 brine Days 1 and 3: IT Implementation Day 43 n = 5 9 AC003374 5.0 mg / kg Days 1 and 3: IT Implementation Day 43 n = 5 10 AC004361 5.0 mg / kg Days 1 and 3: IT Implementation Day 43 n = 4

[0510] Five (5) mice were tested in each group (n=5). The mice were euthanized and harvested on days 15, 29, or 43. Lungs were collected for TSLP mRNA expression measurement by qPCR, using mGAPDH as an endogenous control gene. Groups 2–4 were normalized relative to group 1, groups 6–7 to group 5, and groups 9–10 to group 8. Data from the experiments are shown in Table 62 below: Table 62. Relative TSLP expression in mouse test animals of Example 27.

[0511] TSLP RNAi reagents silenced the expression of human TSLP mRNA in the lungs of knock-in mice for more than 6 weeks. The RISC-blocking RNAi reagent AC005329 (Group 4) showed no effect in silencing hTSLP expression. Groups 2, 3, 6, 7, 9, and 10 showed reduced hTSLP expression in the mouse test animals. More specifically, AC003374 showed hTSLP inhibition, with ~52% inhibition (0.475) at 5.0 mg / kg on day 43. Groups 9 and 10 showed hTSLP inhibition that persisted at least until day 43.

[0512] Example 28. In vivo administration of TSLP RNAi reagent in B-hTSLP / hTSLPR humanized TSLP knock-in mice use.

[0513] To evaluate certain TSLP RNAi reagents, the B-hTSLP / hTSLPR mouse model was used. (C57BL / 6-) Tslp tm1 (TSLP) Crlf2 tm2 (CRLF2) / Bcgen (strain name), also known as B-hTSLP / hTSLPR mice (generic name), purchased and received from Biocytogen (catalog #121269). The background mice were of the C57BL / 6 strain. In B-hTSLP / hTSLPR mice, exons 1-5 of the mouse TSLP gene encoding the full-length protein were replaced with exons 1-4 of the human TSLP gene, containing nucleobases 179-658 of the human TSLP. The extracellular and transmembrane regions of the human thymic stromal lymphopoietin receptor (TSLPR) gene and the cytoplasmic region of the mouse TSLPR gene were constructed into a chimeric CDS vector and inserted into mouse exon 2. The mice expressed chimeric TSLP and TSLPR proteins, while mouse TSLP and TSLPR were no longer expressed.

[0514] On days 1 and 3, five (n=5) male B-hTSLP / hTSLPR mice were administered the TSLP RNAi reagent (at 1.0, 2.5, or 5.0 mg / kg) via intratracheal (IT) administration at a dose volume of 50 μL, either in saline (as a mediator control) or in isotonic saline. Administration was performed according to Table 63 below.

[0515] RNAi reagents AC005329 and AC006020, “RISC blocking” RNAi reagents, include chemical modifications designed to prevent the antisense strand from being loaded into the RISC, and therefore serve as negative controls.

[0516] Table 63. Dosage groups in Example 28. Group RNAi reagents Dosing regimen Day of Execution #Animals(n =) 1 brine Days 1 and 3: IT Implementation Day 15 n = 5 2 AC003374 5.0 mg / kg Days 1 and 3: IT Implementation Day 15 n = 5 3 AC003374 2.5 mg / kg Days 1 and 3: IT Implementation Day 15 n = 5 4 AC003374 1.0 mg / kg Days 1 and 3: IT Implementation Day 15 n = 5 5 AC004361 5.0 mg / kg Days 1 and 3: IT Implementation Day 15 n = 5 6 AC004361 2.5 mg / kg Days 1 and 3: IT Implementation Day 15 n = 5 7 AC004361 1.0 mg / kg Days 1 and 3: IT Implementation Day 15 n = 5 8 AC005329 5.0 mg / kg Days 1 and 3: IT Implementation Day 15 n = 5 9 AC005329 2.5 mg / kg Days 1 and 3: IT Implementation Day 15 n = 5 10 AC005329 1.0 mg / kg Days 1 and 3: IT Implementation Day 15 n = 5 11 AC006020 5.0 mg / kg Days 1 and 3: IT Implementation Day 15 n = 4

[0517] Five (5) mice were tested in each group (n=5). The mice were euthanized and harvested on day 15. Lungs were collected for TSLP mRNA expression measurement by qPCR, using mB2M as an endogenous control gene. Groups 2–11 were normalized to group 1. Data from the experiments are shown in Table 64 below: Table 64. Relative TSLP expression in mouse test animals of Example 28.

[0518] Groups 2–7 showed a decrease in hTSLP in the mouse test animals. Groups 8–11 showed negligible hTSLP inhibition. More specifically, AC003374 showed hTSLP inhibition, with ~49% inhibition (0.506) at 5.0 mg / kg on day 15. A dose response was observed in mice treated with AC003374.

[0519] Other implementation plans It should be understood that although the invention has been described in conjunction with its detailed description, the foregoing specification is intended to illustrate, and not limit, the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the appended claims.

Claims

1. An RNAi reagent for inhibiting the expression of the thymic stromal lymphopoietin gene, comprising: The antisense strand contains at least 17 adjacent nucleotides that differ from any of the sequences provided in Table 2 or Table 3 by 0 or 1 nucleotide; and The sense strand contains a nucleotide sequence that is at least partially complementary to the antisense strand.

2. The RNAi reagent according to claim 1, wherein the antisense strand comprises nucleotides 2-18 of any of the sequences provided in Table 2 or Table 3.

3. The RNAi reagent according to claim 1 or claim 2, wherein the sense strand comprises a nucleotide sequence of at least 17 adjacent nucleotides differing from any of the sequences provided in Table 2 or Table 4 by 0 or 1 nucleotide, and wherein the sense strand has a region on the 17 adjacent nucleotides that is at least 85% complementary to the antisense strand.

4. The RNAi reagent according to any one of claims 1-3, wherein at least one nucleotide of the TSLP RNAi reagent is a modified nucleotide or includes a modified internucleotide bond.

5. The RNAi reagent according to any one of claims 1-4, wherein all or substantially all nucleotides are modified nucleotides.

6. The RNAi reagent according to any one of claims 4-5, wherein the modified nucleotide is selected from: 2'-O-methyl nucleotide, 2'-fluoronucleotide, 2'-deoxynucleotide, 2',3'-cleaved nucleotide mimic, locked nucleotide, 2'-F-arabinonucleotide, 2'-methoxyethyl nucleotide, debased nucleotide, ribitol, reverse nucleotide, reverse 2'-O-methyl nucleotide, reverse 2'-deoxynucleotide, 2'-amino modified nucleotide, 2'-alkyl modified nucleotide, morpholinonucleotide, vinylphosphonate-containing nucleotide, cyclopropylphosphonate-containing nucleotide, and 3'-O-methyl nucleotide.

7. The RNAi reagent according to claim 5, wherein all or substantially all nucleotides are modified with 2'-O-methylnucleotides, 2'-fluoronucleotides, or combinations thereof.

8. The RNAi reagent according to any one of claims 1-7, wherein the antisense strand comprises a nucleotide sequence of any of the modified sequences provided in Table 3.

9. The RNAi reagent according to any one of claims 1-8, wherein the sense strand comprises a nucleotide sequence of any of the modified sequences provided in Table 4.

10. The RNAi reagent of claim 1, wherein the antisense strand comprises a nucleotide sequence of any of the modified sequences provided in Table 3, and the sense strand comprises a nucleotide sequence of any of the modified sequences provided in Table 4.

11. The RNAi reagent according to any one of claims 1-10, wherein the sense strand is 18 to 30 nucleotides in length and the antisense strand is 18 to 30 nucleotides in length.

12. The RNAi reagent according to claim 11, wherein the sense strand and the antisense strand are each 18 to 27 nucleotides in length.

13. The RNAi reagent according to claim 12, wherein the sense strand and the antisense strand are each 18 to 24 nucleotides in length.

14. The RNAi reagent according to claim 13, wherein the sense strand and the antisense strand are each 21 nucleotides in length.

15. The RNAi reagent according to claim 14, wherein the RNAi reagent has two blunt ends.

16. The RNAi reagent according to any one of claims 1-15, wherein the sense strand comprises one or two terminal caps.

17. The RNAi reagent according to any one of claims 1-16, wherein the sense strand comprises one or two reverse debasement residues.

18. The RNAi reagent according to claim 1, wherein the RNAi reagent comprises a sense strand and an antisense strand, the sense strand and the antisense strand forming a duplex having a structure having any one of the duplexes in Table 7A, Table 7B, Table 8, Table 9 or Table 10.

19. The RNAi reagent of claim 18, wherein all or substantially all nucleotides are modified nucleotides.

20. The RNAi reagent of claim 1, comprising an antisense strand, said antisense strand consisting of, substantially consisting of, or containing a nucleotide sequence, said nucleotide sequence being associated with the following nucleotide sequence (5' 3') differs by 0 or 1 nucleotide: AGACAUUUAUUGGUUGUGACC (SEQ ID NO: 836); AGACGUUUAUUGGUUGUGACC (SEQ ID NO: 853); UGACAUUUAUUGGUUGUGACC (SEQ ID NO: 837); UGACGUUUAUUGGUUGUGACC (SEQ ID NO: 856); AGACAUUUAUUGGUUGUGA (SEQ ID NO: 196); UGACAUUUUGGUUGUGA (SEQ ID NO: 197); UUAGCAUUUAUCUGAGUUU (SEQ ID NO: 137); UUAGCAUUUAUCUGAGUUC (SEQ ID NO: 139); UACAUUUAUUGGUUGUGAC (SEQ ID NO: 192); AGACAUUUAUUGGUUGUGACU (SEQ ID NO: 830); UUAGCAUUUAUCUGAGUUUCC (SEQ ID NO: 825); or UACAUUUAUUGGUUGUGACUU (SEQ ID NO: 826).

21. The RNAi reagent of claim 20, wherein the sense strand consists of, is substantially composed of, or contains a nucleotide sequence, said nucleotide sequence being associated with the following nucleotide sequence (5' 3') differs by 0 or 1 nucleotide: GGUCACAACCAAUAAAUGUCU (SEQ ID NO: 872); GGUCACAACCAAUAAAUGUCA (SEQ ID NO: 873); UCACAACCAAUAAAUGUCU (SEQ ID NO: 461); UCACAACCAAUAAAUGUCA (SEQ ID NO: 462); AAACUCAGAUAAAUGCUAA (SEQ ID NO: 402); G(A 2N )ACUCAGAUAAAUGCUAA (SEQ ID NO: 871); GUCACAACCAAUAAAUGUA (SEQ ID NO: 457) AGUCACAACCAAUAAAUGUCU (SEQ ID NO: 864); GGAAACUCAGAUAAAUGCUAA (SEQ ID NO: 866); or (A 2N )AGUCACAACCAAUAAAUGUA (SEQ ID NO: 863), where (A 2N ) represents 2-aminoadenosine nucleotide.

22. The RNAi reagent according to claim 20 or 21, wherein all or substantially all nucleotides are modified nucleotides.

23. The RNAi reagent of claim 1, comprising an antisense strand, said antisense strand comprising, consisting of, or substantially consisting of a modified nucleotide sequence, said modified nucleotide sequence being associated with the following nucleotide sequence (5' 3') differs by 0 or 1 nucleotide: cPrpasGfsacauuuaUfuGfgUfuGfugacsc (SEQ ID NO: 649) cPrpasGfsaCfaUfuUfaUfuGfgUfuGfuGfaCfsu (SEQ ID NO: 609); cPrpasGfsacauuuaUfuGfgUfuGfugacsu (SEQ ID NO: 611); cPrpasGfsacguuuaUfuGfgUfuGfugacsc (SEQ ID NO: 681); cPrpasGfsacauuuAfuuGfgUfuGfugacsu (SEQ ID NO: 612); cPrpusUfsagcauuUfauCfuGfaGfuuucsc (SEQ ID NO: 603); cPrpusUfsagcauUfuauCfuGfaGfuuucsc (SEQ ID NO: 606); or cPrpusAfscsAfuUfuAfuUfgGfuUfgUfgAfcUfsu (SEQ ID NO: 594); Where a represents 2′-O-methyladenosine, c represents 2′-O-methylcytidine, g represents 2′-O-methylguanosine, and u represents 2′-O-methyluridine; Af represents 2′-fluoroadenosine, Cf represents 2′-fluorocytidine, Gf represents 2′-fluoroguanosine, and Uf represents 2′-fluorouridine; cPrpa represents 5′-cyclopropylphosphonate-2′-O-methyladenosine; cPrpu represents 5′-cyclopropylphosphonate-2′-O-methyluridine; s represents phosphate thioester bond; and all or substantially all nucleotides on the sense chain are modified nucleotides.

24. The RNAi reagent of claim 1, wherein the sense strand comprises, consists of, or is substantially composed of a modified nucleotide sequence, said modified nucleotide sequence being associated with the following nucleotide sequence (5' 3') differs by 0 or 1 nucleotide: gsgucacaaCfCfAfauaaaugucu (SEQ ID NO: 714); asgucacaaCfCfAfauaaaugucu (SEQ ID NO: 702); gsgaaacucAfGfAfuaaaugcuaa (SEQ ID NO: 704); a_2NsagucacaAfCfCfaauaaaugua (SEQ ID NO: 701); Where a represents 2′-O-methyladenosine, c represents 2′-O-methylcytidine, g represents 2′-O-methylguanosine, and u represents 2′-O-methyluridine; Af represents 2′-fluoroadenosine, Cf represents 2′-fluorocytidine, Gf represents 2′-fluoroguanosine, and Uf represents 2′-fluorouridine; a_2N represents 2′-O-methyl-2-aminoadenosine; s represents thiophosphate bond; and all or substantially all nucleotides on the antisense strand are modified nucleotides.

25. The RNAi reagent according to any one of claims 20-24, wherein the sense strand further comprises a reverse debasement residue at the 3' end of the nucleotide sequence, at the 5' end of the nucleotide sequence, or at both.

26. The RNAi reagent according to any one of claims 1-25, wherein the RNAi reagent is linked to a targeting ligand.

27. The RNAi reagent of claim 26, wherein the targeting ligand has affinity for a cell receptor expressed on epithelial cells.

28. The RNAi reagent of claim 27, wherein the targeting ligand comprises an integrin targeting ligand.

29. The RNAi reagent according to claim 28, wherein the integrin targeting ligand is the αvβ6 integrin targeting ligand.

30. The RNAi reagent of claim 29, wherein the targeting ligand comprises the following structure: Or its pharmaceutically acceptable salt, or Or its pharmaceutically acceptable salt. in Indicates the connection point with the RNAi reagent.

31. The RNAi reagent according to any one of claims 26-29, wherein the targeting ligand has a structure selected from the following: in Indicates the connection point with the RNAi reagent.

32. The RNAi reagent according to claim 31, wherein the RNAi reagent is conjugated to a targeting ligand having the following structure: 。 33. The RNAi reagent according to any one of claims 26-32, wherein the targeting ligand is conjugated to the sense strand.

34. The RNAi reagent of claim 33, wherein the targeting ligand is conjugated to the 5' end of the sense strand.

35. The RNAi reagent according to any one of claims 1-34, wherein the RNAi reagent is a pharmaceutically acceptable salt.

36. The RNAi reagent according to claim 35, wherein the RNAi reagent is a sodium salt.

37. A composition comprising the RNAi reagent according to any one of claims 1-36, wherein the composition further comprises a pharmaceutically acceptable excipient.

38. The composition of claim 37, further comprising a second RNAi agent capable of inhibiting the expression of the thymic stromal lymphopoietin gene.

39. The composition according to any one of claims 37-38, further comprising one or more additional therapeutic agents.

40. The composition according to any one of claims 37-39, wherein the composition is formulated for administration by inhalation.

41. The composition of claim 40, wherein the composition is delivered by a metering inhaler, a jet sprayer, a vibrating mesh sprayer, or a soft mist inhaler.

42. The composition according to any one of claims 37-41, wherein the RNAi reagent is a sodium salt.

43. The composition according to any one of claims 37-42, wherein the pharmaceutically acceptable excipient is water for injection.

44. The composition according to any one of claims 37-42, wherein the pharmaceutically acceptable excipient is a buffered saline solution.

45. A method for inhibiting TSLP gene expression in cells, the method comprising introducing an effective amount of an RNAi reagent according to any one of claims 1-35 or a composition according to any one of claims 37-44 into the cells.

46. ​​The method of claim 45, wherein the cells are within the subject.

47. The method of claim 46, wherein the subject is a human subject.

48. The method according to any one of claims 45-47, wherein the expression of the thymic stromal lymphopoietin gene is suppressed by at least about 30% after the administration of the RNAi reagent.

49. A method for treating one or more symptoms or diseases associated with increased or elevated levels of TSLP cytokine activity, the method comprising administering to a human subject in need a therapeutically effective amount of the composition according to any one of claims 37-44.

50. The method of claim 49, wherein the disease is asthma, including but not limited to allergic asthma; chronic obstructive pulmonary disease, including but not limited to chronic bronchitis and emphysema; inflammatory lung diseases; interstitial lung disease (ILD); cystic fibrosis; various other types of fibrosis; infectious diseases (e.g., SARS-CoV-2); acute lung injury (e.g., acute respiratory distress syndrome (ARDS)); pulmonary hypertension; various lung cancers; chronic sinusitis with or without nasal polyps; autoimmune diseases, including but not limited to systemic sclerosis (SSc); and various inflammatory diseases, including but not limited to atopic dermatitis, chronic spontaneous urticaria, and eosinophilic esophagitis.

51. The method of claim 50, wherein the disease is allergic asthma.

52. The method according to any one of claims 45-51, wherein the RNAi reagent is administered at a deposition dose of about 0.01 mg / kg to about 5.0 mg / kg of the subject's body weight.

53. The method according to any one of claims 45-52, wherein the RNAi reagent is administered at a deposition dose of about 0.03 mg / kg to about 2.0 mg / kg of the subject's body weight.

54. The method according to any one of claims 45-53, wherein the RNAi reagent is administered in two or more doses.

55. The use of the RNAi reagent according to any one of claims 1-36 for the treatment of diseases, conditions or symptoms mediated at least in part by TSLP cytokine activity and / or TSLP gene expression.

56. The use of the composition according to any one of claims 37-44 for the treatment of at least a portion of a disease, condition, or symptom mediated by thymic stromal lymphopoietin cytokine activity and / or thymic stromal lymphopoietin gene expression.

57. Use of the composition according to any one of claims 37-44 for manufacturing a pharmaceutical agent for treating at least a portion of a disease, condition, or symptom mediated by thymic stromal lymphopoietin cytokine and / or thymic stromal lymphopoietin gene expression.

58. The use according to any one of claims 55-57, wherein the disease is lung inflammation.

59. A method for preparing an RNAi reagent according to any one of claims 1-36, comprising annealing the sense strand and the antisense strand to form a double-stranded ribonucleic acid molecule.

60. The method of claim 59, wherein the sense strand comprises a targeting ligand.

61. The method of claim 60, further comprising conjugating the target ligand to a sense chain.

Images