Rnai agents for inhibiting expression of interleukin 33 (IL33), compositions thereof, and methods of use

IL33-specific RNAi agents with targeted delivery mechanisms inhibit IL33 gene expression, effectively treating asthma and autoimmune disorders by reducing pulmonary inflammation.

WO2026097000A1PCT designated stage Publication Date: 2026-05-07ARROWHEAD PHARMACEUTICALS INC
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/053729
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2025-05-06
Filing Date
2025-11-03
Publication Date
2026-05-07

AI Technical Summary

Technical Problem

There is a need for novel RNA interference (RNAi) agents that can selectively and efficiently inhibit the expression of the IL33 gene to treat diseases associated with pulmonary inflammation such as asthma and autoimmune disorders.

Method used

Development of IL33-specific RNAi agents with specific nucleotide sequences and chemical modifications, combined with targeting ligands, to deliver the agents to relevant pulmonary cells, thereby inhibiting IL33 gene expression and reducing inflammation.

Benefits of technology

The IL33 RNAi agents effectively decrease IL33 expression, providing therapeutic benefits for conditions like asthma, COPD, and autoimmune disorders by reducing airway inflammation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000008_0001
    Figure IMGF000008_0001
  • Figure IMGF000014_0001
    Figure IMGF000014_0001
  • Figure IMGF000023_0001
    Figure IMGF000023_0001
Patent Text Reader

Abstract

Described are RNAi agents, compositions that include RNAi agents, and methods for inhibition of an interleukin 33 (IL33) gene. The IL33 RNAi agents and RNAi agent conjugates disclosed herein inhibit the expression of an IL33 gene. Pharmaceutical compositions that include one or more IL33 RNAi agents, optionally with one or more additional therapeutics, are also described. Delivery of the described IL33 RNAi agents to pulmonary cells, in vivo, provides for inhibition of IL33 gene expression, which can provide a therapeutic benefit to subjects, including human subjects, for the treatment of various diseases including pulmonary inflammation diseases such as asthma, including allergic asthma.
Need to check novelty before this filing date? Find Prior Art

Description

RNAi Agents for Inhibiting Expression of Interleukin 33 (IL33), Compositions Thereof, and Methods of UseCROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of priority to United States Provisional Patent Application Serial No. 63 / 715,778, filed on November 4, 2024. and United States Provisional Patent Application Serial No. 63 / 800,753, filed on May 6, 2025, the contents of each of which are incorporated herein by reference in their entirety.FIELD OF THE INVENTION

[0002] The present disclosure relates to RNA interference (RNAi) agents, e.g., double stranded oligonucleotide RNAi agents, for inhibition of Interleukin 33 (“IL33”) gene expression, compositions that include IL33 RNAi agents, and methods of use thereof.SEQUENCE LISTING

[0003] This application contains a Sequence Listing (in compliance with Standard ST26), which has been submitted in xml format and is hereby incorporated by reference in its entirety. The xml sequence listing file is named 30755-WO_SeqListing.xml, created October 27, 2025, and is 2,290,472 bytes in size.BACKGROUND

[0004] Interleukin-33 (IL33) is a member of the IL-1 cytokine family that includes IL-la, IL-1(3, and IL- 18 and constitutively expressed in structural and lining cells including fibroblasts, endothelial, and epithelial cells of skin, gastrointestinal tract, and lungs that are exposed to the environment. IL-33 is a Th2-oriented cytokine which enhances the production of Th2 cytokines, particularly IL-5 and IL-13. Chan BCL, Lam CWK, Tam L-S and Wong CK (2019) IL33: Roles in Allergic Inflammation and Therapeutic Perspectives. Front. Immunol. 10:364.

[0005] IL33 has been identified as influential for allergic airway diseases in humans, and has been found to be associated with asthma and allergic rhinitis in several GWAS studies that included thousands of human subjects from diverse ethnic groups. Drake LY, Kita H. IL-33: biological properties, functions, and roles in airway disease. Immunol Rev. 2017 Juli278(l): 173-184.SUMMARY

[0006] There exists a need for novel RNA interference (RNAi) agents (termed RNAi agents, RNAi triggers, or triggers), e.g., double stranded RNAi agents, that are able to selectively and efficiently inhibit the expression of an IL33 gene, including for use as a therapeutic or medicament. Further, there exists a need for compositions of novel IL33-specific RNAi agents for the treatment of diseases or disorders associated with pulmonary inflammation such as asthma (specifically including allergic asthma) and / or disorders that can be mediated at least in part by a reduction in IL33 gene expression.

[0007] The nucleotide sequences and chemical modifications of the IL33 RNAi agents disclosed herein, as well as their combination with certain specific targeting ligands suitable for selectively and efficiently delivering the IL33 RNAi agents to relevant pulmonary cells in vivo, differ from what is previously disclosed or known in the art. The IL33 RNAi agents disclosed herein provide for highly potent and efficient inhibition of the expression of an IL33 gene.

[0008] In general, the present disclosure features IL33 gene-specific RNAi agents, compositions that include IL33 RNAi agents, and methods for inhibiting expression of an IL33 gene in vitro and / or in vivo using the IL33 RNAi agents and compositions that include IL33 RNAi agents described herein. The IL33 RNAi agents described herein are able to selectively and efficiently decrease expression of an IL33 gene, and thereby inhibiting the translation of IL33 proteins or cytokines that are at the beginning of the inflammatory cascade resulting in a reduction of airw ay inflammation.

[0009] The described IL33 RNAi agents can be used in methods for therapeutic treatment (including preventative or prophylactic treatment) of symptoms and diseases including, but not limited to, asthma, chronic obstructive pulmonary disease (COPD), autoimmune disorders, and bronchopulmonary dysplasia (BPD).

[0010] In one aspect, the disclosure features RNAi agents for inhibiting expression of an IL33 gene, wherein the RNAi agent includes a sense strand (also referred to as a passenger strand) and an antisense strand (also referred to as a guide strand). The sense strand and the antisense strand can be partially, substantially, or fully complementary to each other. The length of the RNAi agent sense strands described herein each can be 12 to 49 nucleotides in length. The length of the RNAi agent antisense strands described herein each can be 18 to 30 nucleotides in length. In some embodiments, the sense and antisense strands are independently 18 to 26nucleotides in length. The sense and antisense strands can be either the same length or different lengths. In some embodiments, the sense and antisense strands are independently 21 to 26 nucleotides in length. In some embodiments, the sense and antisense strands are independently 21 to 24 nucleotides in length. In some embodiments, both the sense strand and the antisense strand are 21 nucleotides in length. In some embodiments, the antisense strands are independently 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, the sense strands are independently 12, 13. 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides in length. The RNAi agents described herein, upon delivery to a cell expressing IL33 such as a pulmonary cell, inhibit the expression of one or more IL33 gene variants in vivo and / or in vitro.

[0011] The IL33 RNAi agents disclosed herein target a human IL33 gene (see. e.g., SEQ ID NO:1). In some embodiments, the IL33 RNAi agents disclosed herein target a portion of an IL33 gene having the sequence of any of the sequences disclosed in Table 1.

[0012] In another aspect, the disclosure features compositions, including pharmaceutical compositions, that include one or more of the disclosed IL33 RNAi agents that are able to selectively and efficiently decrease expression of an IL33 gene. The compositions that include one or more IL33 RNAi agents described herein can be administered to a subject, such as a human or animal subject, for the treatment (including prophylactic treatment or inhibition) of symptoms and diseases including, but not limited to. asthma including but not limited to asthma, chronic obstructive pulmonary disease (COPD), autoimmune disorders, and bronchopulmonary dysplasia (BPD).

[0013] Examples of IL33 RNAi agent sense strands and antisense strands that can be used in an IL33 RNAi agent are provided in Tables 3, 4, 5. and 6. Examples of IL33 RNAi agent duplexes are provided in Tables 7A, 7B, 8, 9, and 10. Examples of 19-nucleotide core stretch sequences that may consist of or may be included in the sense strands and antisense strands of certain IL33 RNAi agents disclosed herein, are provided in Table 2.

[0014] In another aspect, the disclosure features methods for delivering IL33 RNAi agents to epithelial cells in a subject, such as a mammal, in vivo. Also described herein are compositions for use in such methods. In some embodiments, disclosed herein are methods for delivering IL33 RNAi agents to pulmonary cells (epithelial cells, macrophages, smooth muscle, endothelial cells) to a subject in vivo. In some embodiments, the subject is a human subject.

[0015] The methods disclosed herein include the administration of one or more IL33 RNAi agents to a subject, e.g., a human or animal subject, by any suitable means known in the art. The pharmaceutical compositions disclosed herein that include one or more IL33 RNAi agents can be administered in a number of ways depending upon whether local or systemic treatment is desired. Administration can be, but is not limited to, for example, intravenous, intraarterial, subcutaneous, intraperitoneal, subdermal (e.g., via an implanted device), and intraparenchymal administration. In some embodiments, the pharmaceutical compositions described herein are administered by inhalation (such as dry powder inhalation or aerosol inhalation) or through use of a nebulizer, intranasal administration, intratracheal administration, or oropharyngeal aspiration administration.

[0016] In some embodiments, it is desired that the IL33 RNAi agents described herein inhibit the expression of an IL33 gene in the pulmonary epithelium, for which the administration is by inhalation (e.g., by an inhaler device, such as a metered-dose inhaler, or a nebulizer such as a jet or vibrating mesh nebulizer, or a soft mist inhaler).

[0017] The one or more IL33 RNAi agents can be delivered to target cells or tissues using any oligonucleotide delivery technology known in the art. In some embodiments, an IL33 RNAi agent is delivered to cells or tissues by covalently linking the RNAi agent to a targeting group. In some embodiments, the targeting group can include a cell receptor ligand, such as an integrin targeting ligand. Integrins are a family of transmembrane receptors that facilitate cell-extracellular matrix (ECM) adhesion. In particular, integrin alpha-v-beta-6 (av06) is an epithelial-specific integrin that is known to be a receptor for ECM proteins and the TGF-beta latency-associated peptide (LAP), and is expressed in various cells and tissues. Integrin avf>6 is known to be highly upregulated in injured pulmonary epithelium. In some embodiments, the IL33 RNAi agents described herein are linked to an integrin targeting ligand that has affinity for integrin av06. As referred to herein, an “av06 integrin targeting ligand” is a compound that has affinity for integrin av06, which can be utilized as a ligand to facilitate the targeting and delivery' of an RNAi agent to which it is attached to the desired cells and / or tissues (i.e., to cells expressing integrin av(36). In some embodiments, multiple avf>6 integrin targeting ligands or clusters of av[36 integrin targeting ligands are linked to an IL33 RNAi agent. In some embodiments, the IL33 RNAi agent-avf>6 integrin targeting ligand conjugates are selectively internalized by lung epithelial cells, either through receptor-mediated endocytosis or by other means.

[0018] Examples of targeting groups useful for delivering IL33 RNAi agents that include av 6 integrin targeting ligands are disclosed, for example, in International Patent Application Publication No. WO 2018 / 085415 and International Patent Application Publication No. WO 2019 / 089765, the contents of each of which are incorporated by reference herein in their entirety.

[0019] A targeting group can be linked to the 3' or 5' end of a sense strand or an antisense strand of an IL33 RNAi agent. In some embodiments, a targeting group is linked to the 3' or 5' end of the sense strand. In some embodiments, a targeting group is linked to the 5' end of the sense strand. In some embodiments, a targeting group is linked internally to a nucleotide on the sense strand and / or the antisense strand of the RNAi agent. In some embodiments, one or more targeting ligands are linked internally to one or more nucleotides on the sense strand of the RNAi agent. In some embodiments, a targeting group is linked to the RNAi agent via a linker.

[0020] In another aspect, the disclosure features compositions that include one or more IL33 RNAi agents that have the duplex structures disclosed in Tables 7A, 7B, 8, 9, and 10.

[0021] The use of IL33 RNAi agents provides methods for therapeutic (including prophylactic) treatment of diseases or disorders for which a reduction in IL33 can provide a therapeutic benefit. The IL33 RNAi agents disclosed herein can be used to treat various diseases such as asthma including but not limited to allergic asthma, chronic obstructive pulmonary disease including but not limited to asthma, chronic obstructive pulmonary disease (COPD), autoimmune disorders, and bronchopulmonary dysplasia (BPD). In some embodiments, the IL33 RNAi agents disclosed herein can be used to treat a pulmonary inflammatory disease or condition. In some embodiments, the IL33 RNAi agents disclosed herein can be used to treat asthma. IL33 RNAi agents can be used to treat, for example, allergic asthma. Such methods of treatment include administration of an IL33 RNAi agent to a human being or animal for which a reduction in IL33 levels is desired.Definitions

[0022] As used herein, the terms "‘oligonucleotide" and “polynucleotide” mean a polymer of linked nucleosides each of w hich can be independently modified or unmodified.

[0023] As used herein, an “RNAi agent” (also referred to as an “RNAi trigger”) means a composition of matter that contains an RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule that is capable of degrading or inhibiting (e.g., degrades or inhibits under appropriate conditions) translation of messenger RNA (mRNA) transcripts of a targetmRNA in a sequence specific manner. As used herein, RNAi agents may operate through the RNA interference mechanism (i.e., inducing RNA interference through interaction with the RNA interference pathway machinery (RNA-induced silencing complex or RISC) of mammalian cells), or by any alternative mechanism(s) or pathway(s). While it is believed that RNAi agents, as that term is used herein, operate primarily through the RNA interference mechanism, the disclosed RNAi agents are not bound by or limited to any particular pathway or mechanism of action. RNAi agents disclosed herein are comprised of a sense strand and an antisense strand, and include, but are not limited to: short (or small) interfering RNAs (siRNAs), double stranded RNAs (dsRNA), micro RNAs (miRNAs), short hairpin RNAs (shRNA), and dicer substrates. The antisense strand of the RNAi agents described herein is at least partially complementary to the mRNA being targeted (i.e. IL33 mRNA). RNAi agents can include one or more modified nucleotides and / or one or more non-phosphodi ester linkages.

[0024] As used herein, the terms “silence,” “reduce,” “inhibit,” “down-regulate,” or “knockdown” when referring to expression of a given gene, mean that the expression of the gene, as measured by the level of RNA transcribed from the gene or the level of polypeptide, protein, or protein subunit translated from the mRNA in a cell, group of cells, tissue, organ, or subject in which the gene is transcribed, is reduced when the cell, group of cells, tissue, organ, or subject is treated with the RNAi agents described herein as compared to a second cell, group of cells, tissue, organ, or subject that has not or have not been so treated.

[0025] As used herein, the terms “sequence” and “nucleotide sequence” mean a succession or order of nucleobases or nucleotides, described with a succession of letters using standard nomenclature.

[0026] As used herein, a “base,” “nucleotide base,” or “nucleobase,” is a heterocyclic pyrimidine or purine compound that is a component of a nucleotide, and includes the primary purine bases adenine and guanine, and the primary pyrimidine bases cytosine, thymine, and uracil. A nucleobase may further be modified to include, without limitation, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. (See, e.g., Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley -VCH, 2008). The synthesis of such modified nucleobases (including phosphoramidite compounds that include modified nucleobases) is known in the art.

[0027] As used herein, and unless otherwise indicated, the term “complementary,” when used to describe a first nucleobase or nucleotide sequence (e.g., RNAi agent sense strand or targeted mRNA) in relation to a second nucleobase or nucleotide sequence (e.g., RNAi agent antisensestrand or a single-stranded antisense oligonucleotide), means the abi 1 i ty of an oligonucleotide or polynucleotide including the first nucleotide sequence to hybridize (form base pair hydrogen bonds under mammalian physiological conditions (or otherwise suitable in vivo or in vitro conditions)) and form a duplex or double helical structure under certain standard conditions with an oligonucleotide that includes the second nucleotide sequence. The person of ordinary skill in the art would be able to select the set of conditions most appropriate for a hybridization test. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs and include natural or modified nucleotides or nucleotide mimics, at least to the extent that the above hybridization requirements are fulfilled. Sequence identity or complementarity is independent of modification. For example, a and Af, as defined herein, are complementary to U (or T) and identical to A for the purposes of determining identity’ or complementarity.

[0028] As used herein, “perfectly complementary7” or “fully complementary” means that in a hybridized pair of nucleobase or nucleotide sequence molecules, all (100%) of the bases in a contiguous sequence of a first oligonucleotide will hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence may comprise all or a part of a first or second nucleotide sequence.

[0029] As used herein, “partially complementary” means that in a hybridized pair of nucleobase or nucleotide sequence molecules, at least 70%, but not all, of the bases in a contiguous sequence of a first oligonucleotide will hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence may comprise all or a part of a first or second nucleotide sequence.

[0030] As used herein, “substantially complementary” means that in a hybridized pair of nucleobase or nucleotide sequence molecules, at least 85%, but not all, of the bases in a contiguous sequence of a first oligonucleotide will hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence may compnse all or a part of a first or second nucleotide sequence.

[0031] As used herein, the terms “complementary,” “fully complementary,” “partially complementary’,” and “substantially complementary’” are used with respect to the nucleobase or nucleotide matching between the sense strand and the antisense strand of an RNAi agent, or between the antisense strand of an RNAi agent and a sequence of an IL33 mRNA.

[0032] As used herein, the term “substantially identical” or “substantial identity,” as applied to a nucleic acid sequence means the nucleotide sequence (or a portion of a nucleotide sequence) has at least about 85% sequence identity or more, e.g., at least 90%, at least 95%, orat least 99% identity, compared to a reference sequence. Percentage of sequence identity is determined by comparing two optimally aligned sequences over a comparison window. The percentage is calculated by determining the number of positions at which the same type of nucleic acid base occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity. The inventions disclosed herein encompass nucleotide sequences substantially identical to those disclosed herein.

[0033] As used herein, the terms “treat,’’ “treatment,” and the like, mean the methods or steps taken to provide relief from or alleviation of the number, severity, and / or frequency of one or more symptoms of a disease in a subject. As used herein, “treat” and “treatment” may include the prevention, management, prophylactic treatment, and / or inhibition or reduction of the number, severity, and / or frequency of one or more symptoms of a disease in a subject.

[0034] As used herein, the phrase “introducing into a cell,” when referring to an RNAi agent, means functionally delivering the RNAi agent into a cell. The phrase “functional delivery,” means delivering the RNAi agent to the cell in a manner that enables the RNAi agent to have the expected biological activity, e.g., sequence-specific inhibition of gene expression.

[0035] Unless stated otherwise, use of the symbolas used herein means that any group or groups may be linked thereto that is in accordance with the scope of the inventions described herein.

[0036] As used herein, the term “isomers” refers to compounds that have identical molecular formulae, but that differ in the nature or the sequence of bonding of their atoms or in the arrangement of their atoms in space. Isomers that differ in the arrangement of their atoms in space are termed “stereoisomers.” Stereoisomers that are not mirror images of one another are termed “diastereoisomers,” and stereoisomers that are non-superimposable mirror images are termed “enantiomers,” or sometimes optical isomers. A carbon atom bonded to four nonidentical substituents is termed a “chiral center.”

[0037] As used herein, unless specifically identified in a structure as having a particular conformation, for each structure in which asymmetric centers are present and thus give rise to enantiomers, diastereomers, or other stereoisomeric configurations, each structure disclosed herein is intended to represent all such possible isomers, including their optically pure andracemic forms. For example, the structures disclosed herein are intended to cover mixtures of diastereomers as well as single stereoisomers.

[0038] As used in a claim herein, the phrase “consisting of’ excludes any element, step, or ingredient not specified in the claim. When used in a claim herein, the phrase “consisting essentially of’ limits the scope of a claim to the specified materials or steps and those that do not materially affect the basic and novel characteristic(s) of the claimed invention.

[0039] The person of ordinary skill in the art would readily understand and appreciate that the compounds and compositions disclosed herein may have certain atoms (e g., N, O, or S atoms) in a protonated or deprotonated state, depending upon the environment in which the compound or composition is placed. Accordingly, as used herein, the structures disclosed herein envisage that certain functional groups, such as, for example, OH, SH, or NH. may be protonated or deprotonated. The disclosure herein is intended to cover the disclosed compounds and compositions regardless of their state of protonation based on the environment (such as pH), as would be readily understood by the person of ordinary skill in the art. Correspondingly, compounds described herein with labile protons or basic atoms should also be understood to represent salt forms of the corresponding compound. Compounds described herein may be in a free-acid, free-base, or salt form. Pharmaceutically acceptable salts of the compounds described herein should be understood to be within the scope of the invention.

[0040] As used herein, the term “linked” or “conjugated’' when referring to the connection between two compounds or molecules means that two compounds or molecules are joined by a covalent bond. Unless stated, the terms “linked” and “conjugated” as used herein may refer to the connection between a first compound and a second compound either with or without any intervening atoms or groups of atoms.

[0041] As used herein, the term “including” is used to herein mean, and is used interchangeably with, the phrase "including but not limited to.” The term “or” is used herein to mean, and is used interchangeably with, the term “and / or,” unless the context clearly indicates otherwise.

[0042] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions,will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

[0043] Other objects, features, aspects, and advantages of the invention will be apparent from the following detailed description, accompanying figures, and from the claims.BRIEF DESCRIPTION OF THE DRAWINGS

[0044] FIG. 1. Chemical structure representation of the tridentate av(36 epithelial cell targeting ligand referred to herein as Tri-SM6.1-av’P6-(TA14).DETAILED DESCRIPTION RNAi Agents

[0045] Described herein are RNAi agents for inhibiting expression of an IL33 gene (referred to herein as IL33 RNAi agents or IL33 RNAi triggers). Each IL33 RNAi agent disclosed herein comprises a sense strand and an antisense strand. The sense strand can be 12 to 49 nucleotides in length. The antisense strand can be 18 to 49 nucleotides in length. The sense and antisense strands can be either the same length or they can be different lengths. In some embodiments, the sense and antisense strands are each independently 18 to 27 nucleotides in length. In some embodiments, both the sense and antisense strands are each 21-26 nucleotides in length. In some embodiments, the sense and antisense strands are each 21-24 nucleotides in length. In some embodiments, the sense and antisense strands are each independently 19-21 nucleotides in length. In some embodiments, the sense strand is about 19 nucleotides in length while the antisense strand is about 21 nucleotides in length. In some embodiments, the sense strand is about 21 nucleotides in length while the antisense strand is about 23 nucleotides in length. In some embodiments, a sense strand is 23 nucleotides in length and an antisense strand is 21 nucleotides in length. In some embodiments, both the sense and antisense strands are each 21 nucleotides in length. In some embodiments, the RNAi agent sense strands are each independently 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides in length. In some embodiments, the RNAi agent antisense strands are each independently 18, 19, 20, 21, 22. 23. 24. 25. 26. 27. 28. 29. or 30 nucleotides in length. In some embodiments, the RNAi agent is double stranded and has a duplex length of about 12, 13, 14. 15, 16, 17, 18, 19, 20, 21,22, 23 or 24 nucleotides. In some embodiments, the RNAi agent is double stranded and has a duplex length of 19, 20, 21, 22, or 23 nucleotides.

[0046] Examples of nucleotide sequences used in forming IL33 RNAi agents are provided in Tables 2, 3, 4, 5, 6, and 10. Examples of RNAi agent duplexes, that include the sense strand and antisense strand sequences in Tables 2, 3, 4, 5, 6, are shown in Tables 7A, 7B, 8, 9, and 10.

[0047] In some embodiments, the region of perfect, substantial, or partial complementarity between the sense strand and the antisense strand is 16-26 (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26) nucleotides in length and occurs at or near the 5' end of the antisense strand (e.g., this region may be separated from the 5' end of the antisense strand by 0, 1, 2, 3, or 4 nucleotides that are not perfectly, substantially, or partially complementary).

[0048] A sense strand of the IL33 RNAi agents described herein includes at least 12 consecutive nucleotides that have at least 85% identity to a core stretch sequence (also referred to herein as a “core stretch” or “core sequence”) of the same number of nucleotides in an IL33 mRNA. In some embodiments, a sense strand core stretch sequence is 100% (perfectly) complementary or at least about 85% (substantially) complementary to a core stretch sequence in the antisense strand, and thus the sense strand core stretch sequence is typically perfectly identical or at least about 85% identical to a nucleotide sequence of the same length (sometimes referred to, e.g., as a target sequence) present in the IL33 mRNA target. In some embodiments, this sense strand core stretch is 16, 17, 18. 19. 20. 21. 22. or 23 nucleotides in length. In some embodiments, this sense strand core stretch is 17 nucleotides in length. In some embodiments, this sense strand core stretch is 19 nucleotides in length. In some embodiments, this sense strand core stretch is 21 nucleotides in length.

[0049] An antisense strand of an IL33 RNAi agent described herein includes at least 15 consecutive nucleotides that have at least 85% complementarity to a core stretch of the same number of nucleotides in an IL33 mRNA and to a core stretch of the same number of nucleotides in the corresponding sense strand. In some embodiments, an antisense strand core stretch is 100% (perfectly) complementary or at least about 85% (substantially) complementary to a nucleotide sequence (e.g., target sequence) of the same length present in the IL33 mRNA target. In some embodiments, this antisense strand core stretch is 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, this antisense strand core stretch is 19 nucleotides in length. In some embodiments, this antisense strand core stretch is 17 nucleotides in length.A sense strand core stretch sequence can be the same length as a corresponding antisense core sequence or it can be a different length.

[0050] The IL33 RNAi agent sense and antisense strands anneal to form a duplex. A sense strand and an antisense strand of an IL33 RNAi agent can be partially, substantially, or fully complementary to each other. Within the complementary duplex region, the sense strand core stretch sequence is at least 85% complementary or 100% complementary to the antisense core stretch sequence. In some embodiments, the sense strand core stretch sequence contains a sequence of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that is at least 85% or 100% complementary to a corresponding 16, 17, 18, 19, 20, 21, 22, or 23 nucleotide sequence of the antisense strand core stretch sequence (i.e., the sense and antisense core stretch sequences of an IL33 RNAi agent have a region of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21. at least 22, or at least 23 nucleotides that is at least 85% base paired or 100% base paired.)

[0051] In some embodiments, the antisense strand of an IL33 RNAi agent disclosed herein differs by 0, 1. 2, or 3 nucleotides from any of the antisense strand sequences in Table 2 or Table 3. In some embodiments, the sense strand of an IL33 RN Ai agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 2, Table 4, Table 5, Table 6, or Table 10.

[0052] In some embodiments, the sense strand and / or the antisense strand can optionally and independently contain an additional 1. 2, 3, 4. 5, or 6 nucleotides (extension) at the 3' end. the 5' end, or both the 3' and 5' ends of the core stretch sequences. The antisense strand additional nucleotides, if present, may or may not be complementary to the corresponding sequence in the IL33 mRNA. The sense strand additional nucleotides, if present, may' or may not be identical to the corresponding sequence in the IL33 mRNA. The antisense strand additional nucleotides, if present, may or may not be complementary to the corresponding sense strand's additional nucleotides, if present.

[0053] As used herein, an extension comprises 1, 2, 3, 4, 5, or 6 nucleotides at the 5' and / or 3' end of the sense strand core stretch sequence and / or antisense strand core stretch sequence. The extension nucleotides on a sense strand may or may not be complementary to nucleotides, either core stretch sequence nucleotides or extension nucleotides, in the corresponding antisense strand. Conversely, the extension nucleotides on an antisense strand may or may not be complementary to nucleotides, either core stretch nucleotides or extension nucleotides, in the corresponding sense strand. In some embodiments, both the sense strand and the antisensestrand of an RNAi agent contain 3' and 5' extensions. In some embodiments, one or more of the 3' extension nucleotides of one strand base pairs with one or more 5' extension nucleotides of the other strand. In other embodiments, one or more of 3' extension nucleotides of one strand do not base pair with one or more 5' extension nucleotides of the other strand. In some embodiments, an IL33 RNAi agent has an antisense strand having a 3' extension and a sense strand having a 5' extension. In some embodiments, the extension nucleotide(s) are unpaired and form an overhang. As used herein, an "overhang” refers to a stretch of one or more unpaired nucleotides located at a terminal end of either the sense strand or the antisense strand that does not form part of the hybridized or duplexed portion of an RNAi agent disclosed herein (See, e.g, U. S. Patent No. 8,362,231).

[0054] In some embodiments, an IL33 RNAi agent comprises an antisense strand having a 3' extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In other embodiments, an IL33 RNAi agent comprises an antisense strand having a 3' extension of 1, 2, or 3 nucleotides in length. In some embodiments, one or more of the antisense strand extension nucleotides comprise nucleotides that are complementary to the corresponding IL33 mRNA sequence. In some embodiments, one or more of the antisense strand extension nucleotides comprise nucleotides that are not complementary to the corresponding IL33 mRNA sequence.

[0055] In some embodiments, an IL33 RNAi agent comprises a sense strand having a 3' extension of 1, 2, 3, 4, or 5 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprises adenosine, uracil, or thymidine nucleotides, AT dinucleotide, or nucleotides that correspond to or are the identical to nucleotides in the IL33 mRNA sequence. In some embodiments, the 3' sense strand extension includes or consists of one of the following sequences, but is not limited to: T, UT, TT, UU, UUT, TTT, or TTTT (each listed 5' to 3').

[0056] A sense strand can have a 3' extension and / or a 5’ extension. In some embodiments, an IL33 RNAi agent comprises a sense strand having a 5' extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprise nucleotides that correspond to or are identical to nucleotides in the IL33 mRNA sequence.

[0057] Examples of sequences used in forming IL33 RNAi agents are provided in Tables 2, 3, 4, 5, 6, and 10. In some embodiments, an IL33 RNAi agent antisense strand includes a sequence of any of the sequences in Tables 2, 3, or 10. In certain embodiments, an IL33 RNAi agent antisense strand comprises or consists of any one of the modified sequences in Table 3. Insome embodiments, an IL33 RNAi agent antisense strand includes the sequence of nucleotides (from 5' end3' end) 1-17, 2-15, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, or 2-21, of any of the sequences in Tables 2 or 3. In some embodiments, an IL33 RNAi agent sense strand includes the sequence of any of the sequences in Tables 2, 4, 5, or 6. In some embodiments, an IL33 RNAi agent sense strand includes the sequence of nucleotides (from 5' end -> 3' end) 1-18, 1-19, 1-20, 1-21, 2-19, 2-20, 2-21, 3-20, 3-21, or 4-21 of any of the sequences in Tables 2, 4, 5, or 6. In certain embodiments, an IL33 RNAi agent sense strand comprises or consists of a modified sequence of any one of the modified sequences in Table 4, 5, 6, or 10.

[0058] In some embodiments, the sense and antisense strands of the RNAi agents described herein contain the same number of nucleotides. In some embodiments, the sense and antisense strands of the RNAi agents described herein contain different numbers of nucleotides. In some embodiments, the sense strand 5' end and the antisense strand 3' end of an RNAi agent form a blunt end. In some embodiments, the sense strand 3' end and the antisense strand 5' end of an RNAi agent form a blunt end. In some embodiments, both ends of an RNAi agent form blunt ends. In some embodiments, neither end of an RNAi agent is blunt-ended. As used herein a “blunt end’7refers to an end of a double stranded RNAi agent in which the terminal nucleotides of the two annealed strands are complementary (form a complementary base-pair).

[0059] In some embodiments, the sense strand 5' end and the antisense strand 3' end of an RNAi agent form a frayed end. In some embodiments, the sense strand 3' end and the antisense strand 5' end of an RNAi agent form a frayed end. In some embodiments, both ends of an RNAi agent form a frayed end. In some embodiments, neither end of an RNAi agent is a frayed end. As used herein a frayed end refers to an end of a double stranded RNAi agent in which the terminal nucleotides of the two annealed strands form a pair (i.e., do not form an overhang) but are not complementary’ (i.e. form a non-complementary pair). In some embodiments, one or more unpaired nucleotides at the end of one strand of a double stranded RNAi agent form an overhang. The unpaired nucleotides may be on the sense strand or the antisense strand, creating either 3' or 5' overhangs. In some embodiments, the RNAi agent contains: a blunt end and a frayed end. a blunt end and 5' overhang end, a blunt end and a 3' overhang end, a frayed end and a 5' overhang end, a frayed end and a 3' overhang end, two 5' overhang ends, two 3' overhang ends, a 5' overhang end and a 3’ overhang end, two frayed ends, or two blunt ends. Typically, when present, overhangs are located at the 3’ terminal ends of the sense strand, the antisense strand, or both the sense strand and the antisense strand.

[0060] The IL33 RNAi agents disclosed herein may also be comprised of one or more modified nucleotides. In some embodiments, substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand of the IL33 RNAi agent are modified nucleotides. The IL33 RNAi agents disclosed herein may further be comprised of one or more modified intemucleoside linkages, e g., one or more phosphorothioate linkages. In some embodiments, an IL33 RNAi agent contains one or more modified nucleotides and one or more modified intemucleoside linkages. In some embodiments, a 2'-modified nucleotide is combined with modified intemucleoside linkage.

[0061] In some embodiments, an IL33 RNAi agent is prepared or provided as a salt, mixed salt, or a free acid. In some embodiments, an IL33 RNAi agent is prepared as a pharmaceutically acceptable salt. In some embodiments, an IL33 RNAi agent is prepared as a pharmaceutically acceptable sodium salt. Such forms that are well known in the art are within the scope of the inventions disclosed herein.Modified Nucleotides

[0062] Modified nucleotides, when used in various oligonucleotide constructs, can preserve activity of the compound in cells while at the same time increasing the serum stability of these compounds, and can also minimize the possibility of activating interferon activity in humans upon administration of the oligonucleotide construct.

[0063] In some embodiments, an IL33 RNAi agent contains one or more modified nucleotides. As used herein, a “modified nucleotide” is a nucleotide other than a ribonucleotide (2'-hydroxyl nucleotide). In some embodiments, at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%) of the nucleotides are modified nucleotides. As used herein, modified nucleotides can include, but are not limited to, deoxyribonucleotides, nucleotide mimics, abasic nucleotides, 2'-modified nucleotides, 3’-modified nucleotides (2’-intemucleoside linked), inverted nucleotides, modified nucleobase-comprising nucleotides, bridged nucleotides, peptide nucleic acids (PNAs), 2',3'-seco nucleotide mimics (unlocked nucleobase analogues), locked nucleotides, 3'-O-methoxy (2'-intemucleoside linked) nucleotides, 2’-F-Arabino nucleotides, 5'-Methyl-2'-fluoro nucleotides, morpholino nucleotides (modified nucleotides with a morpholine ring), nucleotides where the typical 5-membered sugar ring of the nucleotide has been modified, vinyl phosphonate deoxyribonucleotides, vinyl phosphonate containing nucleotides, and cyclopropyl phosphonate containing nucleotides. 2'-modified nucleotides (i.e.. a nucleotide with a group other than ahydroxyl group at the 2' position of the five-membered sugar ring) include, but are not limited to, 2'-O-methyl nucleotides (also referred to as 2'-methoxy nucleotides), 2'-fluoro nucleotides (also referred as 2'-deoxy-2'-fluoro nucleotides), 2'-deoxy nucleotides, 2'-methoxyethyl (2'-O-2-methoxylethyl) nucleotides (also referred to as 2'-M0E nucleotides), 2'-amino nucleotides, 2'-halo nucleotides, and 2'-alkyl nucleotides. It is not necessary for all positions in a given compound to be uniformly modified. Conversely, more than one modification can be incorporated in a single IL33 RNAi agent or even in a single nucleotide thereof. The IL33 RNAi agent sense strands and antisense strands can be synthesized and / or modified by methods known in the art. Modification at one nucleotide is independent of modification at another nucleotide.

[0064] Modified nucleobases include synthetic and natural nucleobases, such as 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, (e.g., 2-aminopropyladenine, 5-propynyluracil, or 5-propynylcytosine), 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, inosine, xanthine, hypoxanthine, 2-aminoadenine, 6-alkyl (e.g., 6-methyl, 6-ethyl, 6-isopropyl. or 6-n-butyl) derivatives of adenine and guanine, 2-alkyl (e.g., 2-methyl, 2-ethyl, 2 -isopropyl, or 2-n-butyl) and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2 -thiothymine, 2-thiocytosine, 5-halouracil, cytosine, 5-propynyl uracil, 5-propynyl cytosine, 6-azo uracil, 6-azo cytosine, 6-azo thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-sulfhydiyl, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo (e.g.. 5-bromo), 5-trifluoromethyl, and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine, 7 -deazaadenine, 3 -deazaguanine, and 3 -deazaadenine.

[0065] In some embodiments, the 5’ and / or 3' end of the antisense strand can include abasic residues (Ab), which can also be referred to as an “abasic site” or “abasic nucleotide.” An abasic residue (Ab) is a nucleotide or nucleoside that lacks a nucleobase at the 1' position of the sugar moiety. (See, e.g.. U. S. Patent No. 5,998,203). In some embodiments, an abasic residue can be placed internally in a nucleotide sequence. In some embodiments, Ab or AbAb can be added to the 3' end of the antisense strand. In some embodiments, the 5' end of the sense strand can include one or more additional abasic residues (e.g., (Ab) or (AbAb)). In some embodiments, UUAb, UAb, or Ab are added to the 3' end of the sense strand. In some embodiments, an abasic (deoxyribose) residue can be replaced with a ribitol (abasic ribose) residue.

[0066] In some embodiments, all or substantially all of the nucleotides of an RNAi agent are modified nucleotides. As used herein, an RNAi agent wherein substantially all of the nucleotides present are modified nucleotides is an RNAi agent having four or fewer (i.e., 0, 1, 2, 3, or 4) nucleotides in both the sense strand and the antisense strand being ribonucleotides (i.e., unmodified). As used herein, a sense strand wherein substantially all of the nucleotides present are modified nucleotides is a sense strand having two or fewer (i.e., 0, 1, or 2) nucleotides in the sense strand being unmodified ribonucleotides. As used herein, an antisense sense strand wherein substantially all of the nucleotides present are modified nucleotides is an antisense strand having two or fewer (i.e., 0, 1, or 2) nucleotides in the antisense strand being unmodified ribonucleotides. In some embodiments, one or more nucleotides of an RNAi agent is an unmodified ribonucleotide. Chemical structures for certain modified nucleotides are set forth in Table 11 herein.Modified Internucleoside Linkages

[0067] In some embodiments, one or more nucleotides of an IL33 RNAi agent are linked by non-standard linkages or backbones (i.e., modified intemucleoside linkages or modified backbones). Modified intemucleoside linkages or backbones include, but are not limited to, phosphorothioate groups (represented herein as a lower case “s'’), chiral phosphorothioates, thiophosphates, phosphorodithioates, phosphotriesters, aminoalkyl-phosphotriesters, alkyl phosphonates (e.g., methyl phosphonates or 3'-alkylene phosphonates), chiral phosphonates, phosphinates, phosphoramidates (e.g., 3'-amino phosphoramidate, aminoalkylphosphoramidates, or thionophosphoramidates), thionoalkyl-phosphonates, thionoalkylphosphotriesters, morpholino linkages, boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs of boranophosphates, or boranophosphates having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. In some embodiments, a modified intemucleoside linkage or backbone lacks a phosphorus atom. Modified intemucleoside linkages lacking a phosphorus atom include, but are not limited to, short chain alkyl or cycloalkyl inter-sugar linkages, mixed heteroatom and alkyl or cycloalkyl inter-sugar linkages, or one or more short chain heteroatomic or heterocyclic inter-sugar linkages. In some embodiments, modified intemucleoside backbones include, but are not limited to, siloxane backbones, sulfide backbones, sulfoxide backbones, sulfone backbones, formacetyl and thiofomiacetyl backbones, methylene formacetyl and thioformacetyl backbones, alkene-containing backbones, sulfamate backbones, methyleneimino andmethylenehydrazino backbones, sulfonate and sulfonamide backbones, amide backbones, and other backbones having mixed N, O, S, and CH2 components.

[0068] In some embodiments, a sense strand of an IL33 RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, an antisense strand of an IL33 RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, or both the sense strand and the antisense strand independently can contain 1, 2, 3, 4, 5. or 6 phosphorothioate linkages. In some embodiments, a sense strand of an IL33 RNAi agent can contain 1, 2, 3, or 4 phosphorothioate linkages, an antisense strand of an IL33 RNAi agent can contain 1, 2, 3, or 4 phosphorothioate linkages, or both the sense strand and the antisense strand independently can contain 1, 2, 3, or 4 phosphorothioate linkages.

[0069] In some embodiments, an IL33 RNAi agent sense strand contains at least two phosphorothioate intemucleoside linkages. In some embodiments, the phosphorothioate intemucleoside linkages are betw een the nucleotides at positions 1-3 from the 3' end of the sense strand. In some embodiments, one phosphorothioate intemucleoside linkage is at the 5’ end of the sense strand nucleotide sequence, and another phosphorothioate linkage is at the 3’ end of the sense strand nucleotide sequence. In some embodiments, two phosphorothioate intemucleoside linkage are located at the 5’ end of the sense strand, and another phosphorothioate linkage is at the 3’ end of the sense strand. In some embodiments, the sense strand does not include any phosphorothioate intemucleoside linkages between the nucleotides, but contains one. two, or three phosphorothioate linkages between the terminal nucleotides on both the 5’ and 3’ ends and the optionally present inverted abasic residue terminal caps. In some embodiments, the targeting ligand is linked to the sense strand via a phosphorothioate linkage.

[0070] In some embodiments, an IL33 RNAi agent antisense strand contains four phosphorothioate intemucleoside linkages. In some embodiments, the four phosphorothioate intemucleoside linkages are betw een the nucleotides at positions 1-3 from the 5' end of the antisense strand and betw een the nucleotides at positions 19-21, 20-22, 21-23, 22-24, 23-25, or 24-26 from the 5' end. In some embodiments, three phosphorothioate intemucleoside linkages are located between positions 1-4 from the 5’ end of the antisense strand, and a fourth phosphorothioate intemucleoside linkage is located between positions 20-21 from the 5’ end of the antisense strand. In some embodiments, an IL33 RNAi agent contains at least three or four phosphorothioate intemucleoside linkages in the antisense strand.Capping Residues or Moieties

[0071] In some embodiments, the sense strand may include one or more capping residues or moieties, sometimes referred to in the art as a '‘cap,” a ‘’terminal cap,’’ or a '‘capping residue.” As used herein, a “capping residue” is a non-nucleotide compound or other moiety that can be incorporated at one or more termini of a nucleotide sequence of an RNAi agent disclosed herein. A capping residue can provide the RNAi agent, in some instances, with certain beneficial properties, such as, for example, protection against nuclease degradation. In some embodiments, inverted abasic residues (invAb) (also referred to in the art as “inverted abasic sites”) are added as capping residues (see Table 11). (See, e.g., F. Czaudema, Nucleic Acids Res., 2003, 31(11), 2705-16). Capping residues are generally known in the art, and include, for example, inverted abasic residues as well as carbon chains such as a terminal C3H7 (propyl), C6H13 (hexyl), or C12H25 (dodecyl) groups. In some embodiments, a capping residue is present at either the 5' terminal end, the 3' terminal end, or both the 5' and 3' terminal ends of the sense strand. In some embodiments, the 5 ’ end and / or the 3' end of the sense strand may include more than one inverted abasic deoxyribose moiety as a capping residue.

[0072] In some embodiments, one or more inverted abasic residues (invAb) are added to the 3' end of the sense strand. In some embodiments, one or more inverted abasic residues (invAb) are added to the 5' end of the sense strand. In some embodiments, one or more inverted abasic residues or inverted abasic sites are inserted between the targeting ligand and the nucleotide sequence of the sense strand of the RNAi agent. In some embodiments, the inclusion of one or more inverted abasic residues or inverted abasic sites at or near the terminal end or terminal ends of the sense strand of an RNAi agent allows for enhanced activity or other desired properties of an RNAi agent.

[0073] In some embodiments, one or more inverted abasic residues (invAb) are added to the 5' end of the sense strand. In some embodiments, one or more inverted abasic residues can be inserted between the targeting ligand and the nucleotide sequence of the sense strand of the RNAi agent. The inverted abasic residues may be linked via phosphate, phosphorothioate (e.g., shown herein as (invAb)s)), or other intemucleoside linkages. In some embodiments, the inclusion of one or more inverted abasic residues at or near the terminal end or terminal ends of the sense strand of an RNAi agent may allow for enhanced activity or other desired properties of an RNAi agent. In some embodiments, an inverted abasic (deoxyribose) residue can be replaced with an inverted ribitol (abasic ribose) residue. In some embodiments, the 3' end of the antisense strand core stretch sequence, or the 3' end of the antisense strand sequence,may include an inverted abasic residue. The chemical structures for inverted abasic deoxvribose residues are shown in Table 11 below.IL33 RNAi Agents

[0074] The IL33 RNAi agents disclosed herein are designed to target specific positions on an IL33 gene (e.g., SEQ ID NO: 1 (NM_033439.4)). As defined herein, an antisense strand sequence is designed to target an IL33 gene at a given position on the gene when the 5' terminal nucleobase of the antisense strand is aligned with a position that is 21 nucleotides downstream (towards the 3' end) from the position on the gene when base pairing to the gene. For example, as illustrated in Tables 1 and 2 herein, an antisense strand sequence designed to target an IL33 gene at position 571 requires that when base pairing to the gene, the 5' terminal nucleobase of the antisense strand is aligned with position 591 of an IL33 gene.

[0075] As provided herein, an IL33 RNAi agent does not require that the nucleobase at position 1 (5' 3') of the antisense strand be complementary to the gene, provided that there is at least 85% complementarity (e.g., at least 85, 86, 87, 88, 89, 90. 91. 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity) of the antisense strand and the gene across a core stretch sequence of at least 16 consecutive nucleotides. For example, for an IL33 RNAi agent disclosed herein that is designed to target position 571 of an IL33 gene, the 5' terminal nucleobase of the antisense strand of the of the IL33 RNAi agent must be aligned with position 591 of the gene; however, the 5' terminal nucleobase of the antisense strand may be, but is not required to be, complementary to position 591 of an IL33 gene, provided that there is at least 85% complementarity (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity) of the antisense strand and the gene transcript across a core stretch sequence of at least 16 consecutive nucleotides. As shown by. among other things, the various examples disclosed herein, the specific site of binding of the gene by the antisense strand of the IL33 RNAi agent (e.g., whether the IL33 RNAi agent is designed to target an IL33 gene at position 571, at position 520, at position 570, or at some other position) is an important factor to the level of inhibition achieved and the off-target effects (e g., potential safety issues) of the IL33 RNAi agent. (See, e.g., Kamola et al.. The siRNA Non-seed Region and Its Target Sequences are Auxiliary Determinants of Off-Target Effects, PLOS Computational Biology. 11(12), Figure 1 (2015)).

[0076] In some embodiments, the IL33 RNAi agents disclosed herein target an IL33 gene at or near the positions of the IL33 sequence shown in Table 1. In some embodiments, theantisense strand of an IL33 RNAi agent disclosed herein includes a core stretch sequence that is fully, substantially, or at least partially complementary to a target IL33 19-mer sequence disclosed in Table 1.Table 1. IL33 19-mer mRNA Target Sequences (taken from homo sapiens interleukin 33 (IL33), mRNA transcript, GenBank NM_033439.4 (SEQ ID NO: 1))NM_033439.4, Homo sapiens, interleukin 33 (IL33), mRNA transcript (SEQ ID NO: 1), 2685 bases:1 acagagctgc agctcttcag ggaagaaatc aaaacaagat cacaagaata ctgaaaaatg61 aagcctaaaa tgaagtattc aaccaacaaa atttccacag caaagtggaa gaacacagca121 agcaaagcct tgtgtttcaa gctgggaaaa tcccaacaga aggccaaaga agtttgcccc181 atgtacttta tgaagctccg ctctggcctt atgataaaaa aggaggcctg ttactttagg241 agagaaacca ccaaaaggcc ttcactgaaa acaggtagaa agcacaaaag acatctggta301 ctcgctgcct gtcaacagca gtctactgtg gagtgctttg cctttggtat atcaggggtc361 cagaaatata ctagagcact tcatgattca agtatcacag gaatttcacc tattacagag421 tatcttgctt ctctaagcac atacaatgat caatccatta cttttgcttt ggaggatgaa 481 agtatgaga tatatgtga agactgaaa aaagatgaaa agaaagataa ggtgtactg 541 agtactatg agtctcaaca cccctcaaat gaatcaggtg acggtgttga tggtaagatg 601 ttaatggtaa ccctgagtcc tacaaaagac ttctggttgc atgccaacaa caaggaacac 661 tctgtggagc tccataagtg tgaaaaacca ctgccagacc aggccttctt tgtcctcat 721 aatatgcact ccaactgtgt ttcatttgaa tgcaagactg atcctggagt gtttataggt 781 gtaaaggata atcatcttgc tctgataaa gtagactctt ctgagaattt gtgtactgaa 841 aatatctgt taagctctc tgaaacttag ttgatggaaa cctgtgagtc tgggttgag 901 tacccaaatg ctaccactgg agaaggaatg agagataaag aaagagacag gtgacatcta 961 agggaaatga agagtgcta gcatgtgtgg aatgttttcc atatatgta taaaaatat 1021 tttctaatc ctccagtat tctttatt ccctctgtat aactgcatct tcaatacaag 1081 tatcagtata ttaaataggg tatggtaaa gaaacggtca acatctaaa gagatacagt 1141 ctgaccttta cttttctcta gttcagtcc agaaagaact tcatatttag agctaaggcc 1201 actgaggaaa gagccatagc ttaagtctct atgtagacag ggatccattt taaagagcta 1261 cttagagaaa taatttcca cagttccaaa cgataggctc aaacactaga gctgctagta 1321 aaaagaagac cagatgctc acagaattat catttttca actggaataa aacaccaggt 1381 tgttgtag atgtcttagg caacactcag agcagatctc ccttactgtc aggggatatg 1441 gaacttcaaa ggcccacatg gcaagccagg taacataaat gtgtgaaaaa gtaaagataa 1501 claaaaaatt tagaaaaata aatccagtat ttgtaaagtg aataactlca tltctaaltg 1561 ttaattt aaaatctga ttttatata tgagttaa gcaaggcat ctacacgag 1621 gaagtgaagt aaatttagt tcagacataa aatttcact attaggaata tgtaacatgc 1681 taaaactttt ttttttttaa agagtactga gtcacaacat gtttagagc atccaagtac 1741 catataatcc aactatcatg gtaaggccag aaatctcta acctaccaga gcctagatga 1801 gacaccgaat taacataaa attcagtaa ctgactgtcc ctcatgtcca tggcctacca 1861 tccctctga ccctggcttc cagggaccta tgtctttaa tactcactgt cacattgggc 1921 aaagttgctt ctaatcctta tttcccatgt gcacaagtct ttttgtattc cagcttcctg 1981 ataacactgc tactgtgga atattcattt gacatctgtc tcttttcat tcttttaact 2041 accatgccct tgatatatct tttgcacctg ctgaactca tttctgtatc acctgacctc 2101 tggatgccaa aacgtttat ctgcttgtc tgtgtagaa tlttagataa agctattaat 2161 ggcaatatt tttgctaaa cgttttgt ttttactgtc actagggcaa taaaattat 2221 actcaaccat ataataacat ttttaacta ctaaaggagt agttttatt ttaaagtctt 2281 agcaatttct atacaactt ttctagact taacactat gataaatgac taacatagta 2341 acagaatct tatgaaatat gaccttct gaaaatacat acttacat ttctacttta2401 ttgagaccta ttagatgtaa gtgctagtag aatataagat aaaagaggct gagaattacc 2461 atacaagggt atacaactg taaaacaatt tatcttgt tcatgtct gtcaataat2521 gttaccaaag agataaaaat aaaagcagaa tgtatatcat cccatctgaa aaacactaat2581 tattgacatg tgcatctgta caataaactt aaaatgatta ttaaataatc aaatatatct2641 actacattgt ttatattatt gaataaagta tattttccaa atgta

[0077] In some embodiments, an IL33 RNAi agent includes an antisense strand wherein position 19 of the antisense strand (5'->3') is capable of forming a base pair with position 1 of a 19-mer target sequence disclosed in Table 1. In some embodiments, an IL33 agent includes an antisense strand wherein position 1 of the antisense strand (5'->3') is capable of forming a base pair with position 19 of a 19-mer target sequence disclosed in Table 1.

[0078] In some embodiments, an IL33 agent includes an antisense strand wherein position 2 of the antisense strand (5' 3') is capable of forming a base pair with position 18 of a 19-mer target sequence disclosed in Table 1. In some embodiments, an IL33 agent includes an antisense strand wherein positions 2 through 18 of the antisense strand (5' 3') are capable of forming base pairs with each of the respective complementary bases located at positions 18 through 2 of the 19-mer target sequence disclosed in Table 1.

[0079] For the RNAi agents disclosed herein, the nucleotide at position 1 of the antisense strand (from 5' end -> 3' end) can be perfectly complementary to an IL33 gene, or can be non-complementary to an IL33 gene. In some embodiments, the nucleotide at position 1 of the antisense strand (from 5' end -> 3' end) is a U, A, or dT. In some embodiments, the nucleotide at position 1 of the antisense strand (from 5' end -> 3' end) forms an A: U or U: A base pair with the sense strand.

[0080] In some embodiments, an IL33 RNAi agent antisense strand comprises the sequence of nucleotides (from 5' end -> 3' end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2 or Table 3. In some embodiments, an IL33 RNAi sense strand comprises the sequence of nucleotides (from 5' end3' end) 1-17, 1-18, or 2-18 of any of the sense strand sequences in Table 2, Table 4, Table 5, or Table 6.

[0081] In some embodiments, an IL33 RNAi agent is comprised of (i) an antisense strand comprising the sequence of nucleotides (from 5' end -> 3' end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2 or Table 3, and (ii) a sense strand comprising the sequence of nucleotides (from 5' end3' end) 1-17 or 1-18 of any of the sense strand sequences in Table 2, Table 4. Table 5, or Table 6.

[0082] In some embodiments, the IL33 RNAi agents include core 19-mer nucleotide sequences shown in the following Table 2.Table 2. IL33 RNAi Agent Antisense Strand and Sense Strand Core Stretch Base SequencesN = any nucleobaseI = inosine (hypoxanthine nucleobase) nucleotide(A2N) = 2-aminoadenosine nucleotide

[0083] The IL33 RNAi agent sense strands and antisense strands that comprise or consist of the nucleotide sequences in Table 2 can be modified nucleotides or unmodified nucleotides. In some embodiments, the IL33 RNAi agents having the sense and antisense strand sequences that comprise or consist of any of the nucleotide sequences in Table 2 are all or substantially all modified nucleotides.

[0084] In some embodiments, the antisense strand of an IL33 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 2. In some embodiments, the sense strand of an IL33 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 2.

[0085] As used herein, each N listed in a sequence disclosed in Table 2 may be independently selected from any and all nucleobases (including those found on both modified and unmodified nucleotides). In some embodiments, an N nucleotide listed in a sequence disclosed in Table 2 has a nucleobase that is complementary to the N nucleotide at the corresponding position on the other strand. In some embodiments, an N nucleotide listed in a sequence disclosed in Table 2 has a nucleobase that is not complementary to the N nucleotide at the corresponding position on the other strand. In some embodiments, an N nucleotide listed in a sequence disclosed m Table 2 has a nucleobase that is the same as the N nucleotide at the corresponding position on the other strand. In some embodiments, an N nucleotide listed in a sequence disclosed in Table 2 has a nucleobase that is different from the N nucleotide at the corresponding position on the other strand.

[0086] Certain modified IL33 RNAi agent sense and antisense strands are provided in Table 3, Table 4, Table 5, Table 6, and Table 10. Certain modified IL33 RNAi agent antisense strands, as well as their underlying unmodified nucleobase sequences, are provided in Table 3. Certain modified IL33 RNAi agent sense strands, as well as their underlying unmodified nucleobase sequences, are provided in Tables 4, 5, and 6. In forming IL33 RNAi agents, each of the nucleotides in each of the underlying base sequences listed in Tables 3, 4, 5, and 6, as well as in Table 2, above, can be a modified nucleotide.

[0087] The IL33 RNAi agents described herein are formed by annealing an antisense strand with a sense strand. A sense strand containing a sequence listed in Table 2, Table 4, Table 5, or Table 6 can be hybridized to any antisense strand containing a sequence listed in Table 2 or Table 3, provided the tw o sequences have a region of at least 85% complementarity over a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence.

[0088] In some embodiments, an IL33 RNAi agent antisense strand comprises a nucleotide sequence of any of the sequences in Table 2 or Table 3.

[0089] In some embodiments, an IL33 RNAi agent comprises or consists of a duplex having the nucleobase sequences of the sense strand and the antisense strand of any of the sequences in Table 2, Table 3, Table 4, Table 5, Table 6, or Table 10.

[0090] Examples of antisense strands containing modified nucleotides are provided in Table 3. Examples of sense strands containing modified nucleotides are provided in Tables 4, 5 and 6.

[0091] As used in Tables 3, 4, 5, 6, and 10, the following notations are used to indicate modified nucleotides, targeting groups, and linking groups:A = adenosine-3 '-phosphateC = cytidine-3'-phosphateG = guanosine-3'-phosphateU = uridine-3 '-phosphateI = inosine-3 '-phosphatea = 2'-O-methyladenosine-3 '-phosphateas = 2'-O-methyladenosine-3'-phosphorothioatec = 2'-O-methylcytidine-3 '-phosphatecs = 2'-O-methylcytidine-3'-phosphorothioateg = 2'-O-methylguanosine-3'-phosphategs = 2'-O-methylguanosine-3'-phosphorothioatei = 2'-O-methylinosine-3 '-phosphateis = 2'-O-methylinosine-3'-phosphorothioatet = 2'-O-methyl-5-methyluridine-3 '-phosphatets = 2'-O-methyl-5-methyluridine-3'-phosphorothioateu = 2'-O-methyluridine-3 '-phosphateus = 2'-O-methyluridine-3'-phosphorothioateAf = 2'-fluoroadenosine-3'-phosphateAfs = 2'-fluoroadenosine-3'-phosporothioateCf = 2'-fluorocytidine-3 '-phosphateCfs = 2'-fluorocytidine-3'-phosphorothioateGf = 2'-fluoroguanosine-3 '-phosphateGfs = 2'-fluoroguanosine-3'-phosphorothioateTf = 2'-fluoro-5'-methyluridine-3'-phosphateTfs = 2'-fluoro-5'-methyluridine-3'-phosphorothioateUf = 2'-fluorouridine-3 '-phosphateUfs = 2'-fluorouridine-3'-phosphorothioatedT = 2'-deoxythymidine-3 '-phosphatedTs = 2'-deoxythymidine-3'-phosphorothioatedA = 2'-deoxyadenosine-3'-phosphatedAs = 2'-deoxyadenosine-3'-phosphorothioatedC = 2'-deoxycytidine-3 '-phosphatedCs = 2'-deoxycytidine-3'-phosphorothioatedG = 2'-deoxyguanosine-3 '-phosphatedGs = 2'-deoxyguanosine-3'-phosphorothioateAUNA = 2',3'-seco-adenosine-3 '-phosphateAUNAS = 2',3'-seco-adenosine-3'-phosphorothioateCUNA = 2',3'-seco-cytidine-3 '-phosphateCUNAS = 2',3'-seco-cytidine-3'-phosphorothioateGUNA = 2'3 '-seco-guanosine-3 '-phosphateGUNAS = 2'.3 '-seco-guanosine-3 '-phosphorothioateUUNA = 2',3'-seco-uridine-3'-phosphateUUNAS = 2',3'-seco-uridine-3'-phosphorothioatea_2N = 2'-O-methyl-2-aminoadenosine-3'-phosphate, see Table 11 a_2Ns = 2'-O-methyl-2-aminoadenosine-3'-phosphorothioate, see Table 11 (invAb) = inverted abasic deoxy ribonucleotide-5 '- phosphate, see Table 11(invAb)s = inverted abasic deoxyribonucleotide-5'- phosphorothioate, see Table 11s = phosphorothioate linkagess = phosphrodithioate linkagep = terminal phosphate (as synthesized)vpdN = vinyl phosphonate deoxyribonucleotidecPrpa = 5 ’-cyclopropyl phosphonate-2'-O-methyladenosine-3'-phosphate (see Table 11)cPrpas = 5 ’-cyclopropyl phosphonate-2'-O-methyladenosine-3'- phosphorothioate (see Table 11)cPrpu = 5 ’-cyclopropyl phosphonate-2'-0-methyluridine-3 '-phosphate (see Table 11)cPrpus = 5 ’-cyclopropyl phosphonate-2'-O-methyluridine-3'- phosphorothioate (see Table 11)cPrpi = 5 ’-cyclopropyl phosphonate-2'-O-methylinosine-3'- phosphate (see Table 11)cPrpis = 5 ’-cyclopropyl phosphonate-2'-0-methylinosine-3'- phosphorothioate (see Table 11)(C6-SS-C6) = see Table 11(6-SS-6) = see Table 11(NH2-C6) = see Table 11(NH2-C6)s = see Table 11(TriAlkl4) = see Table 11(TriAlkl4)s = see Table 11-C6- = see Table 11-C6s- = see Table 11-L6-C6- = see Table 11-L6-C6s- = see Table 11(TA 14) = see Table 11 (structure of (TriAlkl4)s after conjugation) (TA14)s = see Table 11 (structure of (TriAlkl4)s after conjugation) Tri-SM6.1-avP6-(TA14) = see Fig. 1(NAG37)s = see Table 11

[0092] As the person of ordinary skill in the art would readily understand, unless otherwise indicated by the sequence (such as. for example, by a phosphorothioate linkage “s’'), when present in an oligonucleotide, the nucleotide monomers are mutually linked by 5 ’-3’-phosphodiester bonds. As the person of ordinary skill in the art would clearly understand, the inclusion of a phosphorothioate linkage as shown in the modified nucleotide sequences disclosed herein replaces the phosphodiester linkage typically present in oligonucleotides. Further, the person of ordinary skill in the art would readily understand that the terminal nucleotide at the 3’ end of a given oligonucleotide sequence would typically have a hydroxyl (-OH) group at the respective 3 ’ position of the given monomer instead of a phosphate moiety ex vivo. Additionally, for the embodiments disclosed herein, when viewing the respective strand 5’ 3', the inverted abasic residues are inserted such that the 3' position of the deoxyribose is linked at the 3’ end of the preceding monomer on the respective strand (see, e.g., Table 11). Moreover, as the person of ordinary skill would readily understand and appreciate, while the phosphorothioate chemical structures depicted herein typically show the anion on the sulfur atom, the inventions disclosed herein encompass all phosphorothioate tautomers (e.g., where the sulfur atom has a double-bond and the anion is on an oxygen atom). Unless expressly indicated otherwise herein, such understandings of the person of ordinary skill in the art are used when describing the IL33 RNAi agents and compositions of IL33 RNAi agents disclosed herein.

[0093] Certain examples of targeting groups and linking groups used with the IL33 RNAi agents disclosed herein are included in the chemical structures provided below in Table 11. Each sense strand and / or antisense strand can have any targeting groups or linking groups listedherein, as well as other targeting or linking groups, conjugated to the 5' and / or 3' end of the sequence.Table 3. IL33 RNAi Agent Antisense Strand SequencesTable 4. IL33 Agent Sense Strand Sequences (Show n Without Linkers, Conjugates, Capping Moieties, or Terminal dT)(A2N)=2-aminoadenosine nucleotide; I = hypoxanthine (inosine) nucleotideTable 5. IL33 RNAi Agent Sense Strand Sequences (Shown With (TriAlkl4) Linker or (NAG37)s (see Table 11 for structure information.))(A2N)=2-aminoadenosine nucleotide; I = hypoxanthine (inosine) nucleotideTable 6. IL33 RNAi Agent Sense Strand Sequences (Shown with Targeting Ligand Conjugate. The structure of avP6-SM6.1 is shown in Table 11. and the structure of Tri-SM6. l-avP6-TA14 is shown in FIG. 1.)

[0094] The IL33 RNAi agents disclosed herein are formed by annealing an antisense strand with a sense strand. A sense strand containing a sequence listed in Table 2. Table 4, Table 5. or Table 6 can be hybridized to any antisense strand containing a sequence listed in Table 2 or Table 3, provided the two sequences have a region of at least 85% complementarity over a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence.

[0095] As shown in Table 5 above, certain of the example IL33 RNAi agent nucleotide sequences are shown to further include reactive linking groups at one or both of the 5’ terminal end and the 3’ terminal end of the sense strand. For example, many of the IL33 RNAi agent sense strand sequences shown in Table 5 above have a (TriAlkl4) linking group at the 5’ end of the nucleotide sequence. Other linking groups, such as an (NH2-C6) linking group or a (6-SS-6) or (C6-SS-C6) linking group, may be present as well or alternatively in certain embodiments. Such reactive linking groups are positioned to facilitate the linking of targeting ligands, targeting groups, and / or PK / PD modulators to the IL33 RNAi agents disclosed herein. Linking or conjugation reactions are well known in the art and provide for formation of covalent linkages between two molecules or reactants. Suitable conjugation reactions for use in the scope of the inventions herein include, but are not limited to, amide coupling reaction. Michael addition reaction, hydrazone formation reaction, inverse-demand Diels-Alder cycloaddition reaction, oxime ligation, and Copper (I)-catalyzed or strain-promoted azide-alkyne cycloaddition reaction cycloaddition reaction.

[0096] In some embodiments, targeting ligands, such as the integrin targeting ligands shown in the examples and figures disclosed herein, can be synthesized as activated esters, such as tetrafluorophenyl (TFP) esters, which can be displaced by a reactive amino group (e.g., NH₂-C6) to attach the targeting ligand to the IL33 RNAi agents disclosed herein. In some embodiments, targeting ligands are synthesized as azides, which can be conjugated to a propargyl (e.g., TriAlkl4) or DBCO group, for example, via Copper (I)- catalyzed or strain-promoted azidealkyne cycloaddition reaction.

[0097] Additionally, certain of the nucleotide sequences can be synthesized with a dT nucleotide at the 3’ terminal end of the sense strand, followed by (3‘5’) a linker (e.g., C6-SS-C6). The linker can, in some embodiments, facilitate the linkage to additional components, such as, for example, a PK / PD modulator or one or more targeting ligands. As described herein, the disulfide bond of C6-SS-C6 is first reduced, removing the dT from the molecule, which can then facilitate the conjugation of the desired PK / PD modulator. The terminal dT nucleotide therefore is not a part of the fully conjugated construct.

[0098] In some embodiments, the antisense strand of an IL33 RNAi agent disclosed herein differs by 0, 1, 2. or 3 nucleotides from any of the antisense strand sequences in Table 3 or Table 10. In some embodiments, the sense strand of an IL33 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 4, Table 5, Table 6, or Table 10.

[0099] In some embodiments, an IL33 RNAi agent antisense strand comprises a nucleotide sequence of any of the sequences in Table 2 or Table 3. In some embodiments, an IL33 RNAi agent antisense strand comprises the sequence of nucleotides (from 5’ end -> 3’ end) 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, or 2-24 of any of the sequences in Table 2, Table 3, or Table 10. In certain embodiments, an IL33 RNAi agent antisense strand comprises or consists of a modified sequence of any one of the modified sequences in Table 3 or Table 10.

[0100] In some embodiments, an IL33 RNAi agent sense strand comprises the nucleotide sequence of any of the sequences in Table 2 or Table 4. In some embodiments, an IL33 RNAi agent sense strand comprises the sequence of nucleotides (from 5’ end3’ end) 1-17, 2-17, 3-17. 4-17. 1-18. 2-18. 3-18. 4-18. 1-19. 2-19. 3-19. 4-19. 1-20. 2-20. 3-20. 4-20. 1-21. 2-21, 3-21, 4-21, 1-22, 2-22, 3-22, 4-22, 1-23, 2-23, 3-23, 4-23, 1-24, 2-24, 3-24, or 4-24, of any of the sequences in Table 2, Table 4, Table 5, Table 6, or Table 10. In certain embodiments, an IL33 RNAi agent sense strand comprises or consists of a modified sequence of any one of the modified sequences in Table 3 or Table 10.

[0101] For the RNAi agents disclosed herein, the nucleotide at position 1 of the antisense strand (from 5' end3' end) can be perfectly complementary’ to an IL33 gene, or can be non-complementary to an IL33 gene. In some embodiments, the nucleotide at position 1 of the antisense strand (from 5' end3' end) is a U, A, or dT (or a modified version of U, A or dT). In some embodiments, the nucleotide at position 1 of the antisense strand (from 5’3’ end) forms an A: U or U: A base pair with the sense strand.

[0102] In some embodiments, an IL33 RNAi agent antisense strand comprises the sequence of nucleotides (from 5' end3' end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2, Table 3, or Table 10. In some embodiments, an IL33 RNAi sense strand comprises the sequence of nucleotides (from 5' end -> 3' end) 1-17 or 1-18 of any of the sense strand sequences in Table 2, Table 4, Table 5, Table 6, or Table 10.

[0103] In some embodiments, an IL33 RNAi agent includes (i) an antisense strand comprising the sequence of nucleotides (from 5' end 3' end) 2-18 or 2-19 of any of the antisense strandsequences in Table 2, Table 3, or Table 10, and (ii) a sense strand comprising the sequence of nucleotides (from 5' end3' end) 1-17 or 1-18 of any of the sense strand sequences in Table 2, Table 4, Table 5, Table 6, or Table 10.

[0104] A sense strand containing a sequence listed in Table 2 or Table 4 can be hybridized to any antisense strand containing a sequence listed in Table 2 or Table 3 provided the two sequences have a region of at least 85% complementarity over a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence. In some embodiments, the IL33 RNAi agent has a sense strand consisting of the modified sequence of any of the modified sequences in Table 4, Table 5, Table 6, or Table 10, and an antisense strand consisting of the modified sequence of any of the modified sequences in Table 3 or Table 10. Certain representative sequence pairings are exemplified by the Duplex ID Nos. shown in Tables 7A, 7B, 8, and 9.

[0105] In some embodiments, an IL33 RNAi agent comprises, consists of, or consists essentially of a duplex represented by any one of the Duplex ID Nos. presented herein. In some embodiments, an IL33 RNAi agent consists of any of the Duplex ID Nos. presented herein. In some embodiments, an IL33 RNAi agent comprises the sense strand and antisense strand nucleotide sequences of any of the Duplex ID Nos. presented herein. In some embodiments, an IL33 RNAi agent comprises the sense strand and antisense strand nucleotide sequences of any of the Duplex ID Nos. presented herein and a targeting group, linking group, and / or other nonnucleotide group wherein the targeting group, linking group, and / or other non-nucleotide group is covalently linked (i.e., conjugated) to the sense strand or the antisense strand. In some embodiments, an IL33 RNAi agent includes the sense strand and antisense strand modified nucleotide sequences of any of the Duplex ID Nos. presented herein. In some embodiments, an IL33 RNAi agent comprises the sense strand and antisense strand modified nucleotide sequences of any of the Duplex ID Nos. presented herein and a targeting group, linking group, and / or other non-nucleotide group, wherein the targeting group, linking group, and / or other non-nucleotide group is covalently linked to the sense strand or the antisense strand.

[0106] In some embodiments, an IL33 RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences of any of the antisense strand / sense strand duplexes of Tables 2, 7A, 7B, 8, 9, or 10, and comprises a targeting group. In some embodiments, an IL33 RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences of any of the antisense strand / sense strand duplexes of Tables 2, 7A, 7B, 8, 9, or 10, and comprises one or more av[J6 integrin targeting ligands.

[0107] In some embodiments, an IL33 RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences of any of the antisense strand / sense strand duplexes of Tables 2, 7 A, 7B, 8, 9, or 10, and comprises a targeting group that is an integrin targeting ligand. In some embodiments, an IL33 RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences of any of the antisense strand / sense strand duplexes of Tables 2, 7A, 7B, 8, 9, or 10, and comprises one or more av[36 integrin targeting ligands or clusters of av[36 integrin targeting ligands (e.g.. a tridentate av[36 integrin targeting ligand).

[0108] In some embodiments, an IL33 RNAi agent comprises an antisense strand and a sense strand having the modified nucleotide sequences of any of the antisense strand / sense strand duplexes of Tables 7A, 7B, 8, 9, and 10.

[0109] In some embodiments, an IL33 RNAi agent comprises an antisense strand and a sense strand having the modified nucleotide sequences of any of the antisense strand / sense strand duplexes of Tables 7A, 7B, 8, 9, and 10, and comprises an integrin targeting ligand.

[0110] In some embodiments, an IL33 RNAi agent comprises, consists of, or consists essentially of any of the duplexes of Tables 7A. 7B, 8, 9, and 10.

[0111] Table 7 A. IL33 RNAi Agent Duplexes with Corresponding Sense and Antisense Strand ID Numbers and Sequence ID numbers for the modified and unmodified nucleotide sequences. (Shown without Linking Agents or Conjugates)

[0112] Table 7B. IL33 RNAi Agent Duplexes with Corresponding Sense and Antisense Strand ID Numbers and Sequence ID numbers for the modified and unmodified nucleotide sequences.

[0113] Table 8. IL33 RNAi Agent Conjugate Duplexes with Corresponding Sense and Antisense Strand ID Numbers and Sequence ID numbers for the modified and unmodified nucleotide sequences. ( Shown with Targeting Ligand Conjugates)

[0114] Table 9. Conjugate Duplex ID Numbers Referencing Position Targeted On Interleukin 33 (IL33) Gene

[0115] Table 10. Conjugate ID Numbers With Chemically Modified Antisense and Sense Strands (including Linkers and Conjugates, see Figure 1 for structure of Tri-SM6.1-avP6-(TA14) ligand)

[0116] In some embodiments, an IL33 RNAi agent is prepared or provided as a salt, mixed salt, or a free-acid. In some embodiments, an IL33 RNAi agent is prepared or provided as a pharmaceutically acceptable salt. In some embodiments, an IL33 RNAi agent is prepared or provided as a pharmaceutically acceptable sodium or potassium salt. In some embodiments, an IL33 RNAi agent is prepared or provided as a pharmaceutically acceptable sodium salt. The RNAi agents described herein, upon delivery to a cell expressing an IL33 gene, inhibit or knockdown expression of one or more IL33 genes in vivo and / or in vitro.Targeting Groups, Linking Groups, Pharmacokinetic / Pharmacodynamic (PK / PD) Modulators, and Delivery Vehicles

[0117] In some embodiments, an IL33 RNAi agent contains or is conjugated to one or more nonnucleotide groups including, but not limited to, a targeting group, a linking group, a pharmacokinetic / pharmacodynamic (PK / PD) modulator, a delivery polymer, or a delivery vehicle. The non-nucleotide group can enhance targeting, delivery, or attachment of the RNAi agent. The non-nucleotide group can be covalently linked to the 3' and / or 5' end of either the sense strand and / or the antisense strand. In some embodiments, an IL33 RNAi agent contains a non-nucleotide group linked to the 3' and / or 5' end of the sense strand. In some embodiments, a non-nucleotide group is linked to the 5' end of an IL33 RNAi agent sense strand. A non-nucleotide group can be linked directly or indirectly to the RNAi agent via a linker / linking group. In some embodiments, a non-nucleotide group is linked to the RNAi agent via a labile, cleavable, or reversible bond or linker.

[0118] In some embodiments, a non-nucleotide group enhances the pharmacokinetic or biodistribution properties of an RNAi agent or conjugate to which it is attached to improve cell-or tissue-specific distribution and cell-specific uptake of the conjugate. In some embodiments, a non-nucleotide group enhances endocytosis of the RNAi agent.

[0119] Targeting groups or targeting moieties enhance the pharmacokinetic or biodistribution properties of a conjugate or RNAi agent to which they are attached to improve cell-specific (including, in some cases, organ specific) distribution and cell-specific (or organ specific) uptake of the conjugate or RNAi agent. A targeting group can be monovalent, divalent, trivalent, tetravalent, or have higher valency for the target to which it is directed. Representative targeting groups include, without limitation, compounds with affinity to cell surface molecule, cell receptor ligands, hapten, antibodies, monoclonal antibodies, antibody fragments, and antibodymimics with affinity to cell surface molecules. In some embodiments, a targeting group is linkedto an RNAi agent using a linker, such as a PEG linker or one, two, or three abasic and / or ribitol (abasic ribose) residues, which in some instances can serve as linkers.

[0120] A targeting group, with or without a linker, can be attached to the 5' or 3' end of any of the sense and / or antisense strands disclosed in Tables 2, 3, 4, 5, 6, and 10. A linker, with or without a targeting group, can be attached to the 5' or 3' end of any of the sense and / or antisense strands disclosed in Tables 2, 3, 4, 5, 6, and 10.

[0121] The IL33 RNAi agents described herein can be synthesized having a reactive group, such as an amino group (also referred to herein as an amine), at the 5'-terminus and / or the 3'-terminus. The reactive group can be used subsequently to attach a targeting moiety using methods typical in the art.

[0122] For example, in some embodiments, the IL33 RNAi agents disclosed herein are synthesized having an NH2-C6 group at the 5 '-terminus of the sense strand of the RNAi agent. The terminal amino group subsequently can be reacted to form a conjugate with, for example, a group that includes an avP6 integrin targeting ligand. In some embodiments, the IL33 RNAi agents disclosed herein are synthesized having one or more alkyne groups at the 5'-terminus of the sense strand of the RNAi agent. The terminal alkyne group(s) can subsequently be reacted to form a conjugate with, for example, a group that includes an αvβ6 integrin targeting ligand.

[0123] In some embodiments, a targeting group comprises an integrin targeting ligand. In some embodiments, an integrin targeting ligand is an av 6 integrin targeting ligand. The use of an avP6 integrin targeting ligand facilitates cell-specific targeting to cells having av 6 on its respective surface, and binding of the integrin targeting ligand can facilitate entry of the therapeutic agent, such as an RNAi agent, to which it is linked, into cells such as epithelial cells, including pulmonary epithelial cells and renal epithelial cells. Integrin targeting ligands can be monomeric or monovalent (e g., having a single integrin targeting moiety) or multimeric or multivalent (e.g., having multiple integrin targeting moieties). The targeting group can be attached to the 3' and / or 5' end of the RNAi oligonucleotide using methods known in the art. The preparation of targeting groups, such as αvβ6 integrin targeting ligands, is described, for example, in International Patent Application Publication No. WO 2018 / 085415 and in International Patent Application Publication No. WO 2019 / 089765, the contents of each of which are incorporated herein in its entirety.

[0124] In some embodiments, targeting groups are linked to the IL33 RNAi agents without the use of an additional linker. In some embodiments, the targeting group is designed having a linker readily present to facilitate the linkage to an IL33 RNAi agent. In some embodiments, when twoor more RNAi agents are included in a composition, the two or more RNAi agents can be linked to their respective targeting groups using the same linkers. In some embodiments, when two or more RNAi agents are included in a composition, the two or more RNAi agents are linked to their respective targeting groups using different linkers.

[0125] In some embodiments, a linking group is conjugated to the RNAi agent. The linking group facilitates covalent linkage of the agent to a targeting group, pharmacokinetic modulator, delivery polymer, or delivery' vehicle. The linking group can be linked to the 3' and / or the 5' end of the RNAi agent sense strand or antisense strand. In some embodiments, the linking group is linked to the RNAi agent sense strand. In some embodiments, the linking group is conjugated to the 5' or 3' end of an RNAi agent sense strand. In some embodiments, a linking group is conjugated to the 5' end of an RNAi agent sense strand. Examples of linking groups, include but are not limited to: C6-SS-C6, 6-SS-6, reactive groups such a primary amines (e.g., NH2-C6) and alkynes, alkyl groups, abasic residues / nucleotides, amino acids, tri-alkyne functionalized groups, ribitol, and / or PEG groups. Examples of certain linking groups are provided in Table 11.

[0126] A linker or linking group is a connection between two atoms that links one chemical group (such as an RNAi agent) or segment of interest to another chemical group (such as a targeting group, pharmacokinetic modulator, or delivery' polymer) or segment of interest via one or more covalent bonds. A labile linkage contains a labile bond. A linkage can optionally include a spacer that increases the distance between the two joined atoms. A spacer may further add flexibility and / or length to the linkage. Spacers include, but are not be limited to, alkyl groups, alkenyl groups, alkynyl groups, ary l groups, aralkyl groups, aralkenyl groups, and aralkynyl groups; each of which can contain one or more heteroatoms, heterocycles, amino acids, nucleotides, and saccharides. Spacer groups are well known in the art and the preceding list is not meant to limit the scope of the description. In some embodiments, an IL33 RNAi agent is conjugated to a polyethylene glycol (PEG) moiety, or to a hydrophobic group having 12 or more carbon atoms, such as a cholesterol or palmitoyl group.

[0127] In some embodiments, an IL33 RNAi agent is linked to one or more pharmacokinetic / pharmacodynamic (PK / PD) modulators. PK / PD modulators can increase circulation time of the conjugated drug and / or increase the activity of the RNAi agent through improved cell receptor binding, improved cellular uptake, and / or other means. Various PK / PD modulators suitable for use with RNAi agents are know n in the art. In some embodiments, the PK / PD modulatory' can be cholesterol or cholesteryl derivatives, or in some circumstances a PK / PD modulator can be comprised of alkyl groups, alkenyl groups, alkynyl groups, aryl groups,aralkyl groups, aralkenyl groups, or aralkynyl groups, each of which may be linear, branched, cyclic, and / or substituted or unsubstituted. In some embodiments, the location of attachment for these moieties is at the 5’ or 3’ end of the sense strand, at the 2’ position of the ribose ring of any given nucleotide of the sense strand, and / or attached to the phosphate or phosphorothioate backbone at any position of the sense strand.

[0128] Any of the IL33 RNAi agent nucleotide sequences listed in Tables 2. 3, 4, 5. 6, and 10, whether modified or unmodified, can contain 3' and / or 5' targeting group(s), linking group(s), and / or PK / PD modulator(s). Any of the IL33 RNAi agent sequences listed in Tables 3, 4, 5, 6, and 10, or are otherwise described herein, which contain a 3' or 5' targeting group, linking group, and / or PK / PD modulator can alternatively contain no 3' or 5' targeting group, linking group, or PK / PD modulator, or can contain a different 3' or 5' targeting group, linking group, or pharmacokinetic modulator including, but not limited to, those depicted in Table 11. Any of the IL33 RNAi agent duplexes listed in Tables 7A, 7B, 8, 9 and 10, whether modified or unmodified, can further comprise a targeting group or linking group, including, but not limited to, those depicted in Table 11, and the targeting group or linking group can be attached to the 3' or 5' terminus of either the sense strand or the antisense strand of the IL33 RNAi agent duplex.

[0129] Examples of certain modified nucleotides, capping moieties, and linking groups are provided in Table 11.Table 11. Structures Representing Various Modified Nucleotides, Capping Moi eties, and

[0130] Alternatively, other linking groups known in the art may be used. In many instances, linking groups can be commercially acquired or alternatively, are incorporated into commercially available nucleotide phosphorami dites. (See, e.g., International Patent Application Publication No. WO 2019 / 161213, which is incorporated herein by reference in its entirety).

[0131] In some embodiments, an IL33 RNAi agent is delivered without being conjugated to a targeting ligand or pharmacokinetic / pharmacodynamic (PK / PD) modulator (referred to as being “naked” or a “naked RNAi agent”).

[0132] In some embodiments, an IL33 RNAi agent is conjugated to a targeting group, a linking group, a PK modulator, and / or another non-nucleotide group to facilitate delivery' of the IL33 RNAi agent to the cell or tissue of choice, for example, to an epithelial cell in vivo. In some embodiments, an IL33 RNAi agent is conjugated to a targeting group wherein the targeting group includes an integrin targeting ligand. In some embodiments, the integrin targeting ligand is an av[36 integrin targeting ligand. In some embodiments, a targeting group includes one or more av|36 integrin targeting ligands.

[0133] In some embodiments, a delivery' vehicle may be used to deliver an RNAi agent to a cell or tissue. A delivery vehicle is a compound that improves delivery of the RNAi agent to a cell or tissue. A delivery vehicle can include, or consist of, but is not limited to: a polymer, such as an amphipathic polymer, a membrane active polymer, a peptide, a melittin peptide, a melittin-like peptide (MLP), a lipid, a reversibly modified polymer or peptide, or a reversibly modified membrane active polyamine.

[0134] In some embodiments, the RNAi agents can be combined with lipids, nanoparticles, polymers, liposomes, micelles, DPCs or other delivery systems available in the art for nucleic acid deliver}'. The RNAi agents can also be chemically conjugated to targeting groups, lipids(including, but not limited to cholesteryl and cholesteryl derivatives), encapsulating in nanoparticles, liposomes, micelles, conjugating to polymers or DPCs (see. for example WO 2000 / 053722, WO 2008 / 022309, WO 2011 / 104169, and WO 2012 / 083185, WO 2013 / 032829, WO 2013 / 158141, each of which is incorporated herein by reference), by iontophoresis, or by incorporation into other delivery7vehicles or systems available in the art such as hydrogels, cyclodextrins, biodegradable nanocapsules, bioadhesive microspheres, or proteinaceous vectors. In some embodiments the RNAi agents can be conjugated to antibodies having affinity for pulmonary epithelial cells. In some embodiments, the RNAi agents can be linked to targeting ligands that have affinity7for pulmonary7epithelial cells or receptors present on pulmonary epithelial cells.Pharmaceutical Compositions and Formulations

[0135] The IL33 RNAi agents disclosed herein can be prepared as pharmaceutical compositions (alternatively referred to as pharmaceutical formulations or medicaments). The pharmaceutical compositions disclosed herein include at least one IL33 RNAi agent. These pharmaceutical compositions are particularly useful in the inhibition of the expression of 1L33 mRNA in a target cell, a group of cells, a tissue, or an organism. The pharmaceutical compositions can be used to treat a subject having a disease, disorder, or condition that would benefit from reduction in the level of the target mRNA, or inhibition in expression of the target gene. The pharmaceutical compositions can be used to treat a subject at risk of developing a disease or disorder that would benefit from reduction of the level of the target mRNA or an inhibition in expression the target gene. In one embodiment, the method includes administering an IL33 RNAi agent linked to a targeting ligand as described herein, to a subject to be treated. In some embodiments, one or more pharmaceutically acceptable excipients (including vehicles, carriers, diluents, and / or delivery polymers) are added to the pharmaceutical compositions that include an IL33 RNAi agent, thereby forming a pharmaceutical formulation or medicament suitable for in vivo delivery to a subject, including a human.

[0136] The pharmaceutical compositions that include an IL33 RNAi agent and methods disclosed herein decrease the level of the target mRNA m a cell, group of cells, group of cells, tissue, organ, or subject, including by administering to the subject a therapeutically effective amount of a herein described IL33 RNAi agent, thereby inhibiting the expression of IL33 mRNA in the subject. In some embodiments, the subject has been previously identified or diagnosed as having a disease or disorder that can be mediated at least in part by a reduction in IL33expression. In some embodiments, the subject has been previously diagnosed with having one or more pulmonary diseases such as asthma, chronic obstructive pulmonary disease (COPD), autoimmune disorders, and bronchopulmonary dysplasia (BPD).

[0137] Embodiments of the present disclosure include pharmaceutical compositions for delivering an IL33 RNAi agent to a pulmonary epithelial cell in vivo. Such pharmaceutical compositions can include, for example, an IL33 RNAi agent conjugated to a targeting group that comprises an integrin targeting ligand. In some embodiments, the integrin targeting ligand is comprised of an av[36 integrin ligand.

[0138] In some embodiments, the described pharmaceutical compositions including an IL33 RNAi agent are used for treating or managing clinical presentations in a subject that would benefit from the inhibition of expression of IL33. In some embodiments, a therapeutically or prophylactically effective amount of one or more of pharmaceutical compositions is administered to a subject in need of such treatment. In some embodiments, administration of any of the disclosed IL33 RNAi agents can be used to decrease the number, severity', and / or frequency of symptoms of a disease in a subject.

[0139] In some embodiments, the described IL33 RNAi agents are optionally combined with one or more additional (i.e., second, third, etc.) therapeutics. A second therapeutic can be another IL33 RNAi agent (e g., an IL33 RNAi agent that targets a different sequence within an IL33 gene). In some embodiments, a second therapeutic can be an RN Ai agent that targets the IL33 gene. An additional therapeutic can also be a small molecule drug, antibody, antibody fragment, and / or aptamer. The IL33 RNAi agents, with or without the one or more additional therapeutics, can be combined with one or more excipients to form pharmaceutical compositions.

[0140] The described pharmaceutical compositions that include an IL33 RNAi agent can be used to treat at least one symptom in a subject having a disease or disorder that would benefit from reduction or inhibition in expression of IL33 mRNA. In some embodiments, the subject is administered a therapeutically effective amount of one or more pharmaceutical compositions that include an IL33 RNAi agent thereby treating the symptom. In other embodiments, the subject is administered a prophylactically effective amount of one or more IL33 RNAi agents, thereby preventing or inhibiting the at least one symptom.

[0141] In some embodiments, one or more of the described IL33 RNAi agents are administered to a mammal in a pharmaceutically acceptable carrier or diluent. In some embodiments, the mammal is a human.

[0142] The route of administration is the path by which an IL33 RNAi agent is brought into contact with the body. In general, methods of administering drugs, oligonucleotides, and nucleic acids, for treatment of a mammal are well known in the art and can be applied to administration of the compositions described herein. The IL33 RNAi agents disclosed herein can be administered via any suitable route in a preparation appropriately tailored to the particular route. Thus, in some embodiments, the herein described pharmaceutical compositions are administered via inhalation, intranasal administration, intratracheal administration, or oropharyngeal aspiration administration. In some embodiments, the pharmaceutical compositions can be administered by injection, for example, intravenously, intramuscularly, intracutaneously, subcutaneously, intraarticularly, intraocularly, or intraperitoneally, or topically.

[0143] The pharmaceutical compositions including an IL33 RNAi agent described herein can be delivered to a cell, group of cells, tissue, or subject using oligonucleotide delivery technologies known in the art. In general, any suitable method recognized in the art for delivering a nucleic acid molecule (in vitro or in vivo) can be adapted for use with the compositions described herein. For example, delivery can be by local administration, (e.g.. direct injection, implantation, or topical administering), systemic administration, or subcutaneous, intravenous, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal and intrathecal), intramuscular, transdermal, airway (aerosol), nasal, oral, rectal, or topical (including buccal and sublingual) administration. In some embodiments, the compositions are administered via inhalation, intranasal administration, oropharyngeal aspiration administration, or intratracheal administration.

[0144] For example, in some embodiments, it is desired that the IL33 RNAi agents described herein inhibit the expression of an IL33 gene in the pulmonary' epithelium, for which administration via inhalation (e.g., by an inhaler device, such as a metered-dose inhaler, or a nebulizer such as a jet or vibrating mesh nebulizer, or a soft mist inhaler) is particularly suitable and advantageous.

[0145] In some embodiments, the pharmaceutical compositions described herein comprise one or more pharmaceutically acceptable excipients. The pharmaceutical compositions described herein are formulated for administration to a subject.

[0146] As used herein, a pharmaceutical composition includes a pharmacologically effective amount of at least one of the described therapeutic compounds and one or more pharmaceutically acceptable excipients. Pharmaceutically acceptable excipients (excipients) are substances other than the Active Pharmaceutical Ingredient (API, therapeutic product, e.g., IL33 RNAi agent) thatare intentionally included in the drug delivery' system. Excipients do not exert or are not intended to exert a therapeutic effect at the intended dosage. Excipients can act to a) aid in processing of the drug delivery system during manufacture, b) protect, support or enhance stability', bioavailability or patient acceptability7of the API, c) assist in product identification, and / or d) enhance any other attribute of the overall safety, effectiveness, of delivery of the API during storage or use. A pharmaceutically acceptable excipient may or may not be an inert substance.

[0147] Excipients include, but are not limited to: absorption enhancers, anti-adherents, antifoaming agents, anti-oxidants, binders, buffering agents, carriers, coating agents, colors, delivery enhancers, delivery' polymers, detergents, dextran, dextrose, diluents, disintegrants, emulsifiers, extenders, fillers, flavors, glidants, humectants, lubricants, oils, polymers, preservatives, saline, salts, solvents, sugars, surfactants, suspending agents, sustained release matrices, sweeteners, thickening agents, tonicity agents, vehicles, water-repelling agents, and wetting agents.

[0148] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water-soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor® ELTM (BASF, Parsippany, NJ) or phosphate buffered saline (PBS). It should be stable under the conditions of manufacture and storage and should be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene gly col), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, and sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.

[0149] Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filter sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, methods of preparation includevacuum drying and freeze-dry ing which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-fdtered solution thereof.

[0150] Formulations suitable for intra-articular administration can be in the form of a sterile aqueous preparation of the drug that can be in microcrystalline form, for example, in the form of an aqueous microcrystalline suspension. Liposomal formulations or biodegradable polymer systems can also be used to present the drug for both intra-articular and ophthalmic administration.

[0151] Formulations suitable for inhalation administration can be prepared by incorporating the active compound in the desired amount in an appropriate solvent, followed by sterile filtration. In general, formulations for inhalation administration are sterile solutions at physiological pH and have low viscosity (< 5 cP). Salts may be added to the formulation to balance tonicity. In some cases, surfactants or co-solvents can be added to increase active compound solubility and improve aerosol characteristics. In some cases, excipients can be added to control viscosity in order to ensure size and distribution of nebulized droplets.

[0152] In some embodiments, pharmaceutical formulations that include the IL33 RNAi agents disclosed herein suitable for inhalation administration can be prepared in water for injection (sterile water), or an aqueous sodium phosphate buffer (for example, the IL33 RNAi agent formulated in 0.5 mM sodium phosphate monobasic, 0.5 mM sodium phosphate dibasic, in water).

[0153] The active compounds can be prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. Liposomal suspensions can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U. S. Patent No. 4,522,811.

[0154] The IL33 RNAi agents can be formulated in compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form refers to physically discrete units suited as un itary dosages for the subject to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the dosage unit forms of the disclosure are dictated by and directly dependent on the unique characteristics of the activecompound and the therapeutic effect to be achieved, and the limitations inherent in the art of compounding such an active compound for the treatment of individuals.

[0155] A pharmaceutical composition can contain other additional components commonly found in pharmaceutical compositions. Such additional components include, but are not limited to: anti-pruritics, astringents, local anesthetics, or anti-inflammatory agents (e.g., antihistamine, diphenhydramine, etc.). It is also envisioned that cells, tissues, or isolated organs that express or comprise the herein defined RNAi agents may be used as ■’pharmaceutical compositions.” As used herein, “pharmacologically effective amount,” “therapeutically effective amount,” or simply “effective amount” refers to that amount of an RNAi agent to produce a pharmacological, therapeutic, or preventive result.

[0156] In some embodiments, the methods disclosed herein further comprise the step of administering a second therapeutic or treatment in addition to administering an RNAi agent disclosed herein. In some embodiments, the second therapeutic is another IL33 RNAi agent (e.g., an IL33 RNAi agent that targets a different sequence within the IL33 target). In other embodiments, the second therapeutic can be a small molecule drug, an antibody, an antibody fragment, and / or an aptamer.

[0157] In some embodiments, described herein are compositions that include a combination or cocktail of at least two IL33 RNAi agents having different sequences. In some embodiments, the two or more IL33 RNAi agents are each separately and independently linked to targeting groups. In some embodiments, the two or more IL33 RNAi agents are each linked to targeting groups that include or consist of integrin targeting ligands. In some embodiments, the two or more IL33 RNAi agents are each linked to targeting groups that include or consist of av(36 integrin targeting ligands.

[0158] Described herein are compositions for delivery of IL33 RNAi agents to pulmonary epithelial cells. Furthermore, compositions for delivery of IL33 RNAi agents to cells, including renal epithelial cells and / or epithelial cells in the GI or reproductive tract and / or and ocular surface epithelial cells in the eye, in vivo, are generally described herein.

[0159] Generally, an effective amount of an IL33 RNAi agent disclosed herein will be in the range of from about 0.0001 to about 20 mg / kg of body weight / deposited dose, e.g., from about 0.001 to about 5 mg / kg of body weight / deposited dose. In some embodiments, an effective amount of an IL33 RNAi agent will be in the range of from about 0.01 mg / kg to about 3.0 mg / kg of body weight per deposited dose. In some embodiments, an effective amount of an IL33 RNAi agent will be in the range of from about 0.03 mg / kg to about 2.0 mg / kg of body weight perdeposited dose. In some embodiments, an effective amount of an IL33 RNAi agent will be in the range of from about 0.01 to about 1.0 mg / kg of deposited dose per body weight. In some embodiments, an effective amount of an IL33 RNAi agent will be in the range of from about 0.50 to about 1.0 mg / kg of deposited dose per body weight. Calculating the pulmonary deposited dose (PDD) is done in accordance with methods known in the art. (See Wolff R. K., Dorato M. A., Toxicologic Testing of Inhaled Pharmaceutical Aerosols, Crit Rev Toxicol., 1993; 23(4):343-369; Tepper et al.. International J. Toxicology, 2016, vol. 35(4):376-392). The amount administered will also likely depend on such variables as the overall health status of the patient, the relative biological efficacy of the compound delivered, the formulation of the drug, the presence and types of excipients in the formulation, and the route of administration. Also, it is to be understood that the initial dosage administered can be increased beyond the above upper level to rapidly achieve the desired blood-level or tissue level, or the initial dosage can be smaller than the optimum. In some embodiments, a dose is administered daily. In some embodiments, a dose is administered weekly. In further embodiments, a dose is administered bi-weekly, triweekly, once monthly, or once quarterly (i.e., once every three months).

[0160] For treatment of disease or for formation of a medicament or composition for treatment of a disease, the pharmaceutical compositions described herein including an IL33 RNAi agent can be combined with an excipient or with a second therapeutic agent or treatment including, but not limited to: a second or other RNAi agent, a small molecule drug, an antibody, an antibody fragment, peptide, and / or an aptamer.

[0161] The described IL33 RNAi agents, when added to pharmaceutically acceptable excipients or adjuvants, can be packaged into kits, containers, packs, or dispensers. The pharmaceutical compositions described herein can be packaged in dry powder or aerosol inhalers, other metered-dose inhalers, nebulizers, pre-filled syringes, or vials.Methods of Treatment and Inhibition of 1L33 Expression

[0162] The IL33 RNAi agents disclosed herein can be used to treat a subject (e.g., a human or other mammal) having a disease or disorder that would benefit from administration of the RNAi agent. In some embodiments, the RNAi agents disclosed herein can be used to treat a subject (e.g., a human) that would benefit from a reduction and / or inhibition in expression of IL33 mRNA and / or a reduction in IL33 cytokine levels.

[0163] In some embodiments, the RNAi agents disclosed herein can be used to treat a subject (e.g., a human) having a disease or disorder for which the subject would benefit from reductionin IL33 cytokine levels, including but not limited to asthma, chronic obstructive pulmonary-disease (COPD), autoimmune disorders, and bronchopulmonary dysplasia (BPD). In some embodiments the disease is allergic asthma. In some embodiments the subject has been previously diagnosed with having asthma, or more specifically, allergic asthma, or another pulmonary inflammatory diseases. Treatment of a subject can include therapeutic and / or prophylactic treatment. The subject is administered a therapeutically effective amount of any one or more IL33 RNAi agents described herein. The subject can be a human, patient, or human patient. The subject may be an adult, adolescent, child, or infant. Administration of a pharmaceutical composition described herein can be to a human being or animal.

[0164] Increased IL33 cytokine levels are known to contribute to aberrant epithelial cell, fibroblast, and immune cell function and have been linked to fibrosis particularly in pulmonary tissues and cells. In some embodiments, the described IL33 RNAi agents are used to treat at least one symptom mediated at least in part by a reduction in IL33 cytokine levels, in a subject. The subject is administered a therapeutically effective amount of any one or more of the described IL33 RNAi agents. In some embodiments, the subject is administered a prophylactically effective amount of any one or more of the described RNAi agents, thereby treating the subject by preventing or inhibiting the at least one symptom.

[0165] In certain embodiments, the present disclosure provides methods for treatment of diseases, disorders, conditions, or pathological states mediated at least in part by IL33 gene expression, in a patient in need thereof, wherein the methods include administering to the patient any of the IL33 RNAi agents described herein.

[0166] In some embodiments, the IL33 RNAi agents are used to treat or manage a clinical presentation or pathological state in a subject, wherein the clinical presentation or pathological state is mediated at least in part by a reduction in IL33 expression. The subject is administered a therapeutically effective amount of one or more of the IL33 RNAi agents or IL33 RNAi agentcontaining compositions described herein. In some embodiments, the method comprises administering a composition comprising an IL33 RNAi agent described herein to a subject to be treated.

[0167] In a further aspect, the disclosure features methods of treatment (including prophylactic or preventative treatment) of diseases or symptoms that may be addressed by a reduction in IL33 cytokine levels, the methods comprising administering to a subject in need thereof an IL33 RNAi agent that includes an antisense strand comprising the sequence of any of the sequences in Table 2, Table 3, or Table 10. Also described herein are compositions for use in such methods.

[0168] The described IL33 RNAi agents and / or compositions that include IL33 RNAi agents can be used in methods for therapeutic treatment of disease or conditions caused by enhanced or elevated IL33 cytokine levels. Such methods include administration of an IL33 RNAi agent as described herein to a subject, e.g., a human or animal subject.

[0169] In another aspect, the disclosure provides methods for the treatment (including prophylactic treatment) of a pathological state (such as a condition or disease) mediated at least in part by IL33 expression, wherein the methods include administering to a subject a therapeutically effective amount of an RNAi agent that includes an antisense strand comprising the sequence of any of the sequences in Table 2, Table 3, or Table 10.

[0170] In some embodiments, methods for inhibiting expression of an IL33 gene are disclosed herein, wherein the methods include administering to a cell an RN Ai agent that includes an antisense strand comprising the sequence of any of the sequences in Table 2, Table 3, or Table 10.

[0171] In some embodiments, methods for the treatment (including prophylactic treatment) of a pathological state mediated at least in part by IL33 expression are disclosed herein, wherein the methods include administering to a subject a therapeutically effective amount of an RN Ai agent that includes a sense strand comprising the sequence of any of the sequences in Table 2, Table 4, Table 5, Table 6, or Table 10.

[0172] In some embodiments, methods for inhibiting expression of an IL33 gene are disclosed herein, wherein the methods comprise administering to a cell an RNAi agent that includes a sense strand comprising the sequence of any of the sequences in Table 2, Table 4, Table 5, Table 6. or Table 10.

[0173] In some embodiments, methods for the treatment (including prophylactic treatment) of a pathological state mediated at least in part by IL33 expression are disclosed herein, wherein the methods include administering to a subject a therapeutically effective amount of an RNAi agent that includes a sense strand comprising the sequence of any of the sequences in Table 4. Table 5, Table 6, or Table 10, and an antisense strand comprising the sequence of any of the sequences in Table 3 or Table 10.

[0174] In some embodiments, methods for inhibiting expression of an IL33 gene are disclosed herein, wherein the methods include administering to a cell an RNAi agent that includes a sense strand comprising the sequence of any of the sequences in Table 4, Table 5, Table 6, or Table 10, and an antisense strand comprising the sequence of any of the sequences in Table 3 or Table 10.

[0175] In some embodiments, methods of inhibiting expression of an IL33 gene are disclosed herein, wherein the methods include administering to a subject an IL33 RNAi agent that includes a sense strand consisting of the nucleobase sequence of any of the sequences in Table 4, Table 5, Table 6, or Table 10, and the antisense strand consisting of the nucleobase sequence of any of the sequences in Table 3 or Table 10. In other embodiments, disclosed herein are methods of inhibiting expression of an IL33 gene, wherein the methods include administering to a subject an IL33 RNAi agent that includes a sense strand consisting of the modified sequence of any of the modified sequences in Table 4. Table 5, Table 6, or Table 10, and the antisense strand consisting of the modified sequence of any of the modified sequences in Table 3 or Table 10.

[0176] In some embodiments, methods for inhibiting expression of an IL33 gene in a cell are disclosed herein, wherein the methods include administering one or more IL33 RNAi agents comprising a duplex structure of one of the duplexes set forth in Tables 7A. 7B, 8, 9, and 10.

[0177] In some embodiments, the IL33 gene expression level and / or IL33 mRNA level in certain pulmonary epithelial cells of subject to whom a described IL33 RNAi agent is administered is reduced by at least about 5%, 10%, 15%, 20%. 25%. 30%. 35%, 40%, 45%, 50%, 55%, 60%, 65%. 70%. 75%. 80%. 85%. 90%. 95%. 96%. 97%. 98%, 99%, or greater than 99%. relative to the subject’s respective level prior to being administered the IL33 RNAi agent or to a different subject not receiving the IL33 RNAi agent. In some embodiments, the IL33 cytokine levels in certain epithelial cells or circulating IL33 cytokine levels of a subject to whom a described IL33 RNAi agent is administered is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99%, relative to the subject prior to being administered the IL33 RNAi agent or to a different subject not receiving the IL33 RNAi agent. The gene expression level, cytokine or protein level, and / or mRNA level in the subject may be reduced in a cell, group of cells, serum, and / or tissue of the subject. In some embodiments, the IL33 cytokine levels in certain subject to whom a described IL33 RNAi agent has been administered is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98% relative to the subject prior to being administered the IL33 RNAi agent or to a subject not receiving the IL33 RNAi agent.

[0178] A reduction in gene expression, mRNA, and cytokine or protein levels can be assessed by any methods known in the art. Reduction or decrease in IL33 cytokine levels or IL33 mRNA levels are sometimes collectively referred to herein as a decrease in, reduction of, or inhibitionof IL33 gene expression. The Examples set forth herein illustrate known methods for assessing inhibition of IL33.Cells, Tissues, Organs, and Non-Human Organisms

[0179] Cells, tissues, organs, and non-human organisms that include at least one of the IL33 RNAi agents described herein are contemplated. The cell, tissue, organ, or non-human organism is made by delivering the RNAi agent to the cell, tissue, organ, or non-human organism.Additional Illustrative Embodiments

[0180] Provided here are certain additional illustrative embodiments of the disclosed technology. These embodiments are illustrative only and do not limit the scope of the present disclosure or of the claims attached hereto.1. An RNAi agent for inhibiting expression of an interleukin 33 gene, comprising:an antisense strand comprising at least 17 contiguous nucleotides differing by 0 or 1 nucleotides from any one of the sequences provided in Table 2 or Table 3; and a sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand.2. The RNAi agent of embodiment 1, wherein the antisense strand comprises nucleotides 2- 18 of any one of the sequences provided in Table 2 or Table 3.3. The RNAi agent of embodiment 1 or embodiment 2, wherein the sense strand comprises a nucleotide sequence of at least 17 contiguous nucleotides differing by 0 or 1 nucleotides from any one of the sequences provided in Table 2 or Table 4, and wherein the sense strand has a region of at least 85% complementarity over the 17 contiguous nucleotides to the antisense strand.4. The RNAi agent of any one of embodiments 1-3, wherein at least one nucleotide of the IL33 RNAi agent is a modified nucleotide or includes a modified intemucleoside linkage.5. The RNAi agent of any one of embodiments 1-4, wherein all or substantially all of the nucleotides are modified nucleotides.6. The RNAi agent of any one of embodiments 4-5, wherein the modified nucleotide is selected from the group consisting of: 2'-O-methyl nucleotide, 2'-fluoro nucleotide, 2'- deoxy nucleotide, 2',3'-seco nucleotide mimic, locked nucleotide, 2’-F-arabino nucleotide, 2'-methoxy ethyl nucleotide, abasic nucleotide, ribitol, inverted nucleotide, inverted 2'-O-methyl nucleotide, inverted 2'-deoxy nucleotide, 2'-amino-modifiednucleotide, 2'-alkyl-modified nucleotide, morpholino nucleotide, vinyl phosphonate-containing nucleotide, cyclopropyl phosphonate-containing nucleotide, and 3'-O-methyl nucleotide.The RNAi agent of embodiment 5, wherein all or substantially all of the nucleotides are modified with 2'-O-methyl nucleotides, 2'-fluoro nucleotides, or combinations thereof. The RNAi agent of any one of embodiments 1-7, wherein the antisense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 3. The RNAi agent of any one of embodiments 1-8, wherein the sense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 4.The RNAi agent of embodiment 1, wherein the antisense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 3 and the sense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 4.The RNAi agent of any one of embodiments 1-10, wherein the sense strand is between 18 and 30 nucleotides in length, and the antisense strand is between 18 and 30 nucleotides in length.The RNAi agent of embodiment 11, wherein the sense strand and the antisense strand are each between 18 and 27 nucleotides in length.The RNAi agent of embodiment 12, wherein the sense strand and the antisense strand are each between 18 and 24 nucleotides in length.The RNAi agent of embodiment 13, wherein the sense strand and the antisense strand are each 21 nucleotides in length.The RNAi agent of embodiment 14, wherein the RNAi agent has two blunt ends.The RNAi agent of any one of embodiments 1-15, wherein the sense strand comprises one or two terminal caps.The RNAi agent of any one of embodiments 1-16, wherein the sense strand comprises one or two inverted abasic residues.The RNAi agent of embodiment 1, wherein the RNAi agent is comprised of a sense strand and an antisense strand that form a duplex having the structure of any one of the duplexes in Table 7A, Table 7B, Table 8, Table 9, or Table 10.The RNAi agent of embodiment 18, wherein all or substantially all of the nucleotides are modified nucleotides.20. The RNAi agent of embodiment 1, comprising an antisense strand that consists of, consists essentially of, or comprises a nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5 '3'):UAACAUCUUACCAUCAACACC (SEQ ID NO: 376); or UAGAUGAUUGUCCUUUACACC (SEQ ID NO: 399).21. The RNAi agent of embodiment 20, wherein the sense strand consists of, consists essentially of, or comprises a nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5' -> 3'):GGUGUUGAUGGUAAGAUGUUA (SEQ ID NO: 403); or GGUGUAAAGGAUAAUCAUCUA (SEQ ID NO: 421).22. The RNAi agent of embodiment 20 or 21, wherein all or substantially all of the nucleotides are modified nucleotides.23. The RNAi agent of embodiment 1, comprising an antisense strand that comprises, consists of, or consists essentially of a modified nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5 '3'):cPrpusAfsacAfucuuacCfaUfcAfacacssc (SEQ ID NO: 244); or cPrpusAfsgaugauuGfuCfcUfuUfacacssc (SEQ ID NO: 252);wherein a represents 2'-O-methyl adenosine, c represents 2'-O-methyl cytidine, g represents 2'-O-methyl guanosine, and u represents 2'-O-methyl uridine; Af, represents 2'-fluoro adenosine. Cf represents 2'-fluoro cytidine, Gf represents 2'-fluoro guanosine, and Uf represents 2'-fluoro uridine; cPrpu represents a 5 ’-cyclopropyl phosphonate-2’-O-methyl uridine; s represents a phosphorothioate linkage; ss represents a phosphorodithioate linkage; and wherein all or substantially all of the nucleotides on the sense strand are modified nucleotides.24. The RNAi agent of embodiment 1, wherein the sense strand comprises, consists of, or consists essentially of a modified nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5' -> 3'):gsguguugaUfgGfuAfagauguua (SEQ ID NO: 285); or gsguguaaaGfGfAfuaaucaucua (SEQ ID NO: 282);wherein a represents 2'-O-methyl adenosine, c represents 2'-O-methyl cytidine, g represents 2'-O-methyl guanosine, and u represents 2'-O-methyl uridine; Af, represents 2'-fluoro adenosine, Cf represents 2'-fluoro cytidine, Gf represents 2'-fluoro guanosine, and Uf represents 2'-fluorouridine; s represents a phosphorothioate linkage; and wherein all or substantially all of the nucleotides on the antisense strand are modified nucleotides.25. The RNAi agent of any one of embodiments 20-24, wherein the sense strand further includes inverted abasic residues at the 3’ terminal end of the nucleotide sequence, at the 5’ end of the nucleotide sequence, or at both.26. The RNAi agent of any one of embodiments 1-25, wherein the RNAi agent is linked to a targeting ligand.27. The RNAi agent of embodiment 26, wherein the targeting ligand has affinity for a cell receptor expressed on an epithelial cell.28. The RNAi agent of embodiment 27, wherein the targeting ligand comprises an integrin targeting ligand.29. The RNAi agent of embodiment 28, wherein the integrin targeting ligand is an avP6 integrin targeting ligand.30. The RNAi agent of embodiment 29, wherein the targeting ligand comprises the structure:thereof,wherein? indicates the point of connection to the RNAi agent.31. The RNAi agent of any one of embodiments 26-29, wherein the targeting ligand has a structure selected from the group consisting of:wherein « indicates the point of connection to the RNAi agent.The RNAi agent of embodiment 31, wherein RNAi agent is conjugated to a targeting ligand having the following structure:The RNAi agent of any one of embodiments 26-32, wherein the targeting ligand is conjugated to the sense strand.The RNAi agent of embodiment 33, wherein the targeting ligand is conjugated to the 5’ terminal end of the sense strand.The RNAi agent of any one of embodiments 1-34, wherein the RNAi agent is a pharmaceutically acceptable salt.The RNAi agent of any one of embodiment 35, wherein the RNAi agent is a sodium salt. A composition comprising the RNAi agent of any one of embodiments 1-36, wherein the composition further comprises a pharmaceutically acceptable excipient.The composition of embodiment 37, further comprising a second RNAi agent capable of inhibiting the expression of interleukin 33 gene expression.The composition of any one of embodiments 37-38, further comprising one or more additional therapeutics.The composition of any one of embodiments 37-39, wherein the composition is formulated for administration by inhalation.The composition of embodiment 40, wherein the composition is delivered by a metered-dose inhaler, jet nebulizer, vibrating mesh nebulizer, or soft mist inhaler.The composition of any of embodiments 37-41, wherein the RNAi agent is a sodium salt. The composition of any of embodiments 37-42, wherein the pharmaceutically acceptable excipient is water for injection.The composition of any of embodiments 37-42, wherein the pharmaceutically acceptable excipient is a buffered saline solution.A method for inhibiting expression of an IL33 gene in a cell, the method comprising introducing into a cell an effective amount of an RNAi agent of any one of embodiments 1-35 or the composition of any one of embodiments 37-44.The method of embodiment 45, wherein the cell is within a subject.The method of embodiment 46, wherein the subject is a human subject.The method of any one of embodiments 45-47, wherein following the administration of the RNAi agent the interleukin 33 gene expression is inhibited by at least about 30%. A method of treating one or more symptoms or diseases associated with enhanced or elevated IL33 cytokine activity levels, the method comprising administering to a human subject in need thereof a therapeutically effective amount of the composition of any one of embodiments 37-44.The method of embodiment 49, wherein the disease is asthma, chronic obstructive pulmonary disease (COPD), autoimmune disorders, and bronchopulmonary dysplasia (BPD).The method of embodiment 50, wherein the disease is allergic asthma.The method of any one of embodiments 45-51, wherein the RNAi agent is administered at a deposited dose of about 0.01 mg / kg to about 5.0 mg / kg of body weight of the subject. The method of any one of embodiments 45-52, wherein the RNAi agent is administered at a deposited dose of about 0.03 mg / kg to about 2.0 mg / kg of body weight of the subject. The method of any of embodiments 45-53, wherein the RNAi agent is administered in two or more doses.Use of the RNAi agent of any one of embodiments 1-36, for the treatment of a disease, disorder, or symptom that is mediated at least in part by IL33 cytokine activity and / or IL33 gene expression.56. Use of the composition according to any one of embodiments 37-44, for the treatment of a disease, disorder, or symptom that is mediated at least in part by interleukin 33 cytokine activity and / or interleukin 33 gene expression.57. Use of the composition according to any one of embodiments 37-44, for the manufacture of a medicament for treatment of a disease, disorder, or symptom that is mediated at least in part by interleukin 33 cytokine and / or interleukin 33 gene expression.58. The use of any one of embodiments 55-57, wherein the disease is pulmonary inflammation.59. A method of making an RNAi agent of any one of embodiments 1-36, comprising annealing a sense strand and an antisense strand to form a double-stranded ribonucleic acid molecule.60. The method of embodiment 59, wherein the sense strand comprises a targeting ligand.61. The method of embodiment 60, comprising conjugating a targeting ligand to the sense strand.

[0181] The above provided embodiments and items are now illustrated with the following, non-limiting examples.EXAMPLESExample 1. Synthesis of IL33 RNAi Agents.

[0183] IL33 RNAi agent duplexes disclosed herein were synthesized in accordance with the following:

[0184] A. Synthesis. The sense and antisense strands of the IL33 RNAi agents were synthesized according to phosphoramidite technology on solid phase used in oligonucleotide synthesis. Depending on the scale, a MerMade96E® (Bioautomation), a MerMadel2® (Bioautomation), or an OP Pilot 100 (GE Healthcare) was used. Syntheses were performed on a solid support made of controlled pore glass (CPG, 500 A or 600A, obtained from Prime Synthesis, Aston, PA, USA). The monomer positioned at the 3’ end of the respective strand attached to the solid support was used as a starting point for synthesis and is acquired commercially. All RNA and 2'-modified RNA phosphoramidites were purchased from Thermo Fisher Scientific (Milwaukee, WI, USA). Specifically, the 2'-O-methyl phosphoramidites that were used included the following: (5'-O-dimethoxytrityl-N6-(benzoyl)-2'-O-methyl-adenosine-3'-O-(2-cyanoethyl-N, N-diisopropylamino) phosphoramidite, 5'-O-dimethoxy-tntyl-N4-(acetyl)-2'-O-methyl-cytidine-3'-O-(2-cyanoethyl-N, N-diisopropyl-amino) phosphoramidite, (5'-O-dimethoxytrityl-N2-(isobutyryl)-2'-O-methyl-guanosine-3'-O-(2-cyanoethyl-N, N-diisopropylamino) phosphoramidite. and 5'-O-dimethoxytrityl-2'-O-methyl-uridine-3'-O-(2-cyanoethyl-N, N-diisopropylamino) phosphoramidite. The 2'-deoxy-2'-fluoro-phosphoramidites carried the same protecting groups as the 2'-O-methyl RNA amidites. 5 '-di methoxy tri tyl-2'-0-methyl-inosinc-3'-O-(2-cyanocthyl-N. N-diisopropylamino) phosphoramidites were purchased from Glen Research (Virginia). The inverted abasic (3'-O-dimethoxytrityl-2'-deoxyribose-5'-O-(2-cyanoethyl-N, N-diisopropylamino) phosphoramidites were purchased from ChemGenes (Wilmington, MA, USA). The following UNA phosphoramidites were used: 5'-(4,4-Dimethoxytrityl)-N6-(benzoyl)-2',3'-seco-adenosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N, N-diisopropyl)]-phosphoramidite, 5'-(4,4'-Dimethoxytrityl)-N-acetyl-2',3'-seco-cytosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N, N-diiso-propyl)]-phosphoramidite, 5'-(4,4'-Dimethoxytrityl)-N-isobutyryl-2',3'-seco-guanosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N, N-diisopropyl)]-phosphoramidite, and 5'-(4,4'-Dimethoxy-trityl)-2',3'-seco-uridine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N, N- diiso-propyl)] -phosphoramidite. TFA aminolink phosphoramidites were also commercially purchased (ThermoFisher). Linker L6 was purchased as propargyl-PEG5-NHS from BroadPharm (catalog # BP-20907) and coupled to the NH2-C6 group from an aminolink phosphoramidite to form -L6-C6-, using standard coupling conditions. In each case,phosphorothioate linkages were introduced as specified using the conditions set forth herein. The cyclopropyl phosphonate phosphoramidites were synthesized in accordance with International Patent Application Publication No. WO 2017 / 214112 (see also Altenhofer et. al., Chem. Communications (Royal Soc. Chem.), 57(55):6808-6811 (July 2021)).

[0185] Tri-alkyne-containing phosphoramidites were dissolved in anhydrous dichloromethane or anhydrous acetonitrile (50 mM), while all other amidites were dissolved in anhydrous acetonitrile (50 mM) and molecular sieves (3A) were added. 5-Benzylthio-1H-tetrazole (BTT, 250 mM in acetonitrile) or 5-Ethylthio-1H-tetrazole (ETT, 250 mM in acetonitrile) was used as activator solution. Coupling times were 10 minutes (RNA), 90 seconds (2' O-Me), and 60 seconds (2' F). In order to introduce phosphorothioate linkages, a 100 mM solution of 3-phenyl 1,2,4-dithiazoline-5-one (POS, obtained from PolyOrg, Inc., Leominster, MA. USA) in anhydrous acetonitrile was employed.

[0186] Alternatively, tri-alkyne moieties were introduced post-synthetically (see section E, below). For this route, the sense strand was functionalized with a 5' and / or 3' terminal nucleotide containing a primary amine. TFA aminolink phosphoramidite was dissolved in anhydrous acetonitrile (50 mM) and molecular sieves (3A) were added. 5-Benzylthio-1H-tetrazole (BTT, 250 mM in acetonitrile) or 5-Ethylthio-1H-tetrazole (ETT, 250 mM in acetonitrile) was used as activator solution. Coupling times were 10 minutes (RNA), 90 seconds (2' O-Me), and 60 seconds (2' F). In order to introduce phosphorothioate linkages, a 100 mM solution of 3-phenyl 1,2,4-dithiazoline-5-one (POS, obtained from PolyOrg, Inc., Leominster, MA. USA) in anhydrous acetonitrile was employed.

[0187] B. Cleavage and deprotection of support bound oligomer. After finalization of the solid phase synthesis, the dried solid support was treated with a 1:1 volume solution of 40 wt. % methylamine in water and 28% to 31 % ammonium hydroxide solution (Aldrich) for 1.5 hours at 30°C The solution was evaporated and the solid residue was reconstituted in water (see below).

[0188] C. Purification. Crude oligomers were purified by anionic exchange HPLC using a TSKgel SuperQ-5PW 13pm column and Shimadzu LC-8 system. Buffer A was 20 mM Tris, 5 mM EDTA, pH 9.0 and contained 20% Acetonitrile and buffer B was the same as buffer A with the addition of 1.5 M sodium chloride. UV traces at 260 nm were recorded. Appropriate fractions were pooled then run on size exclusion HPLC using a GE Healthcare XK 16 / 40 column packed with Sephadex G-25 fine with a running buffer of lOOmM ammonium bicarbonate, pH 6.7 and 20% Acetonitrile or filtered water. Alternatively, pooled fractions were desalted and exchanged into an appropriate buffer or solvent system via tangential flow filtration.

[0189] D. Annealing. Complementary strands were mixed by combining equimolar RNA solutions (sense and antisense) in lx PBS (Phosphate-Buffered Saline, lx, Coming, Cellgro) to form the RNAi agents. Some RNAi agents were lyophilized and stored at -15 to -25°C. Duplex concentration was determined by measuring the solution absorbance on a UV-Vis spectrometer in 1 x PBS. The solution absorbance at 260 nm was then multiplied by a conversion factor (0.050 mg / (mL-cm)) and the dilution factor to determine the duplex concentration.

[0190] E. Conjugation of Tri-alkyne linker. In some embodiments a tri-alkyne linker is conjugated to the sense strand of the RNAi agent on resin as a phosphoramidite (see Example 1G for the synthesis of an example tri-alkyne linker phosphoramidite and Example 1A for the conjugation of the phosphoramidite.). In other embodiments, a tri-alkyne linker may be conjugated to the sense strand following cleavage from the resin, described as follows: either prior to or after annealing, in some embodiments, the 5' or 3' amine functionalized sense strand is conjugated to a tri-alkyne linker. An example tri-alkyne linker structure that can be used in forming the constructs disclosed herein is as follows:To conjugate the tri-alkyne linker to the annealed duplex, amine-functionalized duplex was dissolved in 90% DMSO / 10% H2O, at ~500 mg / mL. 40 equivalents triethylamine was added, followed by 3 equivalents tri-alkyne-PNP. Once complete, the conjugate was precipitated twice in a solvent system of lx phosphate buffered saline / acetonitrile (1:14 ratio), and dried.

[0191] F. Synthesis of Targeting Ligand SM6.1((S)-3-(4-(4-((14-azido-3,6,9,12-tetraoxatetradecyl)oxy)naphthalen-l-yl)phenyl)-3-(2-(4-((4-methylpyridin-2-yl)amino)butanamido)acetamido)propanoic acid)

[0192] Compound 5 (tert-Butyl(4-methylpyridin-2-yl)carbamate) (0.501 g, 2.406 mmol, 1 equiv.) was dissolved in DMF (17 mL). To the mixture was added NaH (0.116 g, 3.01 mmol, 1.25 eq, 60 % dispersion in oil) The mixture stirred for 10 min before adding Compound 20 (Ethyl 4-Bromobutyrate (0.745 g, 3.82 mmol, 0.547 mL)) (Sigma 167118). After 3 hours the reaction was quenched with ethanol (18 mL) and concentrated. The concentrate was dissolved in DCM (50 mL) and washed with saturated aq. NaCl solution (1 x 50 mL), dried over Na2SOr, filtered and concentrated. The product was purified on silica column, gradient 0-5% Methanol in DCM.

[0193] Compound 21 was dissolved (0.80 g, 2.378 mmol) in 100 mL of Acetone: 0.1 M NaOH [1:1]. The reaction was monitored by TLC (5% ethyl acetate in hexane). The organics were concentrated away, and the residue was acidified to pH 3-4 with 0.3 M Citric Acid (40 mL). The product was extracted with DCM (3 x 75 mL). The organics were pooled, dried over NazSCL, filtered and concentrated. The product was used without further purification.

[0194] To a solution of Compound 22 (1.1 g, 3.95 mmol, 1 equiv.), Compound 45 (595 mg. 4.74 mmol, 1.2 equiv.), and TBTU (1.52 g, 4.74 mmol, 1.2 equiv.) in anhydrous DMF (10 mL) was added diisopropylethylamine (2.06 mL, 11.85 mmol, 3 equiv.) at 0 °C. The reaction mixture was warmed to room temperature and stirred 3 hours. The reaction was quenched by saturated NaHCCh solution (10 mL). The aqueous phase was extracted with ethyl acetate (3 x 10 mL) andthe organic phase was combined, dried over anhydrous Na2SO4, and concentrated. The product was separated by CombiFlash® using silica gel as the stationary’ phase. LC-MS: calculated [M+H]+ 366.20, found 367.

[0195] To a solution of compound 61 (2 g, 8.96 mmol, 1 equiv.), and compound 62 (2.13 mL, 17.93 mmol, 2 equiv.) in anhydrous DMF (10 mL) was added K2CO3 (2.48 g, 17.93 mmol, 2 equiv.) at 0 °C. The reaction mixture was warmed to room temperature and stirred overnight. The reaction was quenched by water (10 mL). The aqueous phase was extracted with ethyl acetate (3 x 10 mL) and the organic phase was combined, dried over anhydrous Na2SO4, and concentrated. The product was separated by CombiFlash® using silica gel as the stationary phase.

[0196] To a solution of compound 60 (1.77 g. 4.84 mmol, 1 equiv.) in THF (5 mL) and H2O (5 mL) was added lithium hydroxide monohydrate (0.61 g, 14.53 mmol, 3 equiv.) portion-wise at 0 °C. The reaction mixture was warmed to room temperature. After stirring at room temperature for 3 hours, the reaction mixture was acidified by HC1 (6 N) to pH 3.0. The aqueous phase was extracted with ethyl acetate (3 x 20 mL) and the organic layer was combined, dried overNa2SO4, and concentrated. LC-MS: calculated [M+HJ+ 352.18, found 352.

[0197] To a solution of compound 63 (1.88 g, 6.0 mmol, 1.0 equiv.) in anhydrous THF (20 mL) was added n-BuLi in hexane (3.6 mL, 9.0 mmol, 1.5 equiv.) drop-wise at -78 °C. The reaction was kept at -78 °C for another 1 hour. Triisopropylborate (2.08 mL, 9.0 mmol, 1.5 equiv.) was then added into the mixture at -78 °C. The reaction was then warmed up to room temperature and stirred for another 1 hour. The reaction was quenched by saturated NH-iCI solution (20 mL) and the pH was adjusted to 3. The aqueous phase was extracted with EtOAc (3 x 20 mL) and the organic phase was combined, dried over Na2SO4, and concentrated.

[0198] Compound 12 (300 mg, 0.837 mmol, 1.0 equiv.), Compound 65 (349 mg, 1.256 mmol, 1.5 equiv.), XPhos Pd G2 (13 mg, 0.0167 mmol, 0.02 equiv.), and K3PO4 (355 mg, 1.675mmol, 2.0 equiv.) were mixed in a round-bottom flask. The flask was sealed with a screw-cap septum, and then evacuated and backfilled with nitrogen (this process was repeated a total of 3 times). Then, THF (8 mL) and water (2 mL) were added via syringe. The mixture was bubbled with nitrogen for 20 min and the reaction was kept at room temperature for overnight. The reaction was quenched with water (10 mL), and the aqueous phase was extracted with ethyl acetate (3 x 10 mL). The organic phase was dried overNa2SO4, concentrated, and purified via CombiFlash® using silica gel as the stationary phase and was eluted with 15% EtOAc in hexane. LC-MS: calculated [M+H]+ 512.24, found 512.56.

[0199] Compound 66 (858 mg, 1.677 mmol, 1.0 equiv.) was cooled by ice bath. HC1 in dioxane (8.4 mL, 33.54 mmol, 20 equiv.) was added into the flask. The reaction was warmed to room temperature and stirred for another 1 hr. The solvent was removed by rotary evaporator and the product was directly used without further purification. LC-MS: calculated [M+H]+ 412.18, found 412.46.

[0200] To a solution of compound 64 (500 mg, 1.423 mmol, 1 equiv.). compound 67 (669 mg, 1.494 mmol, 1.05 equiv.), and TBTU (548 mg, 0.492 mmol, 1.2 equiv.) in anhydrous DMF (15 mL) was added diisopropylethylamine (0.744 mL, 4.268 mmol, 3 equiv.) at 0 °C. The reaction mixture was warmed to room temperature and stirred for another 1 hr. The reaction was quenched by saturated NaHCO₃ aqueous solution (10 mL) and the product was extracted with ethyl acetate (3 x 20 mL). The organic phase was combined, dried over Na2SO4. and concentrated. The product was purified by CombiFlash® using silica gel as the stationary phase and was eluted with 3-4% methanol in DCM. The yield was 96.23%. LC-MS: calculated [M+H]+ 745.35, found 746.08.

[0201] To a solution of compound 68 (1.02 g, 1.369 mmol, 1 equiv.) in ethyl acetate (10 mL) was added 10% Pd / C (0.15 g, 50% H2O) at room temperature. The reaction mixture was warmed to room temperature and the reaction was monitored by LC-MS. The reaction was kept at room temperature overnight. The solids were filtered through Celite® and the solvent was removed by rotary evaporator. The product was directly used without further purification. LC-MS:[M+H]+ 655.31, found 655.87.

[0202] To a solution of compound 69 (100 mg, 0.152 mmol, 1 equiv.) and azido-PEGs-OTs (128 mg, 0.305 mmol. 2 equiv.) in anhydrous DMF (2 mL) was added K2CO3 (42 mg, 0.305 mmol, 2 equiv.) at 0 °C. The reaction mixture was stirred for 6 hours at 80 °C. The reaction was quenched by saturated NaHCCh solution and the aqueous layer was extracted with ethyl acetate (3 x 10 mL). The organic phase was combined, dried over NazSCL, and concentrated. LC-MS: calculated [M+H]+ 900.40, found 901.46.

[0203] To a solution of compound 72 (59 mg, 0.0656 mmol, 1.0 equiv.) in THF (2 mL) and water (2 mL) was added lithium hydroxide (5 mg, 0.197 mmol, 3.0 equiv.) at room temperature. The mixture was stirred at room temperature for another 1 hr. The pH was adjusted to 3.0 by HC1 (6N) and the aqueous phase was extracted with EtOAc (3 x 10 mL). The organic phase was combined, dried over NazSCU, and concentrated. TFA (0.5 mL) and DCM (0.5 mL) was added into the residue and the mixture was stirred at room temperature for another 3 hr. The solvent was removed by rotary evaporator. LC-MS: calculated [M+H]+ 786.37, found 786.95.

[0204] G. Synthesis of TriAik 14

[0205] TriAlkl4 and (TriAlkl4)s as shown in Table 11, above, may be synthesized using the synthetic route shown below. Compound 14 may be added to the sense strand as a phosphoramidite using standard oligonucleotide synthesis techniques, or compound 22 may be conjugated to the sense strand comprising an amine in an amide coupling reaction.

[0206] To a 3-L jacketed reactor was added 500 mL DCM and 4 (75.0 g, 0.16 mol). The internal temperature of the reaction was cooled to 0 °C and TBTU (170.0 g, 0.53 mol) w as added. The suspension was then treated with the amine 5 (75.5 g, 0.53 mol) dropwdse keeping the internal temperature less than 5 °C. The reaction was then treated with DIPEA (72.3 g, 0.56 mol) slowly, keeping the internal temperature less than 5 °C. After the addition was complete, the reaction was warmed up to 23 °C over 1 hour, and allowed to stir for 3 hours. A 10% kicker charge of all three reagents w ere added and allowed to stir an additional 3 hours. The reaction w as deemedcomplete when <1% of 4 remained. The reaction mixture was washed with saturated ammonium chloride solution (2 x 500 mL) and once with saturated sodium bicarbonate solution (500 mL). The organic layer was then dried over sodium sulfate and concentrated to an oil. The mass of the crude oil was 188 g which contained 72% 6 by QNMR. The crude oil was carried to the next step. Calculated mass for C46H60N4O11 = 845.0 m / z. Found [M+H] = 846.0.

[0207] The 121.2 g of crude oil containing 72 wt% compound 6 (86.0 g, 0.10 mol) was dissolved in DMF (344 mL) and treated with TEA (86 mL, 20 v / v%), keeping the internal temperature below 23 °C. The formation of dibenzofulvene (DBF) relative to the consumption of Fmoc-amine 6 was monitored via HPLC method 1 (Figure 2) and the reaction was complete within 10 hours. To the solution was added glutaric anhydride (12.8 g, 0.11 mol) and the intermediate amine 7 was converted to compound 8 within 2 hours. Upon completion, the DMF and TEA were removed at 30 °C under reduced pressure resulting in 100 g of a crude oil. Due to the high solubility of compound 7 in water, an aqueous workup could not be used, and chromatography is the only way to remove DBF, TMU, and glutaric anhydride. The crude oil (75 g) was purified on a Teledyne ISCO Combi-flash® purification system in three portions. The crude oil (25 g) was loaded onto a 330 g silica column and eluted from 0 - 20% methanol / DCM over 30 minutesresulting in 42 g of compound 8 (54% yield over 3 steps). Calculated mass for C36H55N4O12 = 736.4 m / z. Found [M+H] = 737.0.Compound 22

[0208] Compound 8 (42.0 g, 0.057 mol) was co-stripped with 10 volumes of acetonitrile prior to use to remove any residual methanol from chromatography solvents. The oil was redissolved in DMF (210 mL) and cooled to 0 °C. The solution was treated with 4-nitrophenol (8.7 g, 0.063 moL) followed by EDC-hydrochloride (12.0 g, 0.063 mol) and found to reach completion within 10 hours. The solution w as cooled to 0 °C and 10 volumes ethyl acetate was added followed by 10 volumes saturated ammonium chloride solution, keeping the internal temperature below 15 °C. The layers were allowed to separate and the ethyl acetate layer was washed with brine. The combined aqueous layers were extracted twice with 5 volumes ethyl acetate. The combined organic layers were dried over sodium sulfate and concentrated to an oil. The crude oil (55 g) was purified on a Teledyne ISCO Combi-Flash® purification system in three portions. The crude oil (25 g) was loaded onto a 330 g silica column and eluted from 0 - 10% methanol / DCM over 30 minutes resulting in 22 g of pure 9 (Compound 22) (50% yield). Calculated mass for C42H59N5O14 = 857.4 m / z. Found [M+H] = 858.0.

[0209] A solution of ester 9 (49.0 g, 57.1 mmol) and 6-amino-l -hexanol (7.36 g, 6.28 mmol) in di chloromethane (3 volumes) was treated with tri ethylamine (11.56g, 111.4 mmol) drop wise. The reaction was monitored by observing the disappearance of compound 9 on HPLC Method 1and was found to be complete in 10 minutes. The crude reaction mixture was diluted with 5 volumes dichloromethane and washed with saturated ammonium chloride (5 volumes) and brine (5 volumes). The organic layer was dried over sodium sulfate and concentrated to an oil. The crude oil was purified on a Teledyne ISCO Combi-flash® purification system using a 330 g silica column. The 4-nitrophenol was eluted with 100% ethyl acetate and 10 was flushed from the column using 20% methanol / DCM resulting in a colorless oil (39 g, 81% yield). Calculated mass for C42H69N5O12 = 836.0 m / z. Found [M+H] = 837.0.

[0210] Alcohol 10 was co-stripped twice with 10 volumes of acetonitrile to remove any residual methanol from chromatography solvents and once more with dry dichloromethane (KF < 60 ppm) to remove trace water. The alcohol 10 (2.30 g, 2.8 mmol) was dissolved in 5 volumes dry dichloromethane (KF < 50 ppm) and treated with diisopropylammonium tetrazolide (188 mg, 1.1 mmol). The solution was cooled to 0 °C and treated with 2-cyanoethyl N, N, N’, N‘-tetraisopropylphosphoramidite (1.00 g, 3.3 mmol) dropwise. The solution was removed from ice-bath and stirred at 20 °C. The reaction was found to be complete within 3 - 6 hours. The reaction mixture w as cooled to 0 °C and treated with 10 volumes of a 1:1 solution of saturated ammonium bicarbonate / brine and then warmed to ambient over 1 minute and allowed to stir an additional 3 minutes at 20 °C. The biphasic mixture was transferred to a separatory funnel and 10 volumes of dichloromethane was added. The organic layer was separated and washed with 10 volumes of saturated sodium bicarbonate solution to hydrolyze unreacted bis-phosphorous reagent. The organic layer was dried over sodium sulfate and concentrated to an oil resulting in 3.08 g of 94 wt% Compound 14. Calculated mass for C51H86N7O13P = 1035.6 m / z. Found [M+H] = 1036.

[0211] H. Conjugation of Targeting Ligands. Either prior to or after annealing, the 5' or 3' tridentate alkyne functionalized sense strand is conjugated to targeting ligands. The following example describes the conjugation of targeting ligands to the annealed duplex: Stock solutions of 0.5M Tris(3-hydroxypropyltriazolylmethyl)amine (THPTA). 0.5M of Cu(II) sulfate pentahydrate (Cu(II)SO4 • 5H2O) and 2M solution of sodium ascorbate were prepared in deionized water. A 75 mg / mL solution in DMSO of targeting ligand w as made. In a 1.5 mLcentrifuge tube containing tri-alkyne functionalized duplex (3mg, 75 pL, 40mg / mL in deionized water, -15.000 g / mol), 25 pL of IM Hepes pH 8.5 buffer is added. After vortexing, 35 pL of DMSO was added and the solution is vortexed. Targeting ligand was added to the reaction (6 equivalents / duplex, 2 equivalents / alkyne. ~15pL) and the solution is vortexed. Using pH paper, pH was checked and confirmed to be pH ~8. In a separate 1.5 mL centrifuge tube, 50 pL of 0.5M THPTA was mixed with 10uL of 0.5M Cu(II)SO4 • 5H2O, vortexed, and incubated at room temp for 5 min. After 5 min, THPTA / Cu solution (7.2 pL, 6 equivalents 5:1 THPTA: Cu) was added to the reaction vial, and vortexed. Immediately afterwards, 2M ascorbate (5 pL, 50 equivalents per duplex, 16.7 per alkyne) was added to the reaction vial and vortexed. Once the reaction was complete (typically complete in 0.5-1h), the reaction was immediately purified by non-denaturing anion exchange chromatography.Example 2. AAV8-TBG-hIL33-GLuc Mouse Model

[0212] To evaluate certain IL33 RNAi agents, an IL33-GLuc (Gaussia Luciferase) AAV (Adeno-associated virus) mouse model was used. Six- to eight-week-old male C57BL / 6 mice were transduced with IL33-GLuc AAV serotype 8, administered at least 14 days prior to administration of an IL33 RNAi agent or control. The genome of the IL33-GLuc AAV contains the nucleobases 58-2685 region of the human IL33 cDNA sequence (GenBank NM_033439.4 (Seq ID No. 1)) inserted into the 3‘ UTR of the GLuc reporter gene sequence. The AAV8 is driven by a thyroxine binding globulin (TBG) promoter. 5E12 to 1E13 GC / kg (genome copies per kg animal body weight) of the respective virus in PBS in a total volume of 10 mL / kg animal ’s body weight was injected into mice via the tail vein to create AAV8-TBG-hIL33-GLuc model mice. Inhibition of IL33 expression by an IL33 RNAi agent results in concomitant inhibition of GLuc expression, which is measured. Prior to administration of a treatment (between day -7 and day 1 pre-dose), GLuc expression levels in serum were measured by the Pierce™ Gaussia Luciferase Glow Assay Kit (Thermo Fisher Scientific), and the mice were grouped according to average GLuc levels.

[0213] Mice were anesthetized with 2-3% isoflurane and blood samples were collected from the submandibular area into serum separation tubes (Sarstedt AG & Co., Numbrecht, Germany). Blood was allowed to coagulate at ambient temperature for 20 min. The tubes were centrifuged at 8,000 x g for 3 min to separate the serum and stored at 4°C. Serum was collected and measured by the Pierce™ Gaussia Luciferase Glow Assay Kit according to the manufacturer’s instructions. Serum GLuc levels for each animal can be normalized to the control group of mice injected withvehicle control in order to account for the non-treatment related shift in IL33 expression with this model. To do so, first, the GLuc level for each animal at a time point was divided by the pre-treatment level of expression in that animal (Day 1) in order to determine the ratio of expression “normalized to pre-treatment”. Expression at a specific time point was then normalized to the control group by dividing the “normalized to pre-treatment” ratio for an individual animal by the average “normalized to pre-treatment” ratio of all mice in the normal vehicle control group. Alternatively, the serum GLuc levels for each animal was assessed by normalizing to pre-treatment levels only.

[0214] To evaluate the activity of IL33 RNAi agents in an IL33-AAV model as described in the Examples below, certain IL33 RNAi agents were conjugated to an N-acetyl-galactosamine containing targeting ligand having the chemical structure referred to as NAG37 (see Table 11). NAG37 is known to have high affinity to bind to asialoglycoprotein receptors that are abundantly expressed on liver cells, including hepatocytes (see, e.g., International Patent Application Publication No. W02018044350A1). The use of NAG37-conjugated IL33 RNAi agents was to evaluate the expression of AAV-IL33 in the liver.Example 3. In vivo administration of IL33 RNAi agents in mouse.

[0215] The IL33-AAV-GLuc mouse model described in Example 2, above, was used to evaluate IL33 RNAi agents in vivo. On Day -21, four (n=4) male C57bl / 6 mice in each group were dosed with ~5xlOA12 GC / kg IL33-GLuc AAV8. via intravenous IV injection, at 250 pL per 25 g body weight injection volume. On Day 1, the mice were dosed with either saline or IL33 RNAi agents formulated in saline (at 3.0 mg / kg), via subcutaneous (SC) injection, at 250 pL per 25 g body weight injection volume. The dosing regimen was in accordance with Table 12 below.

[0216] Table 12. Dosing groups of Example 3.

[0217] The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Animals were weighed prior to dosing, and the dosing volume was individually adjusted based on the animal body weight. On Day -7, 1, 8, 15, and 22 post injection, serum was collected.

[0218] Each of the IL33 RNAi agents included modified nucleotides that were conjugated at the 5’ terminal end of the sense strand to a targeting ligand that included three N-acetyl-galactosamine groups (tridentate ligand) having the modified sequences as set forth in the duplex structures herein (see Tables 3, 4, 5, 6, 7A, 7B, and 8 for specific modifications and structure information related to the IL33 RNAi agents; see Table 11 for structure of (NAG37) and (NAG37)s ligand).

[0219] GLuc levels were determined pursuant to the procedure set forth in Example 2, above. Data from the experiment are shown in the following Table 13, with average GLuc reflecting the normalized average value of GLuc. Inhibition of IL33 expression by an IL33 RNAi agent results in concomitant inhibition of GLuc expression, which is measured.

[0220] Table 13. Average GLuc normalized to pre-treatment and saline control in IL33-Gluc AAV mice of Example 3.

[0221] Groups 2-20 showed reduction in IL33-GLuc compared to the saline control Group 1 at all time points (Day 8, 15, 22, and 29). Particularly, 3.0 mg / kg AC005372 achieved substantial inhibition (0.060, ~94% knockdown) on Day 22.Example 4. In vivo administration of IL33 RNAi agents in mouse.

[0222] The IL33-AAV-GLuc mouse model described in Example 2, above, was used to evaluate IL33 RNAi agents in vivo. On Day -21, five (n=5) male C57bl / 6 mice in each group were dosed with ~5xlOA12 GC / kg IL33-GLuc AAV8, via intravenous IV injection, at 250 pL per 25 g body weight inj ection volume. On Day 1, the mice were dosed with either saline or IL33 RNAi agents formulated in saline (at 0.3 mg / kg, 1.0 mg / kg, or 3.0 mg / kg), via subcutaneous (SC) injection, at 250 pL per 25 g body weight injection volume. The dosing regimen was in accordance with Table 14 below.

[0223] Table 14. Dosing groups of Example 4.

[0224] The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Animals were weighed prior to dosing, and the dosing volume was individually adjusted based on the animal body weight. On Day -7, 1, 8, 15, and 22 post injection, serum was collected.

[0225] Each of the IL33 RNAi agents included modified nucleotides that were conjugated at the 5’ terminal end of the sense strand to a targeting ligand that included three N -acetylgalactosamine groups (tridentate ligand) having the modified sequences as set forth in the duplex structures herein (see Tables 3, 4, 5, 6, 7A, 7B, and 8 for specific modifications and structure information related to the IL33 RNAi agents; see Table 11 for structure of (NAG37) and (NAG37)s ligand).

[0226] GLuc levels were determined pursuant to the procedure set forth in Example 2, above. Data from the experiment are shown in the following Table 15, with average GLuc reflecting the normalized average value of GLuc. Inhibition of IL33 expression by an IL33 RNAi agent results in concomitant inhibition of GLuc expression, which is measured.

[0227] Table 15. Average GLuc normalized to pre-treatment and saline control in IL33-Gluc AAV mice of Example 4.

[0228] Groups 2-13 showed reduction in IL33-GLuc compared to the saline control Group 1 at all time points (Day 8, 15, and 22). Particularly, 3.0 mg / kg AC005368 achieved substantial inhibition (0.092, -91% knockdown) on Day 22. A dose-response was observed for all of the tested IL33 RNAi agents at all time points.Example 5. In vivo administration of IL33 RNAi agents in mouse.

[0229] The IL33-AAV-GLuc mouse model described in Example 2, above, was used to evaluate IL33 RNAi agents in vivo. On Day -21. six (n=6) male C57bl / 6 mice in each group were dosed with ~5xlOA12 GC / kg IL33-GLuc AAV8, via intravenous IV injection, at 250 pL per 25 g body weight inj ection volume. On Day 1, the mice were dosed with either saline or IL33 RNAi agents formulated in saline (at 1.0 mg / kg), via subcutaneous (SC) injection, at 250 pL per 25 g bodyweight injection volume. The dosing regimen was in accordance with Table 16 below.

[0230] Table 16. Dosing groups of Example 5.

[0231] The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Animals were weighed prior to dosing, and the dosing volume was individually adjusted based on the animal body weight. On Day -3. 1, 8, 15, and 22 post injection, serum was collected.

[0232] Each of the IL33 RNAi agents included modified nucleotides that were conjugated at the 5’ terminal end of the sense strand to a targeting ligand that included three N-acetyl-galactosamine groups (tridentate ligand) having the modified sequences as set forth in the duplex structures herein (see Tables 3, 4. 5, 6, 7A. 7B, and 8 for specific modifications and structure information related to the IL33 RNAi agents; see Table 11 for structure of (NAG37) and (NAG37)s ligand).

[0233] GLuc levels were determined pursuant to the procedure set forth in Example 2, above. Data from the experiment are shown in the following Table 17, with average GLuc reflecting the normalized average value of GLuc. Inhibition of IL33 expression by an IL33 RNAi agent results in concomitant inhibition of GLuc expression, which is measured.

[0234] Table 17. Average GLuc normalized to pre-treatment and saline control in IL33-Gluc AAV mice of Example 5.

[0235] At Day 8, and Day 15 Groups 2-20 showed reduction in IL33-GLuc compared to the saline control Group 1. At Day 22, Groups 2-8, 10, 12. 13. 15. and 20 showed reduction in IL33-GLuc compared to the saline control Group 1. Particularly, 1.0 mg / kg AC006342 achieved substantial inhibition (0.153, ~85% knockdown) on Day 8.Example 6. In vivo administration of IL33 RNAi agents in mouse.

[0236] The IL33-AAV-GLuc mouse model described in Example 2, above, was used to evaluate 1L33 RNAi agents in vivo. On Day -21, six (n=6) male C57bl / 6 mice in each group were dosed with ~5xlO 12 GC / kg IL33-GLuc AAV8, via intravenous IV injection, at 250 pL per 25 g body weight inj ection volume. On Day 1, the mice were dosed with either saline or IL33 RNAi agents formulated in saline (at 1.0 mg / kg). via subcutaneous (SC) injection, at 250 pL per 25 g body weight injection volume. The dosing regimen was in accordance with Table 18 below.

[0237] Table 18. Dosing groups of Example 6.

[0238] The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Animals were weighed prior to dosing, and the dosing volume was individually adjusted based on the animal body weight. On Day -7. 1, 8, 15, and 22 post injection, serum was collected.

[0239] Each of the IL33 RNAi agents included modified nucleotides that were conjugated at the 5’ terminal end of the sense strand to a targeting ligand that included three N-acetyl-galactosamine groups (tridentate ligand) having the modified sequences as set forth in the duplex structures herein (see Tables 3, 4. 5, 6, 7A. 7B, and 8 for specific modifications and structureinformation related to the IL33 RNAi agents; see Table 11 for structure of (NAG37) and (NAG37)s ligand).

[0240] GLuc levels were determined pursuant to the procedure set forth in Example 2, above. Data from the experiment are shown in the following Table 19, with average GLuc reflecting the normalized average value of GLuc. Inhibition of IL33 expression by an IL33 RNAi agent results in concomitant inhibition of GLuc expression, which is measured.

[0241] Table 19. Average GLuc normalized to pre-treatment and saline control in IL33-Gluc AAV mice of Example 6.

[0242] At all time points (Day 8, 15, and 22), Groups 2-20 showed reduction in IL33-GLuc compared to the saline control Group 1. Particularly, 1.0 mg / kg AC006940 achieved substantial inhibition (0.102, -90% knockdown) on Day 15.Example 7. In vivo administration ofIL33 RNAi agents in mouse.

[0243] The IL33-AAV-GLuc mouse model described in Example 2, above, was used to evaluate IL33 RNAi agents in vivo. On Day -21, six (n=6) male C57bl / 6 mice in each group were dosed with ~5xlOA12 GC / kg IL33-GLuc AAV8, via intravenous IV injection, at 250 pL per 25 g body weight inj ection volume. On Day 1, the mice were dosed with either saline or IL33 RNAi agents formulated in saline (at 1.0 mg / kg), via subcutaneous (SC) injection, at 250 pL per 25 g body weight injection volume. The dosing regimen was in accordance with Table 20 below.

[0244] Table 20. Dosing groups of Example 7.

[0245] The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Animals were weighed prior todosing, and the dosing volume was individually adjusted based on the animal body weight. On Day -7. 1, 8, 15, and 22 post injection, serum was collected.

[0246] Each of the IL33 RNAi agents included modified nucleotides that were conjugated at the 5’ terminal end of the sense strand to a targeting ligand that included three N-acetyl-galactosamine groups (tridentate ligand) having the modified sequences as set forth in the duplex structures herein (see Tables 3, 4, 5, 6, 7A. 7B, and 8 for specific modifications and structure information related to the IL33 RNAi agents; see Table 11 for structure of (NAG37) and (NAG37)s ligand).

[0247] GLuc levels were determined pursuant to the procedure set forth in Example 2, above. Data from the experiment are shown in the following Table 21, with average GLuc reflecting the normalized average value of GLuc. Inhibition of IL33 expression by an IL33 RNAi agent results in concomitant inhibition of GLuc expression, which is measured.

[0248] Table 21. Average GLuc normalized to pre-treatment and saline control in IL33-Gluc AAV mice of Example 7.

[0249] At all time points (Day 8, 15, and 22), Groups 2-14 showed reduction in IL33-GLuc compared to the saline control Group 1. Particularly, 1.0 mg / kg AC005368 achieved substantial inhibition (0.241, -76% knockdown) on Day 15.Example 8. In vivo administration of IL33 RNAi agents in mouse.

[0250] The IL33-AAV-GLuc mouse model described in Example 2, above, was used to evaluate IL33 RNAi agents in vivo. On Day -21, six (n=6) male C57bl / 6 mice in each group were dosed with ~5xlOA12 GC / kg IL33-GLuc AAV8, via intravenous IV injection, at 250 pL per 25 g body weight inj ection volume. On Day 1, the mice were dosed with either saline or IL33 RNAi agents formulated in saline (at 0.3 mg / kg or 1.0 mg / kg), via subcutaneous (SC) injection, at 250 pL per 25 g body weight injection volume. The dosing regimen was in accordance with Table 22 below.

[0251] Table 22. Dosing groups of Example 8.

[0252] The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Animals were weighed prior todosing, and the dosing volume was individually adjusted based on the animal body weight. On Day -7. 1, 8, 15, and 22 post injection, serum was collected.

[0253] Each of the IL33 RNAi agents included modified nucleotides that were conjugated at the 5’ terminal end of the sense strand to a targeting ligand that included three N-acetyl-galactosamine groups (tridentate ligand) having the modified sequences as set forth in the duplex structures herein (see Tables 3, 4, 5, 6, 7A. 7B, and 8 for specific modifications and structure information related to the IL33 RNAi agents; see Table 11 for structure of (NAG37) and (NAG37)s ligand).

[0254] GLuc levels were determined pursuant to the procedure set forth in Example 2, above. Data from the experiment are shown in the following Table 23, with average GLuc reflecting the normalized average value of GLuc. Inhibition of IL33 expression by an IL33 RNAi agent results in concomitant inhibition of GLuc expression, which is measured.

[0255] Table 23. Average GLuc normalized to pre-treatment and saline control in IL33-Gluc AAV mice of Example 8.

[0256] At all time points (Day 8, 15, and 22), Groups 2-15 showed reduction in IL33-GLuc compared to the saline control Group 1. Particularly, 1.0 mg / kg AC006345 achieved substantial inhibition (0.214, -79% knockdown) on Day 15. A dose-response was observed for all of the tested IL33 RNAi agents at all time points.Example 9. In vivo administration of IL33 RNAi agents in mouse.

[0257] The IL33-AAV-GLuc mouse model described in Example 2, above, was used to evaluate IL33 RNAi agents in vivo. On Day -21, six (n=6) male C57bl / 6 mice in each group were dosed with ~5xlO 12 GC / kg IL33-GLuc AAV8, via intravenous IV injection, at 250 pL per 25 g body weight injection volume. On Day 1, the mice were dosed with either saline or IL33 RNAi agents formulated in saline (at 0.5 mg / kg). via subcutaneous (SC) injection, at 250 pL per 25 g body weight injection volume. The dosing regimen was in accordance with Table 24 below.

[0258] Table 24. Dosing groups of Example 9.

[0259] The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Animals were weighed prior to dosing, and the dosing volume was individually adjusted based on the animal body weight. On Day -7, 1, 8, 15, and 22 post injection, serum was collected.

[0260] Each of the IL33 RNAi agents included modified nucleotides that were conjugated at the 5' terminal end of the sense strand to a targeting ligand that included three N-acetyl-galactosamine groups (tridentate ligand) having the modified sequences as set forth in the duplex structures herein (see Tables 3, 4, 5, 6, 7A, 7B, and 8 for specific modifications and structure information related to the IL33 RNAi agents; see Table 11 for structure of (NAG37) and (NAG37)s ligand).

[0261] GLuc levels were determined pursuant to the procedure set forth in Example 2, above. Data from the experiment are shown in the following Table 25, with average GLuc reflecting the normalized average value of GLuc. Inhibition of IL33 expression by an IL33 RNAi agent results in concomitant inhibition of GLuc expression, which is measured.

[0262] Table 25. Average GLuc normalized to pre-treatment and saline control in IL33-Gluc AAV mice of Example 9.

[0263] At all time points (Day 8. 15, and 22). Groups 2-20 showed reduction in IL33-GLuc compared to the saline control Group 1. Particularly, 0.5 mg / kg AC007896 achieved substantial inhibition (0.315, ~68% knockdown) on Day 15.Example 10. In vivo administration ofIL33 RNAi agents in mouse.

[0264] The IL33-AAV-GLuc mouse model described in Example 2, above, was used to evaluate IL33 RNAi agents in vivo. On Day -21, five (n=5) male C57bl / 6 mice in each group were dosed with ~5xlO 12 GC / kg IL33-GLuc AAV8, via intravenous IV injection, at 250 pL per 25 g body weight inj ection volume. On Day 1, the mice were dosed with either saline or IL33 RNAi agents formulated in saline (at 0.5 mg / kg or 1.0 mg / kg), via subcutaneous (SC) injection, at 250 pL per 25 g body weight injection volume. The dosing regimen was in accordance with Table 26 below.

[0265] Table 26. Dosing groups of Example 10.

[0266] The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Animals were weighed prior to dosing, and the dosing volume was individually adjusted based on the animal body weight. On Day -7, 1, 8, 15, and 22 post injection, serum was collected.

[0267] Each of the IL33 RNAi agents included modified nucleotides that were conjugated at the 5’ terminal end of the sense strand to a targeting ligand that included three N -acetylgalactosamine groups (tridentate ligand) having the modified sequences as set forth in the duplex structures herein (see Tables 3, 4, 5, 6, 7A, 7B, and 8 for specific modifications and structure information related to the IL33 RNAi agents; see Table 11 for structure of (NAG37) and (NAG37)s ligand).

[0268] GLuc levels were determined pursuant to the procedure set forth in Example 2, above. Data from the experiment are shown in the following Table 27, with average GLuc reflecting the normalized average value of GLuc. Inhibition of IL33 expression by an IL33 RNAi agent results in concomitant inhibition of GLuc expression, which is measured.

[0269] Table 27. Average GLuc normalized to pre-treatment and saline control in IL33-Gluc AAV mice of Example 10.

[0270] At all time points (Day 8, 15, and 22), Groups 2-14 showed reduction in IL33-GLuc compared to the saline control Group 1. Particularly, 1.0 mg / kg AC007889 achieved substantial inhibition (0.149. -85% knockdown) on Day 15. A dose-response was observed for AC007896 (at all time points), AC007892 (at all time points), AC007889 (at all time points), and AC007888 (at all time points).Example 11. In vivo administration ofIL33 RNAi agents in mouse.

[0271] The IL33-AAV-GLuc mouse model described in Example 2, above, was used to evaluate IL33 RNAi agents in vivo. On Day -21, six (n=6) male C57bl / 6 mice in each group were dosed with ~4.5xlOA12 GC / kg IL33-GLuc AAV8, via intravenous IV injection, at 250 pL per 25 g body weight injection volume. On Day 1. the mice were dosed with either saline or IL33 RNAi agents formulated in saline (at 0.5 mg / kg, 1.0 mg / kg, or 2.0 mg / kg), via subcutaneous (SC) injection, at 250 pL per 25 g body weight injection volume. The dosing regimen was in accordance with Table 28 below.

[0272] Table 28. Dosing groups of Example 11.

[0273] The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Animals were weighed prior to dosing, and the dosing volume was individually adjusted based on the animal body weight. On Day -7, 1, 8, 15, and 22 post injection, serum was collected.

[0274] Each of the IL33 RNAi agents included modified nucleotides that w ere conjugated at the 5’ terminal end of the sense strand to a targeting ligand that included three N-acetyl-galactosamine groups (tridentate ligand) having the modified sequences as set forth in the duplex structures herein (see Tables 3, 4, 5, 6, 7A, 7B, and 8 for specific modifications and structure information related to the IL33 RNAi agents; see Table 11 for structure of (NAG37) and (NAG37)s ligand).

[0275] GLuc levels were determined pursuant to the procedure set forth in Example 2, above. Data from the experiment are shown in the following Table 29, with average GLuc reflecting the normalized average value of GLuc. Inhibition of IL33 expression by an IL33 RNAi agent results in concomitant inhibition of GLuc expression, which is measured.

[0276] Table 29. Average GLuc normalized to pre-treatment and saline control in IL33-Gluc AAV mice of Example 11.

[0277] At all time points (Day 8, 15, and 22), Groups 2-7 showed reduction in IL33-GLuc compared to the saline control Group 1. Particularly, 2.0 mg / kg AC007908 achieved substantialinhibition (0.088, -91% knockdown) on Day 22. A dose-response was observed for all of the tested IL33 RNAi agents at all time points.Example 12. AA V9-CAG-hIL33 Mouse Model.

[0278] To evaluate certain IL33 RNAi agents, an AAV9-hIL33 (Adeno-associated virus AAV) mouse model was used. Five- (5) to six- (6) week old male C57BL / 6J mice were transduced with 1) AAV9-CAG-hIL33 and 2) AAV9-CAG-eGFP. AAV9-CAG-hIL33 is of AAV serotype 9, driven by the chicken beta-actin (CAG) promoter, the transgenic sequence includes the human IL33 hIL33 cDNA (nucleobases 58-2685 region of the human IL33 cDNA sequence (GenBank NM_033439.4 (Seq ID No. 1)). AAV9-CAG-eGFP is of AAV serotype 9, driven by the chicken beta-actin (CAG) promoter, the transgenic sequence includes eGFP. The AAV9-CAG-hIL33 and AAV9-CAG-eGFP were both formulated in PBS and diluted at AAV / 25 g in a total dose delivery volume of 25 pl, and delivered via the low pressure tail vein (LPTV) injection to create AAV9-CAG-hIL33 model mice.

[0279] Between Day -21 and Day -14. mice were administered 1) AAV9-CAG-hIL33 (2xl0A10 GC / kg) and 2) AAV9-CAG-eGFP (2xl0A10 GC / kg) (GC / kg = genome copies per kg animal body weight), via the intratracheal IT injection.

[0280] On Day 1, the mice were administered, via intratracheal IT injection, IL33 RNAi agents (formulated in saline) or saline.

[0281] Between Day 14 to Day 22, the test mice were sacrificed and harvested. Blood samples were collected from the test animals throughout the duration of the studies. From the test animals, whole lungs w ere collected and analyzed for the biological parameters of interest.Example 13. In vivo administration ofIL33 RNAi agents in mouse.

[0282] The AAV9-CAG-hIL33 mouse model described in Example 12, above, was used to evaluate IL33 RNAi agents in vivo. On Day -17 and -14, five (n=5) female C57bl / 6 mice in each group were dosed with ~2xl0A10 GC / kg AAV9-CAG-hIL33 and ~2xl0A10 GC / kg AAV9-CAG-eGFP, via intratracheal IT injection, at 50 pL per total dose volume. On Day 1 and 3, the mice were dosed with either saline or IL33 RNAi agents formulated in saline (at 1.5 mg / kg body weight), via intratracheal IT injection, at 50 pL per total dose volume. The dosing regimen was in accordance with Table 30 below.

[0283] Table 30. Dosing groups of Example 13.

[0284] The intratracheal injections were performed via feeding needle. At Day 15, the test animals were sacrificed. From the test animals, whole lungs were harvested, and subsequently evaluated for relevant biological parameters.

[0285] Each of the IL33 RNAi agents included modified nucleotides that were conjugated at the 5' terminal end of the sense strand to a targeting ligand that included integrin targeting ligand Tri-SM6. l-av06-TA14 having the modified sequences as set forth in the duplex structures herein (see Tables 3, 4, 5, 6, 7A, 7B, and 8 for specific modifications and structure information related to the IL33 RNAi agents; see Figure 1 for Tri-SM6.1-avP6-TA14 ligand).

[0286] From the collected mouse lung samples, lysates were generated.

[0287] Mouse lung hIL33 mRNA levels were quantified via qPCR, with eGFP as endogenous control gene, normalized to Group 1 mice dosed with saline. The data from the experiment are shown in the following Table 31 A.

[0288] Table 31A. Average hIL33 mRNA transcript expression normalized to saline control in AAV9-CAG-hIL33 mice of Example 13.

[0289] At Day 15, Groups 2-9 showed reduction in hlL33 mRNA transcript levels in AAV9-CAG-hIL33 mice. Most notably, two doses of 1.5 mg / kg AC005296 achieved -71% hIL33 inhibition (0.293) at Day 15.

[0290] From the collected mouse lung samples, lysates were generated. Lung lysate human hIL33 levels were quantified via U-PLEX immunoassay (Meso Scale Diagnostics, Cat. #K151WFK). Mouse lung hIL33 protein levels were normalized to Group 1 animals dosed with saline. The data from the experiment are shown in the following Table 31B.

[0291] Table 31B. Average hIL33 protein expression normalized to saline control in AAV9-CAG-hIL33 mice of Example 13.

[0292] At Day 15, Groups 2-8 showed reduction in hIL33 protein levels in AAV9-CAG-hIL33 mice. Most notably, two doses of 1.5 mg / kg AC005296 achieved -93% hIL33 inhibition (0.065) at Day 15.Example 14. In vivo administration ofIL33 RNAi agents in mouse.

[0293] The AAV9-CAG-hIL33 mouse model described in Example 12, above, was used to evaluate IL33 RNAi agents in vivo. On Day -17 and -14, five (n=5) female C57bl / 6 mice in each group were dosed with ~2xl0A10 GC / kg AAV9-CAG-hIL33 and ~2xl0A10 GC / kg AAV9-CAG-eGFP, via intratracheal IT injection, at 50 pL per total dose volume. On Day 1 and 4, the mice were dosed with either saline or IL33 RNAi agents formulated in saline (at 1.5 mg / kg or 3.0 mg / kg body weight), via intratracheal IT injection, at 50 pL per total dose volume. The dosing regimen was in accordance with Table 32 below.

[0294] Table 32. Dosing groups of Example 14.

[0295] The intratracheal injections were performed via feeding needle. At Day 15, the test animals were sacrificed. From the test animals, whole lungs were harvested, and subsequently evaluated for relevant biological parameters.

[0296] Each of the IL33 RNAi agents included modified nucleotides that were conjugated at the 5’ terminal end of the sense strand to a targeting ligand that included integrin targeting ligand Tri-SM6. 1 -avf)6-TA 14 having the modified sequences as set forth in the duplex structures herein (see Tables 3, 4, 5, 6, 7A, 7B, and 8 for specific modifications and structure information related to the IL33 RNAi agents; see Figure 1 for Tri-SM6.1-avP6-TA14 ligand).

[0297] From the collected mouse lung samples, lysates were generated.

[0298] Mouse lung hIL33 mRNA levels were quantified via qPCR, with eGFP as endogenous control gene, normalized to Group 1 mice dosed with saline. The data from the experiment are shown in the follow ing Table 33A.

[0299] Table 33A. Average hIL33 mRNA transcript expression normalized to saline control in AAV9-CAG-hIL33 mice of Example 14.

[0300] At Day 15, Groups 2-8 showed reduction in hIL33 mRNA transcript levels in AAV9-CAG-ML33 mice. Most notably, two doses of 3.0 mg / kg AC008453 achieved -84% hIL33 inhibition (0.156) at Day 15. A dose-response was observed for AC008452 and AC008453.

[0301] Lung lysate human hIL33 levels were quantified via U-PLEX immunoassay (Meso Scale Diagnostics, Cat. #K151WFK). Mouse lung hIL33 protein levels were normalized to Group 1 animals dosed with saline. The data from the experiment are shown in the following Table 33B.

[0302] Table 33B. Average hIL33 protein expression normalized to saline control in AAV9-CAG-hIL33 mice of Example 14.

[0303] At Day 15, Groups 2-8 showed reduction in hIL33 protein levels in AAV9-CAG-HL33 mice. Most notably, two doses of 3.0 mg / kg AC008453 achieved -93% hIL33 inhibition (0.074) at Day 15. A dose-response was observed for AC008453.Example 15. In vivo administration ofIL33 RNAi agents in mouse.

[0304] The AAV9-CAG-hIL33 mouse model described in Example 12, above, was used to evaluate IL33 RNAi agents in vivo. On Day -17 and -13, five (n=5) female C57bl / 6 mice in each group were dosed with ~2xl0A10 GC / kg AAV9-CAG-hIL33 and ~2xl0A10 GC / kg AAV9-CAG-eGFP, via intratracheal IT injection, at 50 pL per total dose volume. On Day 1 and 3, the mice were dosed with either saline or IL33 RNAi agents formulated in saline (at 1.5 mg / kg or 3.0 mg / kg body weight), via intratracheal IT injection, at 50 pL per total dose volume. The dosing regimen was in accordance with Table 34 below.

[0305] Table 34. Dosing groups of Example 15.

[0306] The intratracheal injections were performed via feeding needle. At Day 15, the test animals were sacrificed. From the test animals, whole lungs were harvested, and subsequently evaluated for relevant biological parameters.

[0307] Each of the IL33 RNAi agents included modified nucleotides that were conjugated at the 5’ terminal end of the sense strand to a targeting ligand that included integrin targeting ligand Tri-SM6. l-av(36-TA 14 having the modified sequences as set forth in the duplex structures herein (see Tables 3, 4, 5, 6, 7A, 7B, and 8 for specific modifications and structure information related to the IL33 RNAi agents; see Figure 1 for Tri-SM6.1-avP6-TA14 ligand).

[0308] From the collected mouse lung samples, lysates were generated.

[0309] Mouse lung hIL33 mRNA levels were quantified via qPCR, with eGFP as endogenous control gene, normalized to Group 1 mice dosed with saline. The data from the experiment are shown in the following Table 35A.

[0310] Table 35A. Average hIL33 mRNA transcript expression normalized to saline control in AAV9-CAG-hIL33 mice of Example 15.

[0311] At Day 15, Groups 2-8 showed reduction in hIL33 mRNA transcript levels in AAV9-CAG-hIL33 mice. Most notably, two doses of 3.0 mg / kg AC008451 achieved -78% hIL33 inhibition (0.224) at Day 15. A dose-response was observed for AC008451 and AC008448.Example 16. In vivo administration ofIL33 RNAi agents in mouse.

[0312] The AAV9-CAG-hIL33 mouse model described in Example 12, above, was used to evaluate IL33 RNAi agents in vivo. On Day -17 and -14, five (n=5) female C57bl / 6 mice in each group were dosed with ~2xl0A10 GC / kg AAV9-CAG-hIL33 and ~2xl0A10 GC / kg AAV9-CAG-eGFP, via intratracheal IT injection, at 50 pL per total dose volume. On Day 1 and 3, the mice were dosed with either saline or IL33 RNAi agents formulated in saline (at 0.75 mg / kg, 1.5 mg / kg, or 3.0 mg / kg body weight), via intratracheal IT injection, at 50 pL per total dose volume. The dosing regimen was in accordance with Table 36 below.

[0313] Table 36. Dosing groups of Example 16.

[0314] The intratracheal injections were performed via feeding needle. At Day 15, the test animals were sacrificed. From the test animals, whole lungs were harvested, and subsequently evaluated for relevant biological parameters.

[0315] Each of the IL33 RNAi agents included modified nucleotides that were conjugated at the 5’ terminal end of the sense strand to a targeting ligand that included integrin targeting ligand Tri-SM6.1-av|36-TA14 having the modified sequences as set forth in the duplex structures herein (see Tables 3, 4, 5, 6, 7A, 7B, and 8 for specific modifications and structure information related to the IL33 RNAi agents; see Figure 1 for Tri-SM6. l-av(36-TA14 ligand).

[0316] Group 8 mice were dosed with RNAi agent AC002666. AC002666 is a construct that includes chemical modifications designed to prevent the loading of the antisense strand into RISC (serving as a negative control).

[0317] From the collected mouse lung samples, lysates were generated.

[0318] Mouse lung hIL33 mRNA levels were quantified via qPCR, with eGFP as endogenous control gene, normalized to Group 1 mice dosed with saline. The data from the experiment are shown in the following Table 37A.

[0319] Table 37A. Average hIL33 mRNA transcript expression normalized to saline control in AAV9-CAG-hIL33 mice of Example 16.

[0320] At Day 15, Groups 2-7 showed reduction in hlL33 mRNA transcript levels in AAV9-CAG-hIL33 mice. Most notably, two doses of 3.0 mg / kg AC008453 achieved -75% hIL33 inhibition (0.250) at Day 15. A dose-response was observed for AC008453 and AC008448.

[0321] Lung lysate human hIL33 levels were quantified via U-PLEX immunoassay (Meso Scale Diagnostics, Cat. #K151WFK). Mouse lung hIL33 protein levels were normalized to Group 1 animals dosed with saline. The data from the experiment are shown in the following Table 37B.

[0322] Table 37B. Average hIL33 protein expression normalized to saline control in AAV9-CAG-hIL33 mice of Example 16.

[0323] At Day 15, Groups 2-7 showed reduction in hIL33 protein levels in AAV9-CAG-HL33 mice. Most notably, two doses of 3.0 mg / kg AC008453 achieved -74% hIL33 inhibition (0.258) at Day 15. A dose-response was observed for AC008453 and AC008448.Example 17. In vivo administration ofIL33 RNAi agents in mouse.

[0324] The IL33 RNAi agents were evaluated in vivo in humanized IL33 mouse. On Day 1 and 3, five (n=5) female C57BL / 6-IL33tml(hIL33)Bcgen / Bcgen mice ( ‘B-hIL33” mice, Biocytogen) were dosed with either saline or IL33 RNAi agents formulated in saline (at 1.0 mg / kg, 2.5 mg / kg, or 5.0 mg / kg body weight), via intratracheal IT injection, at 50 pL per total dose volume. The dosing regimen was in accordance with Table 38 below.

[0325] C57BL / 6-IL33tml(hIL33)Bcgen / Bcgen mice (‘“B-hIL33” mice, Biocytogen) have exons 2-8 of the mouse IL33 gene (encoding for full-length protein) replaced by human IL33 exons 2-8.

[0326] Table 38. Dosing groups of Example 17.

[0327] The intratracheal injections were performed via feeding needle. At Day 15, the test animals were sacrificed. From the test animals, whole lungs were harvested, and subsequently evaluated for relevant biological parameters.

[0328] Each of the IL33 RNAi agents included modified nucleotides that were conjugated at the 5’ terminal end of the sense strand to a targeting ligand that included integrin targeting ligand Tri-SM6.1-avP6-TA14 having the modified sequences as set forth in the duplex structures herein (see Tables 3, 4, 5, 6, 7A, 7B, and 8 for specific modifications and structure information related to the IL33 RNAi agents; see Figure 1 for Tri-SM6.1-avP6-TA14 ligand).

[0329] Group 7 mice were dosed with RNAi agent AC007729. AC007729 is a construct that includes chemical modifications designed to prevent the loading of the antisense strand into RISC (serving as a negative control).

[0330] From the collected mouse lung samples. hIL33 mRNA transcript levels were quantified via qPCR, with mB2M as endogenous control gene, normalized to Group 1 mice dosed with saline. The data from the experiment are show n in the following Table 39.

[0331] Table 39. Average hIL33 mRNA transcript expression normalized to saline control in B-hIL33 mice of Example 17.

[0332] At Day 15, Groups 2-6 showed reduction in hIL33 transcripts in B-hIL33 mice. Most notably, two doses of 5.0 mg / kg AC008448achieved -66% hIL33 inhibition (0.339) at Day 15.

[0333] From the collected mouse lung samples, lysates were generated. Lung lysate human hIL33 levels were quantified via U-PLEX immunoassay (Meso Scale Diagnostics, Cat. K151WFK). Mouse lung hIL33 protein levels were normalized to Group 1 animals dosed with saline. The data from the experiment are shown in the following Table 40.

[0334] Table 40. Average hIL33 protein expression normalized to saline control in B-hIL33 mice of Example 17.

[0335] At Day 15, Groups 2-6 showed reduction in hIL33 in B-hIL33 mice. Most notably, two doses of 2.5 mg / kg AC008453 achieved -84% hIL33 inhibition (0.158) at Day 15.Example 18. In vivo administration ofIL33 RNAi agents in rat.

[0336] IL33 RNAi agents were evaluated in vivo in rat. On Day 1 and Day 3, five (n=5) Brow n Norway rats were administered either PBS, or IL33 RNAi agent (formulated in PBS at 5.0 mg / kg), via intratracheal (IT) administration via microsprayer, at 200 pL dose volume.

[0337] On Day 15, the rats were administered and challenged, via intratracheal IT administration via microsprayer, with a single dose of 500 pg per rat of Alternaria alternata prepared in PBS. Rats in Group 1 were administered with PBS and no Alternaria alternata, as control.

[0338] Dosing was in accordance with Table 41 below.

[0339] Table 41. RNAi Agent and Dosing for Example 18.

[0340] AC005120 includes a rat-specific sequence designed to target the rat IL33 transcript (NCBI GenBank NM_001014166.2) and does not have homology with the human IL33 gene, and was chemically modified as follows:Modified Antisense Strand (5’ -^ 3):cPrpusUfscGfaAfugaaaCfgAfaGfuCfagsa (SEQ ID NO: 422)Modified Sense Strand (5’ 3):Tri-SM6.1-avb6-(TA14)-uscugacuuCfGfUfuucauucgaas(invAb) (SEQ ID NO: 423)

[0341] On Day 16, the test animals were sacrificed. From the test animals, bronchoalveolar lavage fluid (BALF) and whole lungs were collected and harvested.

[0342] The lung samples were processed for immunohistochemistry (IHC), and stained for IL33 and surfactant protein C (Spc). Treatment with rat-specific IL33 RNAi led to reductions of IL33 protein expression in alveolar type 2 (AT2) cells and endothelial cells in the rat lung inflammation in rat Altemaria disease model. IL33 was highly expressed in alveolar type 2 cells and endothelial cells in the rat lung. IL33 protein is localized in nuclei of alveolar type 2 (AT2) cells and endothelial cells in rat lung. Nuclear IL33 protein expression in Spc+ cells was significantly reduced with IL33 RNAi agent treatment. This suggests Tri-SM6.1-avb6 ligand when conjugated to IL33 specific RNAi agent enables effective and specific silencing of IL33 in AT2 cells. Silencing IL33 in rat further inhibits immune cell infiltration.Example 19. In vivo administration ofIL33 RNAi agents in rat.

[0343] IL33 RNAi agents were evaluated in vivo in rat. On Day 1 and Day 3, five (n=5) Sprague Dawley rats were administered either PBS, or IL33 RNAi agent (formulated in PBS at 5.0 mg / kg), via intratracheal (IT) administration via microsprayer, at 200 pL dose volume.

[0344] Dosing was in accordance with Table 42 below.

[0345] Table 42. RNAi Agent and Dosing for Example 19.

[0346] AC005889 includes a rat-specific sequence designed to target the rat IL33 transcript (NCBI GenBank NM_001014166.2) and does not have homology with the human IL33 gene, and was chemically modified as follows:Modified Antisense Strand (5’ -^ 3)cPrpusUfscgAfaugaaaCfgAfaGfucagsa (SEQ ID NO: 424)Modified Sense Strand (5’ 3)Tri-SM6.1-avb6-(TA14)-uscugacuuCfGfUfuucauucgaas(invAb) (SEQ ID NO: 425)

[0347] Rats were sacrificed on either Day 8, 15, 29, or 43, in accordance with Table 42 above. From the rats, whole lungs were collected for analysis.

[0348] From the collected mouse rat samples, IL33 mRNA transcript levels were quantified via qPCR, with rB2M as endogenous control gene, normalized to the saline Group rats that were sacrificed on the same day (Group 2 normalized to Group 1, Group 4 normalized to Group 3, Group 6 normalized to Group 5, and Group 8 normalized to Group 7). The data from the experiment are shown in the following Table 43.

[0349] Table 43. Average rIL33 mRNA transcript expression in rats of Example 19.

[0350] IL33 RNAi agent AC005889 achieved reduction in IL33 transcripts out to at least Day 43.Example 20. In vivo administration ofIL33 RNAi agents in rat.

[0351] IL33 RNAi agents were evaluated in vivo in rat. On Day 1 and Day 3, five (n=5) Sprague Dawley rats were administered either PBS, or IL33 RNAi agent (formulated in PBS at 2.5 mg / kg, 5.0 mg / kg, or 10 mg / kg), via intratracheal (IT) administration via microsprayer, at 200 pL dose volume.

[0352] Dosing was in accordance with Table 44 below.

[0353] Table 44. RNAi Agent and Dosing for Example 20.

[0354] AC005120 includes a rat-specific sequence designed to target the rat IL33 transcript (NCBI GenBank NM_001014166.2) and does not have homology with the human IL33 gene, and was chemically modified as follows:Modified Antisense Strand (5’ 3):cPrpusUfscGfaAfugaaaCfgAfaGfuCfagsa (SEQ ID NO: 422)Tri-SM6.1-avb6-(TA14)-uscugacuuCfGfUfuucauucgaas(invAb) (SEQ ID NO: 423)

[0355] AC005889 includes a rat-specific sequence designed to target the rat IL33 transcript (NCBI GenBank NM_001014166.2) and does not have homology with the human IL33 gene, and was chemically modified as follows:Modified Antisense Strand (5’ -^ 3):cPrpusUfscgAfaugaaaCfgAfaGfucagsa (SEQ ID NO: 424)Modified Sense Strand (5’ 3):Tri-SM6.1-avb6-(TA14)-uscugacuuCfGfUfuucauucgaas(invAb) (SEQ ID NO: 425)

[0356] Rats were sacrificed on Day 15. From the rats, whole lungs were collected for analysis.

[0357] From the collected rat lung samples, IL33 mRNA transcript levels were quantified via qPCR, with rB2M as endogenous control gene, normalized to the saline Group 1 rats dosed with saline. The data from the experiment are shown in the following Table 45.

[0358] Table 45. Average rIL33 mRNA transcript expression normalized to saline control in mice of Example 20.

[0359] IL33 RNAi agent AC005120 and AC005889 achieved reduction in IL33 transcripts out to at least Day 15. A dose-response was observed for both AC005120 and AC005889.

[0360] From the collected rat lung samples. IL33 protein levels were quantified via Jess assay, normalized to the saline Group 1 rats dosed with saline. The data from the experiment are shown in the following Table 46.

[0361] Table 46. Average rIL33 protein expression normalized to saline control in mice of Example 20.

[0362] IL33 RNAi agent AC005889 achieved reduction in IL33 protein out to at least Day 15. A dose-response was observed for AC005889.OTHER EMBODIMENTS

[0363] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

1. Claims:

1. An RNAi agent for inhibiting expression of an interleukin 33 gene, comprising:3.an antisense strand comprising at least 17 contiguous nucleotides differing by 0 or 1 nucleotides from any one of the sequences provided in Table 2 or Table 3; and a sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand.

2. The RNAi agent of claim 1, wherein the antisense strand comprises nucleotides 2-18 of any one of the sequences provided in Table 2 or Table 3.

3. The RNAi agent of claim 1 or claim 2, wherein the sense strand comprises a nucleotide sequence of at least 17 contiguous nucleotides differing by 0 or 1 nucleotides from any one of the sequences provided in Table 2 or Table 4, and wherein the sense strand has a region of at least 85% complementarity over the 17 contiguous nucleotides to the antisense strand.

4. The RNAi agent of any one of claims 1-3, wherein at least one nucleotide of the IL33 RNAi agent is a modified nucleotide or includes a modified intemucleoside linkage.

5. The RNAi agent of any one of claims 1-4, wherein all or substantially all of the nucleotides are modified nucleotides.

6. The RNAi agent of any one of claims 4-5, wherein the modified nucleotide is selected from the group consisting of 2'-O-methyl nucleotide, 2'-fluoro nucleotide, 2'-deoxy nucleotide. 2',3'-seco nucleotide mimic, locked nucleotide, 2’-F-arabino nucleotide, 2'- methoxy ethyl nucleotide, abasic nucleotide, ribitol, inverted nucleotide, inverted 2'-O- methyl nucleotide, inverted 2'-deoxy nucleotide, 2'-amino-modified nucleotide, 2'-alkyl- modified nucleotide, morpholino nucleotide, vinyl phosphonate-containing nucleotide, cyclopropyl phosphonate-containing nucleotide, and 3'-O-methyl nucleotide.

7. The RNAi agent of claim 5, wherein all or substantially all of the nucleotides are modified with 2'-O-methyl nucleotides, 2'-fluoro nucleotides, or combinations thereof.

8. The RNAi agent of any one of claims 1-7, wherein the antisense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 3.

9. The RNAi agent of any one of claims 1-8. wherein the sense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 4.

10. The RNAi agent of claim 1, wherein the antisense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 3 and the sense strandcomprises the nucleotide sequence of any one of the modified sequences provided in Table 4.

11. The RNAi agent of any one of claims 1-10, wherein the sense strand is between 18 and 30 nucleotides in length, and the antisense strand is between 18 and 30 nucleotides in length.

12. The RNAi agent of claim 11, wherein the sense strand and the antisense strand are each between 18 and 27 nucleotides in length.

13. The RNAi agent of claim 12, wherein the sense strand and the antisense strand are each between 18 and 24 nucleotides in length.

14. The RNAi agent of claim 13, wherein the sense strand and the antisense strand are each 21 nucleotides in length.

15. The RNAi agent of claim 14, wherein the RNAi agent has two blunt ends.

16. The RNAi agent of any one of claims 1-15, wherein the sense strand comprises one or two terminal caps.

17. The RNAi agent of any one of claims 1-16, wherein the sense strand comprises one or two inverted abasic residues.

18. The RNAi agent of claim 1, wherein the RNAi agent is comprised of a sense strand and an antisense strand that form a duplex having the structure of any one of the duplexes in Table 7A, Table 7B, Table 8, Table 9, or Table 10.

19. The RNAi agent of claim 18, wherein all or substantially all of the nucleotides are modified nucleotides.

20. The RNAi agent of claim 1, comprising an antisense strand that consists of, consists essentially of, or comprises a nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5' 3'):22.UAACAUCUUACCAUCAACAC (SEQ ID NO: ); or UAGAUGAUUGUCCUUUACAC (SEQ ID NO: ).

21. The RNAi agent of claim 20, wherein the sense strand consists of, consists essentially of, or comprises a nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5' -> 3'):24.GGUGUUGAUGGUAAGAUGUUA (SEQ ID NO: ); or GGUGUAAAGGAUAAUCAUCUA (SEQ ID NO:

25.

26.

22. The RNAi agent of claim 20 or 21, wherein all or substantially all of the nucleotides are modified nucleotides.

23. The RNAi agent of claim 1, comprising an antisense strand that comprises, consists of, or consists essentially of a modified nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5' -> 3'):28.cPrpusAfsacAfucuuacCfaUfcAfacacssc (SEQ ID NO: 244); or cPrpusAfsgaugauuGfuCfcUfuUfacacssc (SEQ ID NO: 252);29.wherein a represents 2'-O-methyl adenosine, c represents 2'-O-methyl cytidine, g represents 2'-O-methyl guanosine, and u represents 2'-O-methyl uridine; Af, represents 2'-fluoro adenosine, Cf represents 2'-fluoro cytidine, Gf represents 2'-fluoro guanosine, and Uf represents 2'-fluoro uridine; cPrpu represents a 5 ' -cyclopropyl phosphonate-2'-O-methyl uridine: s represents a phosphorothioate linkage; ss represents a phosphorodithioate linkage; and wherein all or substantially all of the nucleotides on the sense strand are modified nucleotides.

24. The RNAi agent of claim 1, wherein the sense strand comprises, consists of, or consists essentially of a modified nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5'31.

32. 3'):33.gsguguugaUfgGfuAfagauguua (SEQ ID NO: 285); or gsguguaaaGfGfAfuaaucaucua (SEQ ID NO: 282);34.wherein a represents 2'-O-methyl adenosine, c represents 2'-O-methyl cytidine, g represents 2'-O-methyl guanosine, and u represents 2'-O-methyl uridine; Af, represents 2'-fluoro adenosine. Cf represents 2'-fluoro cytidine, Gf represents 2'-fluoro guanosine, and Uf represents 2'-fluoro uridine; s represents a phosphorothioate linkage; and wherein all or substantially all of the nucleotides on the antisense strand are modified nucleotides.

25. The RNAi agent of any one of claims 20-24, wherein the sense strand further includes inverted abasic residues at the 3’ terminal end of the nucleotide sequence, at the 5’ end of the nucleotide sequence, or at both.

26. The RNAi agent of any one of claims 1-25, wherein the RNAi agent is linked to a targeting ligand.

27. The RNAi agent of claim 26, wherein the targeting ligand has affinity for a cell receptor expressed on an epithelial cell.

28. The RNAi agent of claim 27, wherein the targeting ligand comprises an integrin targeting ligand.

29. The RNAi agent of claim 28, wherein the integrin targeting ligand is an avP6 integrin targeting ligand.

30. The RNAi agent of claim 29, wherein the targeting ligand comprises the structure:

41.

42. thereof,43.wherein indicates the point of connection to the RNAi agent.

31. The RNAi agent of any one of claims 26-29, wherein the targeting ligand has a structure selected from the group consisting of:

45.

47.

49.

52.

54.

56.

58.

60.

62.

64.

65. wherein « indicates the point of connection to the RNAi agent.

32. The RNAi agent of claim 31, wherein RNAi agent is conjugated to a targeting ligand having the following structure:

67.

33. The RNAi agent of any one of claims 26-32, wherein the targeting ligand is conjugated to the sense strand.

34. The RNAi agent of claim 33, wherein the targeting ligand is conjugated to the 5’ terminal end of the sense strand.

35. The RNAi agent of any one of claims 1-34, wherein the RNAi agent is a pharmaceutically acceptable salt.

36. The RNAi agent of any one of claim 35, wherein the RNAi agent is a sodium salt.

37. A composition comprising the RNAi agent of any one of claims 1-36, wherein the composition further comprises a pharmaceutically acceptable excipient.

38. The composition of claim 37, further comprising a second RNAi agent capable of inhibiting the expression of interleukin 33 gene expression.

39. The composition of any one of claims 37-38, further comprising one or more additional therapeutics.

40. The composition of any one of claims 37-39, wherein the composition is formulated for administration by inhalation.

41. The composition of claim 40, wherein the composition is delivered by a metered-dose inhaler, jet nebulizer, vibrating mesh nebulizer, or soft mist inhaler.

42. The composition of any of claims 37-41, wherein the RNAi agent is a sodium salt.

43. The composition of any of claims 37-42, wherein the pharmaceutically acceptable excipient is water for injection.

44. The composition of any of claims 37-42, wherein the pharmaceutically acceptable excipient is a buffered saline solution.

45. A method for inhibiting expression of an IL33 gene in a cell, the method comprising introducing into a cell an effective amount of an RNAi agent of any one of claims 1-35 or the composition of any one of claims 37-44.

46. The method of claim 45. wherein the cell is within a subject.

47. The method of claim 46, wherein the subject is a human subject.

48. The method of any one of claims 45-47, wherein following the administration of the RNAi agent the interleukin 33 gene expression is inhibited by at least about 30%.

49. A method of treating one or more symptoms or diseases associated with enhanced or elevated IL33 cytokine activity levels, the method comprising administering to a human subject in need thereof a therapeutically effective amount of the composition of any one of claims 37-44.

50. The method of claim 49, wherein the disease is asthma, chronic obstructive pulmonary disease (COPD). autoimmune disorders, and bronchopulmonary dysplasia (BPD).

51. The method of claim 50, wherein the disease is allergic asthma.

52. The method of any one of claims 45-51, wherein the RNAi agent is administered at a deposited dose of about 0.01 mg / kg to about 5.0 mg / kg of body weight of the subject.

53. The method of any one of claims 45-52, wherein the RNAi agent is administered at a deposited dose of about 0.03 mg / kg to about 2.0 mg / kg of body weight of the subject.

54. The method of any of claims 45-53, wherein the RNAi agent is administered in two or more doses.

55. Use of the RNAi agent of any one of claims 1-36, for the treatment of a disease, disorder, or symptom that is mediated at least in part by IL33 cytokine activity and / or IL33 gene expression.

56. Use of the composition according to any one of claims 37-44, for the treatment of a disease, disorder, or symptom that is mediated at least in part by interleukin 33 cytokine activity and / or interleukin 33 gene expression.

57. Use of the composition according to any one of claims 37-44, for the manufacture of a medicament for treatment of a disease, disorder, or symptom that is mediated at least in part by interleukin 33 cytokine and / or interleukin 33 gene expression.

58. The use of any one of claims 55-57, wherein the disease is pulmonary inflammation.

59. A method of making an RNAi agent of any one of claims 1-36, comprising annealing a sense strand and an antisense strand to form a double-stranded ribonucleic acid molecule.

60. The method of claim 59, wherein the sense strand comprises a targeting ligand.

61. The method of claim 60, comprising conjugating a targeting ligand to the sense strand.

Citation Information

Patent Citations

  • Products for altering IL-33 activity and methods thereof

    US8119771B2

  • Alpha-v beta-6(ανβ6) integrin ligands for extrahepatic delivery

    WO2024129931A1