Methods for distinguishing asfv-infected and asfv-vaccinated animals

Abstract

The present invention relates to an in vitro diagnostic method for distinguishing an animal infected with African swine fever virus (ASFV) from an animal that has been vaccinated against ASFV using an immunogenic composition comprising an attenuated ASFV in which the EP153R gene and the EP402R gene have been inactivated and in which a region of the ASFV genome comprising the EP402R and EP153R genes is replaced with a heterologous gene.

Description

Technical Field

[0001] This invention relates to a method for distinguishing between animals infected with African swine fever virus and animals vaccinated with attenuated African swine fever virus. Background Technology

[0002] African swine fever (ASF) is a devastating hemorrhagic disease affecting pigs caused by the large double-stranded DNA virus African swine fever virus (ASFV). ASFV belongs to the African swine fever virus family (ASFV). Asfarviridae The only member of the family and primarily replicates in the cytoplasm of the cell. Highly virulent strains of ASFV can kill domestic pigs within approximately 5-14 days after infection, with a mortality rate approaching 100%.

[0003] ASFV can be found in ticks of the genus *Achnatherum* (*Achnatherum*). Ornithodoros Warthog (species) (which is considered a vector) Phacochoerus sp.), masked boar (bushpig, Potamocherus ASFV infects and replicates in ticks and soft ticks, but few clinical signs are observed in these species, and long-term persistent infection can be established. ASFV was first described after European settlers introduced pigs into areas where it was prevalent; therefore, ASFV is an example of a “newly emerging infection.” The disease is currently prevalent in many sub-Saharan countries and several regions in Europe and Southeast Asia. Vaccination is considered the most effective strategy and solution for disease control. However, no vaccine is currently available for ASF. In the past, some countries have achieved eradication through a variety of strategies, including large-scale culling on farms and increased biosecurity.

[0004] Although ASFV has resurfaced over the past few decades, it has been most evident in Georgia, where in 2007 the virus spread rapidly from the port city of Porti to the Caucasus region, the Russian Federation, and Eastern Europe, before spreading to Southeast Asia and the Pacific. Most recently, in January 2022, multiple re-emergences were reported in key areas including RF, Moldova, Ukraine, as well as northern Macedonia, Thailand, and Italy. These recent events highlight the extremely disturbing pattern of continuous ASFV transmission.

[0005] Pork is a major source of animal protein, accounting for over 35% of global meat consumption. Therefore, this disease poses a serious threat to food safety worldwide. It also impacts biodiversity and ecosystem balance, as it affects not only domesticated farm pigs but also wild boars, including native breeds.

[0006] Several vaccines under development are based on genetically modified attenuated ASFV viruses, which are typically obtained through gene mutations that affect viral virulence.

[0007] Currently, the use of biomarker vaccines is mandatory. After administration to the human population, the use of such vaccines allows for the differentiation between infected and vaccinated animals. Therefore, the strategic use of such vaccines, combined with identification testing (where biomarker detection is key), not only allows for the protection of vulnerable populations but also allows for a simple way to distinguish between vaccinated and infected individuals, which is crucial for control eradication programs and international commercial trade.

[0008] Therefore, for African swine fever, there is a need for a method that allows for differentiation between infected and vaccinated animals, namely the DIVA method. Summary of the Invention

[0009] The inventors developed the DIVA method to determine whether animals have been inoculated with an attenuated strain of ASFV in which the genes EP153R and EP402R have been inactivated.

[0010] Therefore, a first aspect of the present invention relates to an in vitro diagnostic method for distinguishing between animals infected with African swine fever virus (ASFV) and animals vaccinated against ASFV using an immunogenic composition containing attenuated ASFV, wherein the EP153R and EP402R genes in the attenuated ASFV have been inactivated, and regions of the ASFV genome containing the EP402R and EP153R genes have been replaced with heterologous genes, the method comprising: (i) Detecting the presence of a first biomarker and a second biomarker in a sample from the animal, wherein the first biomarker is selected from the group consisting of: - Antibodies against ASFV-specific antigens that are not EP402R or EP153R gene products, and - An ASFV gene or fragment thereof that is not the EP402R or EP153R gene. And the second biomarker is a “first ASFV vaccine biomarker” and / or a “second ASFV vaccine biomarker”, wherein the first ASFV vaccine biomarker is selected from the group consisting of: - Antibodies targeting the EP402R gene product or the EP153R gene product, and - The EP402R gene or a fragment thereof, or the EP153R gene or a fragment thereof. And the second ASFV vaccine biomarker mentioned therein is selected from the following group: - Antibodies specific to the heterologous gene product, or - The heterologous gene or a fragment thereof, and and (ii) Identify the animal as a) If at least one of the first biomarker and the second ASFV vaccine biomarker is detected, then the individual has been vaccinated, or b) If at least one of the first biomarkers is detected, and optionally the first ASFV vaccine biomarker is detected or the second ASFV vaccine biomarker is not detected, then the person has been infected.

[0011] Another aspect of the present invention relates to a kit comprising: (i) A reagent suitable for detecting a first biomarker, wherein the first biomarker is selected from the group consisting of: - Antibodies against ASFV-specific antigens that are not EP402R or EP153R gene products, and - ASFV genes or fragments thereof that are not EP402R or EP153R genes, and (ii) A reagent suitable for detecting a second biomarker, wherein the second biomarker is a “first ASFV vaccine biomarker” and / or a “second ASFV vaccine biomarker”, wherein the first ASFV vaccine biomarker is selected from the group consisting of: - Antibodies targeting the EP402R gene product or the EP153R gene product, and - The EP402R gene or a fragment thereof, or the EP153R gene or a fragment thereof. And the second ASFV vaccine biomarker mentioned therein is selected from the following group: - Antibodies specific to heterologous gene products, or - Heterologous genes or fragments thereof.

[0012] On the other hand, the kit according to the invention relates to the use in an in vitro diagnostic method for distinguishing between animals infected with African swine fever virus (ASFV) and animals vaccinated against ASFV using an immunogenic composition containing attenuated ASFV, wherein the EP153R and EP402R genes in the attenuated ASFV have been inactivated, and regions of the ASFV genome containing the EP402R and EP153R genes have been replaced with heterologous genes. Attached Figure Description

[0013] Figure 1 Analysis of EP153R protein expression. A) Analysis of purified protein by SDS-PAGE-silver staining, and B) Western blot using an anti-mouse Fc monoclonal antibody conjugated with peroxidase.

[0014] Figure 2Analysis of eGFP protein expression. A) Analysis of purified protein by SDS-PAGE-Coomassie staining, and B) Western blotting using an antihistamine monoclonal antibody and visualization with an anti-mouse antibody conjugated to alkaline phosphatase.

[0015] Figure 3 Immunogenicity analysis of pEP153R; pEP153R and an unrelated antigen expressed under the same conditions as pEP153R (“negative antigen”) were used as coating antigens. Indirect ELISA was performed using two positive sera and two negative sera, dpi: days post-infection.

[0016] Figure 4 Analysis of the immunogenicity of eGFP: eGFP and an unrelated antigen expressed under the same conditions (“negative antigen”) were used as coating antigens. Indirect ELISA was performed using two positive sera (16- and 35- dpi) and four negative sera (0 dpi and wild-type serum), dpi: 7 days post-infection.

[0017] Figure 5 Analysis of the potential of pEP153R and eGFP as DIVA antigens in domestic pigs (DP). Indirect ELISA against pEP153R, eGFP, and p72 (INgezim® PPA Compac). A. Antibody response in DP C17 inoculated with parental virus. B. Antibody response in DP C7 inoculated with Lv17 / WB / Rie1ΔEP153RΔEP402R. pEP153R cut-off: 0.3; eGFP cut-off: 0.6; INgezim® PPA Compac cut-off: 50%. Arrows indicate challenge time (Arm07).

[0018] Figure 6 Analysis of the potential of pEP153R and eGFP as DIVA antigens in wild boar (WB). Indirect ELISA against pEP153R, eGFP, and p72 (INgezim® PPA Compac). A. Antibody response in WB RA1 inoculated with parental virus. B. Antibody response in WB MU4 inoculated with Lv17 / WB / Rie1ΔEP153RΔEP402R. pEP153R cut-off: 0.3; eGFP cut-off: 0.6; INgezim® PPA Compac cut-off: 50%. Red arrows indicate challenge time (Arm07).

[0019] Figure 7Indirect ELISA was used to promptly investigate the antibody response to pEP153R. The assay was performed using serum from two animals: PW13 and PW14. INgezim® PPA Compac cut-off: 50%; pEP153R cut-off: 0.3%.

[0020] Figure 8 The immunogenicity of mCherry protein (expressed in a baculovirus system) was determined by indirect ELISA. The graph shows the mean and standard deviation (error bars) of the optical density (OD) values ​​from two replicates for each serum sample.

[0021] Detailed Implementation Plan The inventors designed the DIVA (Distinguishing Infected and Vaccinated Animals) test, which is based on the detection of the presence of wild-type ASFV-specific antigens and / or genes in animals and the presence of genetically modified live attenuated vaccine (LAV) ASFV-specific antigens and / or genes.

[0022] DIVA method and its kit Therefore, the method of the present invention begins here. The first aspect of the invention relates to an in vitro diagnostic method for distinguishing between animals infected with African swine fever virus (ASFV) and animals vaccinated against ASFV using an immunogenic composition containing attenuated ASFV, wherein the EP153R and EP402R genes in the attenuated ASFV have been inactivated, and regions of the ASFV genome containing the EP402R and EP153R genes have been replaced with heterologous genes. The method comprises: (i) Detecting the presence of a first biomarker and a second biomarker in a sample from the animal, wherein the first biomarker is selected from the group consisting of: - Antibodies against ASFV-specific antigens that are not EP402R or EP153R gene products, and - An ASFV gene or fragment thereof that is not the EP402R or EP153R gene. And the second biomarker is a “first ASFV vaccine biomarker” and / or a “second ASFV vaccine biomarker”, wherein the first ASFV vaccine biomarker is selected from the group consisting of: - Antibodies targeting the EP402R gene product or the EP153R gene product, and - The EP402R gene or a fragment thereof, or the EP153R gene or a fragment thereof. And the second ASFV vaccine biomarker mentioned therein is selected from the following group: - Antibodies specific to the heterologous gene product, or - The heterologous gene or a fragment thereof, and and (ii) Identify the animal as a) If at least one of the first biomarker and the second ASFV vaccine biomarker is detected, then the individual has been vaccinated, or b) If at least one of the first biomarkers is detected, and optionally the first ASFV vaccine biomarker is detected or the second ASFV vaccine biomarker is not detected, then the person has been infected.

[0023] As used herein, the term “in vitro” refers to a biological process or reaction performed using components of an organism that have been isolated from the organism’s usual biological environment, in order to allow for more detailed or convenient analysis of the whole organism than in an artificial environment (i.e., a laboratory).

[0024] The term "African swine fever virus" and its acronym "ASFV" as used in this article refer to the pathogen of African swine fever (ASF). ASFV is a large icosahedral double-stranded DNA virus with a linear genome containing at least 150 genes. The number of genes varies slightly between different viral isolates. ASFV is similar to other large DNA viruses, such as poxviruses, iridoviruses, and giant viruses. As with other viral hemorrhagic fevers, the primary target cells for replication are monocytes and macrophages. Based on sequence variations in the C-terminal region of the B646L gene encoding the major capsid protein p72, 24 ASFV genotypes (I-XXIV) have been identified. All ASFV p72 genotypes circulate in East and Southern Africa. Genotype I has been prevalent in West Africa and Sardinia and has historically been prevalent in Europe, South America, and the Caribbean. Genotype II was the cause of the devastating pandemic that broke out in Georgia in 2007 and affected Europe, Asia, and more recently the Americas (2021, Haiti and the Dominican Republic) and Oceania (2022, Papua New Guinea), while also experiencing an outbreak in East Africa. Genotype VIII is limited to four East African countries. In a particular embodiment of the method of the present invention, ASFV is genotype II ASFV.

[0025] As used herein, the term "animal" refers to a mammal, preferably a pig or wild boar. In one specific embodiment of the method of the invention, the animal is a pig or wild boar. The term "swine" as used herein refers to a domestic pig (domesticated pig), also known as a castrated pig or domestic pig when distinguished from other members of the genus *Sus*. The pig is an omnivorous, domesticated, materiate, hoofed mammal.

[0026] The term "wild boar" as used in this article refers to the genus *Holothuria* (…). Sus scrofaThe wild boar, also known as the common wild boar, Eurasian wild boar, or simply wild boar, is native to much of Eurasia and North Africa and has been introduced to the Americas and Oceania.

[0027] In the context of this invention, the term "immunogenic composition" refers to a composition that can elicit a cellular and / or humoral immune response in mammals but does not necessarily confer complete or partial immune protection against African swine fever. However, to avoid confusion, such immunogenic compositions can confer complete or partial protection against African swine fever in mammals, and this is preferred. Conversely, in the context of this invention, a "vaccine" does indeed confer complete or partial (but at least partial) immune protection against African swine fever in mammals.

[0028] As used herein, the terms "protection against African swine fever," "protective immunity," "functional immunity," and similar phrases refer to the response against African swine fever (virus) induced by administration of the recombinant ASFV of the present invention, resulting in fewer harmful effects than expected in non-immunized mammals already exposed to African swine fever (virus). That is, the severity of the harmful effects of ASFV infection is reduced in vaccinated mammals. In vaccinated mammals, infection can be reduced, mitigated, or possibly completely prevented. Where complete prevention of infection is intended herein, it is specifically stated. Where complete prevention is not stated, the term includes partial prevention.

[0029] As used in this article, the term "attenuated" refers to a virus whose virulence is impaired or absent in the target recipient (e.g., pigs or wild boars). The purpose of producing attenuated viruses is to generate viruses that do not produce infection symptoms or very mild infection symptoms, but which, when used as a vaccine, can still elicit an immune response, thus providing immunogenic protection when animals are infected with wild-type viruses. The term "wild-type" indicates that the virus is present in the field (at some points) and isolated from a natural host, such as domestic pigs, ticks, or warthogs.

[0030] The level of viral attenuation can be determined by a hemoadsorption assay. As used herein, "hemoadsorption" refers to the phenomenon where ASFV-infected cells adsorb red blood cells (erythrocytes) onto their surface. The degree of ASFV-induced hemoadsorption can be measured using, for example, the hemoadsorption assay described in De León, P. et al. (2013, Virus Res. 173, 168-179). For instance, cells can be transfected with proteins or infected with ASFV, followed by the addition of erythrocytes, and the degree of hemoadsorption can be detected by imaging.

[0031] The attenuated ASFV involved in the method of the present invention has inactivated EP153R and EP402R genes.

[0032] As used herein, the term "EP153R gene" refers to the ASFV gene whose product downregulates MHC-I expression by weakening an appropriate conformation or presenting it to the latter's plasma membrane (also known as lectin-like protein EP153R). The ASFV EP153R protein (pEP153R) is a type II transmembrane protein with 159 amino acids and multiple putative sites for post-translational modifications: N-glycosylation, myristylation, and phosphorylation. pEP153R is involved in viral hemosorption and is highly variable between genotypes. In one specific embodiment of the method of the invention, the EP153R gene product has the sequence according to SEQ ID NO: 1. In another specific embodiment of the method of the invention, the EP153R gene has the sequence according to SEQ ID NO: 2.

[0033] As used herein, the term "EP402R gene" refers to the ASFV gene encoding the CD2v protein, a glycoprotein with a relative molecular weight of approximately 105 kDa, responsible for the in vitro blood-adsorption phenotype of ASFV infection of cells. This ASFV protein is a viral homologue (CD2v) of the CD2 protein, a surface adhesion receptor on cellular T lymphocytes. Based on sequence data and hydrophilicity, the ASFV CD2v protein resembles a typical (CD2) III transmembrane protein. Typically, the full-length ASFV CD2v protein contains four distinct parts: (i) a hydrophobic leader region on the N-terminal side of the protein, (ii) a hydrophilic extracellular domain containing multiple potential N-linked glycosylation sites, (iii) a hydrophobic fragment of amino acids serving as the transmembrane domain, and (iv) a C-terminal hydrophilic cytoplasmic domain containing numerous incomplete repeats of a typical hexapeptide (PPPKPC). In a specific embodiment of the method of the present invention, the EP402R gene product has the sequence according to SEQ ID NO: 3. In another specific embodiment of the method of the present invention, the EP402R gene has the sequence according to SEQ ID NO: 4.

[0034] As used herein, the term "inactivated" refers to a gene whose sequence, or a sequence related to its expression or regulation, has been modified to not express a product or to express a nonfunctional product. Gene inactivation can be achieved by several methods well known to those skilled in the art, such as random mutagenesis via transposon insertion and UV irradiation, as well as targeted mutagenesis with homologous recombination and CRISP / Cas9 technology (see the Examples section). Both of these techniques allow for gene inactivation by inserting additional nucleotide sequences into the coding sequence of the gene, or conversely, by deleting a segment or all of the gene. In both cases, the result can be nonfunctionality of the gene or the absence of transcription, thus lacking a gene product.

[0035] In the method of the present invention, the inactivating gene of the ASFV strain is replaced by a "heterologous gene," a term referring to a gene that is not naturally present in ASFV. Therefore, in a specific embodiment of the method of the present invention, the heterologous gene is a reporter gene.

[0036] The term "reporter gene" refers to a polynucleotide that encodes a molecule that can be easily detected, either directly or through its effect on the host cell (phenotype). Exemplary reporter genes encode enzymes such as the products of the ADE2 or ADE3 genes, β-galactosidase and URA3, luminescent or fluorescent proteins such as green fluorescent protein (GFP) and its variants, antigenic epitopes (e.g., Glu-tags), mRNAs with different sequences, etc.

[0037] In another specific embodiment of the method of the present invention, the heterologous gene is a fluorescent protein selected from the group consisting of: GFP (enhanced GFP), blue fluorescent protein (BFP), cyan fluorescent protein (CFP), yellow fluorescent protein (YFP), Venus, mOrange, dTomato, DsRed, red fluorescent protein (RFP), and mCherry. In a more specific embodiment of the method of the present invention, the heterologous gene is eGFP.

[0038] Step (i) The first step of the method of the present invention involves detecting the presence of genes or their products derived from ASFV and heterologous to ASFV in a sample.

[0039] As used herein, the term "sample" refers to a small amount of biological material isolated from an organism (preferably an animal) that represents the whole, i.e., whose characteristics are identical to those of the organism from which the sample was obtained. In a particular embodiment of the method of the invention, the sample is a biological fluid or tissue sample. Methods for obtaining said samples are well known in the art, and those skilled in the art can collect said samples effortlessly.

[0040] As used herein, the term "biofluid" refers to any fluid that can be obtained from an animal, such as blood, saliva, urine, milk, gravy, feces, sweat, and chorionic fluid. In one specific embodiment of the method of the present invention, the biofluid is selected from the group consisting of urine, blood, plasma, serum, serum derivatives, bile, sputum, saliva, sweat, amniotic fluid, milk, and cerebrospinal fluid (CSF). In one specific embodiment of the method of the present invention, the sample is a product derived from blood. Examples of products derived from blood are serum, plasma, red blood cells, etc. In another specific embodiment, the sample is serum or plasma.

[0041] As used herein, the term "tissue sample" refers to any tissue sample that can be obtained from an animal, such as, but not limited to, lung, bone, muscle, brain, and heart tissue. Tissue samples contain undigested cells that are presented in large clusters.

[0042] The term "marker" refers to a molecule that is quantitatively or qualitatively related to the presence of a biological phenomenon. Examples of "markers" are proteins, metabolites, and byproducts, whether directly or indirectly related to the underlying mechanisms of a disease.

[0043] Step (i) of the method of the present invention depends on detecting a first marker and a second marker.

[0044] The first biomarker of the method of the present invention may be selected from the group consisting of: antibodies against ASFV-specific antigens that are not EP402R gene products or EP153R gene products, and ASFV genes or fragments thereof that are not EP402R or EP153R genes.

[0045] As used herein, the term "ASFV-specific antigen" refers to a molecule or molecular structure, preferably a protein, that belongs to ASFV and can specifically bind to antibodies present in a host infected with ASFV. In a particular embodiment of the method of the present invention, the ASFV-specific antigen that is not the EP402R gene product or the A238L gene product is a structural ASFV protein selected from pp220, pp62, p72, p54, p30, and CP312R.

[0046] As used herein, the term "antibody" refers to a glycoprotein that exhibits specific binding activity against a particular protein (called an "antigen"). The term "antibody" includes fully monoclonal or polyclonal antibodies, or fragments thereof, and includes human antibodies, humanized antibodies, chimeric antibodies, and antibodies of non-human origin. A "monoclonal antibody" is a homogeneous, highly specific group of antibodies targeting a single site or antigenic determinant. A "polyclonal antibody" includes heterologous groups of antibodies targeting different antigenic determinants.

[0047] As used herein, antibodies suitable for the methods of this invention include not only full-length antibodies (e.g., IgG), but also antigen-binding fragments thereof, such as Fab, Fab', F(ab')2, Fv fragments, human antibodies, humanized antibodies, chimeric antibodies, non-human antibodies, recombinant antibodies, and polypeptides derived from immunoglobulins produced through genetic engineering, such as single-chain Fv (scFv), dimer antibodies, heavy chains or fragments thereof, light chains or fragments thereof, VH or dimers thereof, VL or dimers thereof, Fv fragments stabilized by disulfide bridges (dsFv), molecules (Ab) having single-chain variable region domains, small antibodies, scFv-Fc and fusion proteins containing antibodies, or any other modified conformation of immunoglobulin molecules containing antigen recognition sites of desired specificity. Antibody fragments may refer to antigen-binding fragments. Antibodies include any type of antibody, i.e., IgA, IgD, IgE, IgG (or its subclasses), and IgM, and antibodies need not be of any particular type.

[0048] The term "gene" refers to a nucleic acid (e.g., DNA or RNA) sequence containing the coding sequence necessary to produce RNA or a polypeptide or its precursor. A functional polypeptide can be encoded by the full-length coding sequence or any portion of the coding sequence, as long as the desired activity or functional property of the polypeptide (e.g., enzyme activity, ligand binding, signal transduction, etc.) is preserved. When used to refer to a gene, the term "fragment" refers to a segment of that gene. The size of a fragment can range from a few nucleotides to the entire gene sequence minus one nucleotide, provided that the sequence of the fragment allows for identification of the specific gene involved.

[0049] In a particular embodiment of the method of the present invention, the antibody against an ASFV-specific antigen that is not an EP402R gene product or an EP153R gene product is an anti-p72 antibody, an anti-CP312 antibody, or an antibody against a p30 gene product, or the ASFV gene that is not an EP402R gene or an EP153R gene is a p72 gene, a CP312 gene, or a p30 gene.

[0050] As used in this article, the term "p72 gene" is interchangeable with the term "B646L gene" because both terms refer to the gene that encodes the p72 protein.

[0051] The second marker in step (i) of the method of the present invention is a "first ASFV vaccine marker" and / or a "second ASFV vaccine marker".

[0052] The first ASFV vaccine biomarker is selected from the group consisting of: antibodies against the EP402R gene product or against the EP153R gene product, and the EP402R gene or a fragment thereof or the EP153R gene or a fragment thereof. In a particular embodiment of the method of the present invention, the first ASFV vaccine biomarker is an anti-EP153R antibody, an anti-EP402R antibody, the EP153R gene or a fragment thereof, or the EP402R gene or a fragment thereof.

[0053] In another specific embodiment of the method of the present invention, the anti-EP153R antibody is specific to EP153R as defined in SEQ ID NO: 1, wherein the EP153R gene is defined as in SEQ ID NO: 2, and the anti-EP402R antibody is specific to EP402R as defined in SEQ ID NO: 3, wherein the EP402R gene is defined as in SEQ ID NO: 4.

[0054] The second ASFV vaccine biomarker is selected from the group consisting of antibodies that are specific to the heterologous gene product, or the heterologous gene or a fragment thereof.

[0055] The method of the present invention allows for the combination of different types of markers between a first marker and a second marker.

[0056] Therefore, in a specific embodiment, the first and second biomarkers are genes or gene fragments. Gene detection is well known in the art and can be accomplished by several methods for detecting nucleotide sequences, primarily based on polymerase chain reaction (PCR), such as Q-PCR, RT-PCR, sequencing, FISH, etc. In another specific embodiment of the method of the present invention, the detection of the first and second biomarkers is performed by polymerase chain reaction (PCR), preferably real-time PCR.

[0057] As used herein, the term "polymerase chain reaction (PCR)" refers to a biochemical technique in molecular biology used to amplify a single or several copies of a DNA fragment to several orders of magnitude greater, producing thousands to millions of copies of a specific DNA sequence. The protocols followed for performing PCR are well-known in the art, and commercial kits containing the materials necessary for such amplification are currently available. Similarly, conditions such as temperature, time, reagent concentration, and the number of PCR cycles will depend on the DNA polymerase used in the amplification reaction, the specificity of the primers, etc. As used herein, the term "real-time PCR" refers to a reaction that is essentially conventional PCR, in which the amplification equipment (called a thermal cycler) incorporates a fluorescence detection system based on the use of a specific molecule. Fluorescence can be used to quantify the number of molecules being amplified or to quantify the amplification level relative to a reference curve (semi-quantitative). Quantification is performed by fluorescence measurements taken during PCR cycles (the term "real-time"). Fluorescence increases proportionally with the amount of PCR product. At the end of a run (consisting of several cycles), quantification is performed by the fluorescence signal obtained during the exponential phase of PCR. Accurate quantification is only possible during the exponential phase of PCR (which requires several cycles in a single run), as optimal reaction conditions prevail during this phase. For detection, dyes such as ethidium bromide, SYBR Green I, and FRET probes or so-called dual-dye oligomers (also known as TaqMan probes) can be used.

[0058] In another specific embodiment of the method of the present invention, each PCR fragment is detected using a specific TaqMan probe.

[0059] As used herein, the term "probe" refers to a nucleic acid that specifically binds to a target molecule. Probes typically bind to or are capable of binding to a label. A label is a detectable chemical moiety. Typical markers include dyes, radioactive isotopes, luminescent and chemiluminescent components, fluorophores, enzymes, precipitants, amplified sequences, etc. The specificity of hybridization depends on conditions such as the base pair composition of the nucleotides, as well as the temperature and salt concentration of the reaction. These conditions are readily discernible to those skilled in the art using routine experiments.

[0060] As used herein, the term "TaqMan probe" refers to a modified oligonucleotide in which a fluorescent substance (fluorophore) serving as both a reporter and a quencher is attached to both ends. Specifically, FAM can be used as a reporter and TAMRA can be used as a quencher, but is not limited thereto.

[0061] In one specific embodiment of the method of the present invention, the TaqMan probe comprises a fluorophore selected from the following: - 3',6'-Dihydroxy-1-oxospiro[2-benzofuran-3,9'-xanthon]-5-carboxylic acid (6-FAM); - [2',4,4',5',7,7'-hexachloro-6-[6-[2-cyanoethoxy-[di(prop-2-yl)amino]phosphoalkyl]oxohexylcarbamoyl]-6'-(2,2-dimethylpropionyloxy)-3-oxospiro[2-benzofuran-1,9'-xanthones]-3'-yl]2,2-dimethylpropionate (HEX); - 4',5'-Dichloro-2',7'-Dimethoxy-6-carboxyfluorescein (JOE); - (2Z)-2-[(3,6-dimethyl-2-phenylpyrimidin-3-onthiol-4-yl)methylene]-1-ethylquinoline, chloride (Cy3, Cy5); - (3R,4S,5S,6R,7R,9R,11S,12R,13S,14R)-6-[(2S,3R,4S,6R)-4-(dimethylamino)-3-hydroxy-6-methyloxacyclohexane-2-yl]oxy-14-ethyl-7,12,13-trihydroxy-4-[(2R,4R,5S,6S)-5-hydroxy-4-methoxy-4,6-dimethyloxacyclohexane-2-yl]oxy-10-(2-methoxyethoxymethoxyamino)-3,5,7,9,11,13-hexamethyloxacyclotetradecane-2-one (ROX); - Chlorosulfonyl-2-(3-oxa-23-aza-9-azaheptacyclo[17.7.1.15,9.02,17.04,15.023,27.013,28]octadec-1(27),2(17),4,9(28),13,15,18-hepten-16-yl)benzenesulfonate (TexasRed); - 2-(7-ethyl-3,3,8,8,10-pentamethyl-7-aza-21-azahexacyclo[15.7.1.02,15.04,13.06,11.021,25]pentadecan-1,4(13),5,11,14,16,18,21(25)-octen-14-yl)-N-methyl-N-(4-oxopentyl)benzamide (ATTON 647N); - (2,5-dioxopyrrolidone-1-yl)4',5'-dichloro-3',6'-dihydroxy-2',7'-dimethoxy-1-oxospiro[2-benzofuran-3,9'-xanthon]-5-carboxylic acid ester (6-JOE); - (2S,4R)-N-[(1S)-2-methyl-1-[(2R,3R,4S,5R,6R)-3,4,5-trihydroxy-6-methylthiooxacyclopropane-2-yl]propyl]-4-propylpiperidine-2-carboxamide (VIC); and - (Tetrachlorofluorescein): 4,5,6,7-Tetrachloro-3',6'-dihydroxyspiro[2-benzofuran-3,9'-xanthon]-1-one (TET).

[0062] In a particular embodiment of the method of the present invention, the TaqMan probe comprises a quencher molecule selected from the following: - N-[2-[[(E)-3-[1-[(2R,4S,5R)-5-[[bis(4-methoxyphenyl)-phenylmethoxy]methyl]-4-[2-cyanoethoxy-[di(propyl-2-yl)amino]phosphoalkyl]oxacyclopentan-2-yl]-2,4-dioxopyrimidin-5-yl]prop-2-enoyl]amino]ethyl]-6-[[7-[[2,5-dimethoxy-4-[(4-nitrophenyl)diazeninyl]phenyl]diazeninyl]-1-azatricyclo[7.3.1.05,13]tetrazol-5(13),6,8-trien-6-yl]oxy]hexamamide (BBQ650); - 2-[3-(dimethylamino)-6-dimethylazacyclopropane-9-yl]benzoate (TAMRA); - (2S)-2-[4-(3,4-dimethylphenyl)-2-methylquinolin-3-yl]-2-[(2-methylprop-2-yl)oxy]acetic acid (TQ2); - 5-Phenylenylquinazoline-2,4-diamine (TQ3); and - 2,5-bis(2-methyl-2-propyl)-1,4-benzenediol (BHQ-1 and 2).

[0063] PCR reactions can be used to detect a single sequence region (“locus”) or more than one single region, wherein primers and probes for two or more nucleic acid regions are used. Therefore, in a particular embodiment of the method of the present invention, the PCR is multiplex PCR, wherein the first biomarker and the second biomarker are detected in the same reaction.

[0064] In this invention, the term "multiplex PCR" refers to a variant of the polymerase reaction chain in which several loci are amplified in a single reaction.

[0065] In a specific embodiment of the method of the present invention: - The first biomarker is the ASFV p72 gene, and the PCR was performed using the forward primer of SEQ ID NO: 5 and the reverse primer of SEQ ID NO: 6. - The first ASFV vaccine biomarker is the EP153R gene, and the PCR is performed using the forward primer of SEQ ID NO: 8 and the reverse primer of SEQ ID NO: 9, and / or - The second ASFV vaccine biomarker is the eGFP gene, and the PCR is performed using the forward primer of SEQ ID NO: 11 and the reverse primer of SEQ ID NO: 12.

[0066] SEQ ID NO: 5 - CCCAGGRGATAAAATGACTG SEQ ID NO: 6 - CACTRGTTCCCTCCACCGATA SEQ ID NO: 8 - TTGGAACTAACATCTTAAGCCTT SEQ ID NO: 9 - ATATCCAACCCAATCTTTAGGG SEQ ID NO: 11 - CATCGACTTCAAGGAGGAC SEQ ID NO: 12-GCCATGATATAGACGTTGTGG As used herein, the term "primer" refers to a nucleic acid molecule containing a 3' terminal -OH group, which, upon hybridization with a complementary nucleic acid sequence, can be extended, for example, via an enzymatic nucleic acid replication reaction. Upper and lower limits for primer length are determined empirically. Primers described herein can be either forward or reverse primers. As used herein, the term "reverse primer" refers to a primer that initiates the antisense strand of a DNA sequence to allow polymerase to extend along the complementary strand of the DNA sequence in one direction. As used herein, the term "forward primer" refers to a primer that initiates the sense strand of a DNA sequence to allow polymerase to extend along one strand of the DNA sequence in one direction.

[0067] In a specific embodiment of the method of the present invention, a TaqMan probe containing the sequence defined in SEQ ID NO: 7 is used to detect the p72 gene PCR fragment, a TaqMan probe containing the sequence defined in SEQ ID NO: 10 is used to detect the EP153R gene PCR fragment, and / or a TaqMan probe containing the sequence defined in SEQ ID NO: 13 is used to detect the eGFP gene PCR fragment.

[0068] As previously described, TaqMan probes can be labeled to allow direct detection during PCR reactions. In specific embodiments, TaqMan probes specific to the p72 gene PCR fragment are labeled with 6-FAM, TaqMan probes specific to the EP153R gene PCR fragment are labeled with JOE, and / or TaqMan probes specific to the eGFP gene PCR fragment are labeled with Cy5. In another specific embodiment, the TaqMan probes specific to the p72 gene PCR fragment contain BHQ1 as a quencher, the TaqMan probes specific to the EP153R gene PCR fragment contain BHQ1 as a quencher, and / or the TaqMan probes specific to the eGFP gene PCR fragment contain BBQ as a quencher.

[0069] In another specific embodiment, the reagent for detecting the first biomarker comprises a primer pair having the sequences of SEQ ID NO: 5 and 6 and a TaqMan probe having the sequence 6FAM-TCCTGGCCRACCAAGTGCTT-BHQ1 (SEQ ID NO: 7), and the reagent for detecting the first ASFV vaccine biomarker comprises a primer pair having the sequences of SEQ ID NO: 8 and 9 and a TaqMan probe having the sequence JOE. The TaqMan probe of sequence -AGGAG+AGATTAATAAA+C+CAATA+T+GTTACC-BHQ1 (SEQ ID NO: 10) and the reagent for detecting the second ASFV vaccine biomarker comprise a primer pair having the sequences of SEQ ID NO: 11 and 12 and a TaqMan probe having the sequence Cy5-TGTAGTTGTACTCCAGCTTGTGCC-BBQ (SEQ ID NO: 13), wherein R represents A or G and + represents LNA nucleotides.

[0070] As used herein, the term "LNA nucleotide" refers to a modified RNA nucleotide. LNA nucleotides are locked nucleic acids. The ribose moiety of an LNA nucleotide can be modified with an additional bridge connecting the 2' oxygen and 4' carbon. This bridge locks the ribose in a 3'-inner (north) conformation, which is commonly found in A-type duplexes. LNA nucleotides can hybridize with DNA or RNA residues in oligonucleotides. LNA nucleotides hybridize with DNA or RNA. Oligomers containing LNA nucleotides are chemically synthesized and commercially available. The locked ribose conformation enhances base stacking and backbone pre-organization. The presence of LNA nucleotides significantly increases the hybridization properties (melting temperature) of oligonucleotides.

[0071] In a specific embodiment of the method of the present invention, the first and second markers are antibodies.

[0072] Several methods for detecting antibodies are known in the art, commonly referred to as immunoassays. In a specific embodiment of the method of the present invention, the detection of the first and second biomarkers is performed by an immunoassay.

[0073] As used herein, the term "immunoassay" includes any immunoassay technique based on the formation or use of immune complexes, i.e., immune complexes generated by the conjugation of antibodies and antigens, serving as a quantitative reference for measuring an analyte (the substance being examined), which may be an antibody or an antigen, using molecules as markers for measurement, which generate a detectable signal in response to specific binding.

[0074] Immunoassay techniques applicable to the context of this invention include Western blotting or transfer, ELISA (enzyme-linked immunosorbent assay), RIA (radioimmunoassay), competitive ELISA (competitive enzyme immunoassay), DAS-ELISA (double antibody sandwich ELISA), chemiluminescent immunoassay (CLIA) (which combines chemiluminescence technology with immunochemical reactions), lateral flow analysis in dual recognition (DR) (also known as immunochromatography, rapid testing, or field testing), indirect or competitive forms of protein arrays in dual recognition (DR), indirect or competitive forms of immunocytochemistry and immunohistochemistry, techniques based on the use of protein biochips or microarrays (which include specific antibodies), or assays based on colloidal precipitation, such as test strips. In one specific embodiment of the method of this invention, the immunoassay includes capturing an antibody against the EP153R gene product, and said capture is performed using the EP153R gene product or a fragment thereof.

[0075] In another specific embodiment, the immunoassay is an indirect ELISA (also known as a sandwich immunoassay), in which the antibody is captured using the EP153R gene product or a fragment thereof, and the captured antibody is detected using an antibody specific to porcine antibodies.

[0076] As used herein, the term "sandwich immunoassay" or "sandwich assay" refers to an assay that detects an antigen using a pair of antibodies (e.g., antibody 'A' and antibody 'B'), each targeting a portion of the antigen. For example, antibody 'A' is reportedly covalently or non-covalently labeled with a molecule (e.g., a molecule that allows electrochemiluminescence or fluorescence). An example of non-covalent labeling of antibody 'A' would be a secondary labeled antibody that allows binding to antibody 'A'. Antibody 'B' is directly attached (or allowed to be indirectly attached) to a solid support phase, such as an assay plate, beads, magnet, or electrode. Detection techniques suitable for sandwich immunoassays include electrochemiluminescence, chemiluminescence, and fluorescent chemiluminescence.

[0077] In one specific embodiment of the method of the present invention, the immunoassay includes capturing the antibody using an immobilized antigen that can be specifically bound by the antibody. Examples of techniques using immobilized antigens are ELISA-based techniques, such as direct ELISA, sandwich ELISA, competitive ELISA, and dual recognition (DR) ELISA.

[0078] As used herein, the term “enzyme-linked immunosorbent assay” or its acronym “ELISA” refers to a commonly used analytical biochemical assay that uses a solid-phase type of enzyme immunoassay (EIA) to detect the presence of a ligand (typically a protein) in a liquid sample using an antibody against the protein to be tested. Performing an ELISA involves at least one antibody specific to a particular antigen. A sample containing an unknown amount of antigen is immobilized nonspecifically (by adsorption to a surface) or specifically (by capture in a “sandwich” ELISA by another antibody specific to the same antigen) on a solid support (typically a polystyrene microtiter plate). After immobilization of the antigen, a detection antibody is added, forming a complex with the antigen. The detection antibody can be covalently linked to an enzyme, or it can be detected by biobinding a second antibody linked to the enzyme. Several enzyme biomarkers can be used in ELISA, allowing the measurement of the assay result at the completion of the assay. The most commonly used, but not limited to, is OPD (o-phenylenediamine dihydrochloride), which turns amber to detect HRP (horseradish peroxidase) and is often used as a conjugated protein; TMB (3,3',5,5'-tetramethylbenzidine), which turns blue when detecting HRP and yellow upon the addition of sulfuric acid or phosphoric acid; ABTS (2,2'-diazobis[3-ethylbenzothiazoline-6-sulfonic acid]-diammonium salt), which turns green when detecting HRP; PNPP (disodium p-nitrophenyl phosphate), which turns yellow when detecting alkaline phosphatase; and ONPG (o-nitrophenyl-β-D-galactoside), which turns yellow when detecting β-galactoside (b-Gal).

[0079] In the first step of the method of the present invention, the selection of the first and second markers can change the sample to be used. Therefore, in a particular embodiment of the method of the present invention, if the first and second markers are antibodies, the sample is a serum sample, or if the first and second markers are genes or gene fragments, the sample is a blood sample.

[0080] Step (ii) Step (ii) of the method of the present invention is to determine whether the animal is infected with a wild-type ASFV strain or has been vaccinated.

[0081] To identify vaccinated animals, at least one first biomarker and one second ASFV vaccine biomarker must be detected. Furthermore, vaccination can be confirmed by further verifying the absence of the first ASFV vaccine biomarker. Therefore, in one particular embodiment, the identification of the animal as vaccinated is further confirmed by detecting the first ASFV vaccine biomarker, wherein if the biomarker is not detected, the animal is confirmed as vaccinated.

[0082] To identify infected animals, at least one first biomarker is detected, and optionally a first ASFV vaccine biomarker is detected or a second ASFV vaccine biomarker is not detected. Furthermore, the identification can be further improved by determining whether the animal is infected with a genotype II ASFV strain or a non-genotype II ASFV strain. In one particular embodiment, the identification of the animal's infection is further confirmed by detecting the first ASFV vaccine biomarker, wherein the first ASFV vaccine biomarker is a genotype II specific biomarker, wherein if the biomarker is detected, the animal is identified as being infected with a genotype II ASFV strain, or if the biomarker is not detected, the animal is identified as being infected with an ASFV strain of a genotype other than genotype II.

[0083] As used herein, the term “genotype II specific marker” refers to an antibody against the EP402R gene product or the EP153R gene product, or the EP402R gene or a fragment thereof, or the EP153R gene or a fragment thereof, wherein detection of said antibody, gene or fragment thereof indicates that the ASFV strain present in the detected animal sample belongs to genotype II.

[0084] The fact that an animal has been vaccinated does not prevent it from being exposed to ASFV and thus infected. Therefore, in a particular embodiment of the method of the present invention, if the first marker, the first ASFV vaccine marker, and the second ASFV vaccine marker are detected, the animal is identified as having been vaccinated and infected with the ASFV strain.

[0085] The method of the present invention does not include detecting ASFV strains in which certain genes are inactivated. Therefore, in a specific embodiment of the method of the present invention, the method does not include detecting antibodies against the DP148R, 9GL / B119L, MGF_360-12L, MGF-13L, and MGF_360-14L gene products in the sample, and / or the method does not include detecting the presence of the DP148R, 9GL / B119L, MGF_360-12L, MGF-13L, and MGF_360-14L genes or fragments thereof in the sample.

[0086] As used herein, the term "DP148R" refers to a gene of unknown function located between positions 183187 and 184012 of the genome of the ASFV Georgia 2007 / 1 strain (GenBank accession number NC044959, version 2, December 20, 2020). It is known that deletion of this gene does not affect viral replication, but it does affect viral infection.

[0087] As used herein, the term "9GL / B119L" refers to the gene encoding a FAD-linked thiol oxidase located between positions 95936 and 96295 of the genome of the ASFV Georgia 2007 / 1 strain. It is known that deletion of this gene does not affect virion maturation, viral growth in macrophages, or viral virulence in pigs.

[0088] As used herein, the terms "MGF_360-12L", "MGF_360-13L", and "MGF_360-14L" refer to genes present in the polygenic family 360, whose functions can affect the host's immune response mechanisms and are host-specific. The genes MGF_360-12L, MGF_360-13L, and MGF_360-14L are located between positions 30355 and 33887 of the ASFV Georgia 2007 / 1 strain genome. The reagent kit of the present invention The reagents required to perform the methods of the present invention can be wholly or partially formed into a kit. Therefore, another aspect of the present invention relates to a kit, which, from this point onward, comprises: (iii) A reagent suitable for detecting a first marker, wherein the first marker is selected from the group consisting of: - Antibodies against ASFV-specific antigens that are not EP402R or EP153R gene products, and - ASFV genes or fragments thereof that are not EP402R or EP153R genes, and (iv) A reagent suitable for detecting a second biomarker, wherein the second biomarker is a “first ASFV vaccine biomarker” and / or a “second ASFV vaccine biomarker”, wherein the first ASFV vaccine biomarker is selected from the group consisting of: - Antibodies targeting the EP402R gene product or the EP153R gene product, and - The EP402R gene or a fragment thereof, or the EP153R gene or a fragment thereof. And the second ASFV vaccine biomarker mentioned therein is selected from the following group: - Antibodies specific to heterologous gene products, or - Heterologous genes or fragments thereof.

[0089] All previous definitions and embodiments described with respect to the preceding aspects are equally valid for the present aspects and their implementations.

[0090] In the context of this invention, "kit" should be understood as a product of different reagents used to perform the methods described herein, whether for detection with antibodies / antigens or for detection with nucleotide sequencing techniques such as PCR using primers and probes, wherein the different reagents are packaged together to allow for transport and storage. However, if the kit as defined in this invention does not contain the reagents necessary to put the methods of this invention into practice, such reagents are commercially available and can be found as part of the kit. Suitable materials for packaging the kit components include, but are not limited to, glass, plastics (polyethylene, polypropylene, polycarbonate, etc.), bottles, vials, paper, pouches, etc. The kit may additionally include instructions for using the different components in the kit. The instructions may be in printed format or on an electronic device capable of storing the instructions so that they are human-readable, such as electronic storage media (disks, magnetic tapes, etc.), optical devices (CD-ROMs, DVDs, USBs), etc. The medium may additionally or optionally include an Internet address providing the instructions.

[0091] In one specific embodiment of the kit of the present invention, the first biomarker is an antibody against an ASFV-specific antigen that is not the product of the EP402R gene or the EP153R gene; in this case, the reagent is an ASFV-specific antigen.

[0092] In a more specific embodiment of the kit of the present invention, the first marker is an ASFV gene or a fragment thereof that is not the EP402R gene or the EP153R gene, and the reagent is a primer pair and / or probe that is specific to the gene or gene fragment.

[0093] In another specific embodiment of the kit of the present invention, if the second biomarker is an antibody against the EP402R gene product, then the reagent is the EP402R gene product or an immunogenic fragment thereof, and if the second biomarker is an antibody against the EP153R gene product, then the reagent is the EP153R gene product or an immunogenic fragment thereof.

[0094] In another specific embodiment of the kit of the present invention, if the second marker is the EP402R gene or a fragment thereof, the reagent is a primer or probe specific to the EP402R gene product or a fragment thereof, and wherein if the second marker is the EP153R gene or a fragment thereof, the reagent is a primer or probe specific to the EP153R gene product or a fragment thereof.

[0095] In another specific embodiment of the kit of the present invention, the reagent that is specific for the anti-EP153R antibody is specific for the antibody against EP153R of SEQ ID NO: 1, and / or the reagent that is specific for the anti-EP402R antibody is specific for the antibody against EP402R of SEQ ID NO: 3.

[0096] In a more specific embodiment of the kit of the present invention, if the second biomarker is an antibody against the heterologous gene product, then the reagent is the heterologous gene product or an immunogenic fragment thereof.

[0097] In another specific embodiment of the kit of the present invention, if the second marker is a heterologous gene or a fragment thereof, then the reagent is a primer or probe that is specific to the heterologous gene product or a fragment thereof.

[0098] In another specific embodiment of the kit of the present invention, the ASFV-specific antigen that is not the EP402R gene product or the EP153R gene product is the p72, CP312 and / or p30 antigen, or the ASFV gene that is not the EP402R gene or the EP153R gene is the p72 gene, the CP312 gene or the p30 gene.

[0099] In a specific embodiment of the kit of the present invention, the heterologous gene is the eGFP gene, or the product of the heterologous gene is the eGFP protein.

[0100] In another specific embodiment of the kit of the present invention, the kit does not contain reagents for detecting antibodies against the gene products of DP148R, 9GL / B119L, MGF_360-12L, MGF-13L and MGF_360-14L, and / or does not contain reagents for detecting the genes of DP148R, 9GL / B119L, MGF_360-12L, MGF-13L and MGF_360-14L or fragments thereof.

[0101] In a more specific embodiment of the kit of the present invention, the first and second reagents are primers and / or probes.

[0102] In one specific embodiment of the kit of the present invention, the primers are primers according to SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 11 and SEQ ID NO: 12. In another specific embodiment, the probes are probes according to SEQ ID NO: 7, SEQ ID NO: 10 and SEQ ID NO: 13.

[0103] In a more specific embodiment of the kit of the present invention, the TaqMan probe specific to the p72 gene PCR fragment contains 6FAM as a reporter and BHQ1 as a quencher, the TaqMan probe specific to the EP153R gene PCR fragment contains JOE as a reporter and BHQ1 as a quencher, and / or the TaqMan probe specific to the eGFP gene PCR fragment contains Cy5 as a reporter and BBQ as a quencher.

[0104] In another specific embodiment of the kit of the present invention, the first and second reagents are polypeptides.

[0105] As used herein, the term "polypeptide" refers to a straight chain of amino acid residues of any length linked together by peptide bonds. As used herein, the term "peptide" refers to a linear chain of amino acids that is a polypeptide, although shorter than a polypeptide. It should be understood that the terms "peptide bond," "peptide," "polypeptide," and "protein" are known to those skilled in the art.

[0106] In another specific embodiment of the kit of the present invention, the polypeptide is immobilized on a support.

[0107] As used herein, the term "solid support" refers to a non-fluid material and includes chips, containers, and particles (including microparticles and beads) made of materials such as polymers, metals (paramagnetic, ferromagnetic particles), glass, and ceramics; gel materials, such as silica, alumina, and polymer gels; capillaries, which may be made of polymers, metals, glass, and / or ceramics; zeolites and other porous materials; electrodes; microtiter plates; solid test strips; and cuvettes, test tubes, or other spectrometer sample containers. The difference between a measured solid support component and a measured inert solid surface that may come into contact with the solid support is that the "solid support" contains at least one polypeptide on its surface, intended to interact directly or indirectly with the first and / or second markers of the method of the present invention. Solid supports can be fixed components, such as test tubes, test strips, cuvettes, or microtiter plates, or they can be non-fixed components, such as beads and microparticles. Microparticles can also be used as solid supports in homogeneous assays. A variety of microparticles that allow non-covalent or covalent binding of proteins and other substances can be used. Such particles include polymer particles, such as polystyrene and poly(methyl methacrylate); gold particles, such as gold nanoparticles and gold colloids; and ceramic particles such as silica, glass and metal oxide particles.

[0108] In a more specific embodiment of the kit of the present invention, the kit further comprises an antibody specific to porcine antibodies.

[0109] The kit of the present invention has been found to be useful for an in vitro diagnostic method to distinguish between animals infected with African swine fever virus (ASFV) and animals vaccinated against ASFV. Therefore, another aspect of the present invention relates to an in vitro diagnostic method to distinguish between animals infected with African swine fever virus (ASFV) and animals vaccinated against ASFV using an immunogenic composition containing attenuated ASFV, wherein the EP153R and EP402R genes in the attenuated ASFV have been inactivated, and regions of the ASFV genome containing the EP402R and EP153R genes have been replaced with heterologous genes.

[0110] The present invention will be described through the following embodiments, which are considered to be merely illustrative and not to limit the scope of the invention.

[0111] Example Example—DIVA Method of the Invention Example 1: Materials and methods A brief description of the EP153R antigen The ASFV EP153R protein (pEP153R) is a type II transmembrane protein with 159 amino acids and multiple putative sites for post-translational modifications: N-glycosylation, myristylation, and phosphorylation. pEP153R is involved in viral hemosorption and is highly variable across genotypes.

[0112] Cloning and expression of pEP153R The complete extracellular domain of ASFV's pEP153R (such as the Lv17 / WB / Rie1 strain disclosed in patent application WO2020 / 049194) has been expressed in mammalian cell lines. The corresponding gene sequence was amplified from a synthetic gene optimized for Homo sapiens and cloned into the vector pCMV6-Ac-Fc-S, which adds an interleukin-2 secretion signal to the amino terminus of the protein and a mouse Fc tag to the carboxyl terminus. The recombinant vector was transfected into HEK-293 cells using FectoPRO® reagent (Polyplus). Six days post-transfection, pEP153R was obtained from the culture medium. The protein was purified by affinity chromatography using a protein GSepharose® column (Cytiva) and eluted with glycine-HCl 0.1 M pH 2.6 buffer. The purity of the purified protein was analyzed by SDS-PAGE followed by silver staining. Figure 1 A), and used a monoclonal antibody with an anti-mouse Fc tag to analyze its identity via Western blotting (A). Figure 1 B). Given that the cloned gene has six N-glycosylation projection sites (NetNGIyc 1.0 Server, DTU Bioinformatics), this analysis revealed diffusion bands with the expected molecular weight of the protein (64 kDa), and experimental evidence shows that the molecular weight of each of these N-glycosylations is approximately 4 kDa.

[0113] A brief description of eGFP antigen Derived from Victoria jellyfish ( Aequorea Victoria The enhanced green fluorescent protein (eGFP) of DIVA is included in the prototype DIVA vaccine candidate. Therefore, the potential use of eGFP as a target for the DIVA antigen in the prototype DIVA assay was further tested.

[0114] Cloning and expression of eGFP protein The complete eGFP sequence was expressed using insect cell lines. The corresponding sequence was amplified from the synthetic gene and cloned into the vector pAcHLTA, with six histidine residues added to the amino terminus of the protein. Recombinant baculovirus was obtained by co-transfection with recombinant plasmid and linear BacPAK6 DNA using jetPEI® transfection reagent (Polyplus). Sf9 cells were infected with the recombinant baculovirus (MOI 1.5). Three days post-infection, cells were lysed with 25 mM bicarbonate buffer. eGFP was obtained from the soluble fraction of the cell extract and purified by affinity chromatography using a nickel column (high-density metal-free resin, ABT). The purity of the purified protein was analyzed by SDS-PAGE-Coomassie brilliant blue staining, and its identity was analyzed by Western blotting using an anti-histidine-tagged monoclonal antibody. This analysis revealed a band with the expected protein molecular weight (33 kDa). Figure 2 ).

[0115] Serum samples used in the study To establish an ELISA for detecting antibodies against the target DIVA antigens of ASFV (pEP153R) and eGFP in domestic pigs (DP) and wild boars (WB), several well-characterized sera were analyzed. Serum samples from DP were obtained from in vivo studies conducted at the CISA-INIA BSL-3 facility, and samples from WB were obtained from in vivo studies conducted at the VISAVAT, UCM BSL-3 facility.

[0116] In addition, to ensure the specificity of the assay, the study included a total of 386 ASFV-free wild-type samples from Spanish farms.

[0117] Description of DIVA-ELISA pEP153R enzyme-linked immunosorbent assay To detect anti-pEP153R antibody, 96-well plates were coated with 15 ng / well of antigen and incubated overnight at 4°C. The coated wells were then stabilized and blocked at room temperature (RT) for 1 hour using StabilZyme™ Select Stabilizer (SS) (SURMODICS). After removing the blocking solution, the wells were incubated at RT for 1 hour with serum diluted 1:100 in serum dilution buffer. After washing the plate three times with washing solution (Ingenasa), anti-pig IgG monoclonal antibody conjugated with horseradish peroxidase (1BH7, Ingenasa) was used as the secondary antibody, diluted 1:40000 in SS and incubated at RT for 1 hour. After the washing step, the assay was performed by adding TMB as described above. The reaction was terminated by adding 0.5 M sulfuric acid after 20 minutes. The signal was measured by reading the optical density (OD) at 450 nm. The sample / positive (S / P) ratio for each sample was calculated using the following formula: eGFP ELISA To detect anti-eGFP antibodies, 96-well plates were coated with 0.2 μg / well of antigen and incubated overnight at 4°C. The coated wells were stabilized with SS at room temperature (RT) for 1 h and blocked. After removing the blocking solution, serum samples diluted 1:100 in serum dilution buffer were incubated at RT for 1 h. After washing the plates three times with washing solution, protein A / G, conjugated with horseradish peroxidase and diluted to 1 / 80000, was incubated at RT for 1 h. After the washing steps described above, the assay was performed by adding TMB. The reaction was terminated by adding 0.5 M sulfuric acid after 10 minutes. The signal was measured by reading the OD at 450 nm. The S / P ratio for each sample was calculated using the following formula: Explanation of serological DIVA ELISA The DIVA serological diagnostic assay will be based on the detection of antibodies against different antigens: highly immunogenic viral antigens (p72, CP312, and / or p30), pEP153R, and eGFP. Table 1 shows the expected results obtained using the serological DIVA assay, taking into account the high genotypic variability of pEP153R.

[0118] Table 1. Explanation of serological DIVA ELISA.

[0119] P: Positive; N: Negative result Immunogenicity analysis of pEP153R The immunogenicity of pEP153R was evaluated by indirect ELISA. In this preliminary study, two positive sera and two negative sera were analyzed. Differential signals were observed between positive and negative sera in both animals. Furthermore, no signal was observed when the same sera were tested with an unrelated antigen expressed under the same system and conditions as pEP153R. Figure 3 These results indicate that pEP153R is immunogenic in ELISA.

[0120] Analysis of the immunogenicity of eGFP The immunogenicity of eGFP was evaluated by indirect ELISA. In this preliminary study, sera from domestic pigs experimentally infected with an ASFV mutant containing the eGFP gene as a reporter gene were analyzed. Serum was collected at different time points post-infection: 0, 16, and 35 dpi. Additionally, three wild-type sera from an ASFV-free Spanish farm were also included in the assay. All sera were analyzed against eGFP and against an unrelated antigen (negative antigen) produced under the same expression system and conditions as eGFP. Differential signals were observed between experimentally positive and negative sera, and no signal was detected using wild-type negative sera. Furthermore, no signal was observed under any circumstances when the same sera were analyzed against the negative antigen. Figure 4 These results indicate that eGFP is immunogenic in ELISA.

[0121] Analysis of the immunogenicity of mCherry The reporter protein mCherry was recombinantly produced in an *E. coli* and baculovirus expression system. Serial protein purification yielded two forms with high levels of purity (data not shown). Immunogenicity of the protein was assessed by indirect ELISA. Since mCherry is a fluorescent protein derived from dsRed and has a high percentage of amino acid sequence identity (approximately 80%), serum samples from domestic pigs experimentally inoculated with a modified ASFV (Lv17 / WB / Rie1AUK) containing dsRed as the reporter protein were included in the evaluation. Figure 8 As shown, when mCherry was used as a coating antigen in an ELISA plate, a differential signal was detected between negative (0 dpi) and positive sera (14 dpi) (results obtained in the form of baculovirus systemic expression are shown only in the figure). Furthermore, because the signal in positive serum appeared to increase with increasing amounts of coating antigen, and the OD of negative serum remained similar, the positive signal appears to be antigen-specific. These preliminary results suggest that mCherry is immunogenic by ELISA.

[0122] Analysis of the potential of pEP153R and eGFP as DIVA antigens Based on the biomarker candidate vaccine (Lv17 / WB / Rie1ΔEP402RΔEP153R: ΔCD), a DIVA serological assay was developed to differentiate infected and vaccinated animals. This assay is based on detecting antibodies against proteins encoded by the deleted gene EP153R (pEP153R) and proteins encoded by the reporter gene (eGFP) used in the vaccine. Additionally, other highly immunogenic viral antigens, such as p72, were used as controls to detect infection and monitor immunity in vaccinated animals.

[0123] Serum samples from DP and WB were analyzed by indirect ELISA to evaluate antibody responses against pEP153R and eGFP, which are serological DIVA candidates. Antibody responses against p72 were also evaluated.

[0124] In the case of DP, a total of 122 serum samples from 8 animals experimentally inoculated with the parental virus were analyzed. Six of these 8 animals were intramuscularly inoculated with 10... 2 TCDI 50 Lv17 / WB / Rie1 was administered at a dose of / mL, and serum was collected between 0 and 54 dpi: 100% of these pigs seroconverted to pEP153R after 23 ± 5 dpi and to p72 protein after 13 ± 2 dpi (porcine C18 was not included in the mean because it died at 12 dpi). All sera were negative for eGFP. Furthermore, Lv17 / WB / Rie1 was administered at a dose of / mL, and serum was collected between 0 and 54 dpi. 50 Two pigs were intramuscularly inoculated with Lv17 / WB / Rie1 at a dose of / mL, and serum was collected between 0 and 126 dpi. Under these conditions, 100% of these pigs showed seroconversion against pEP153R at different time points after 22 dpi and against p72 protein after 7 dpi. All sera were negative for eGFP. Furthermore, another animal was exposed to Lv17 / WB / Rie1: an antibody response against pEP153R was detected after 29 dpi, and antibodies against p72 protein were detected after 14 dpi. Moreover, all serum samples from this animal were negative for eGFP.

[0125] Regarding the vaccinated pigs, a group of 60 serum samples from 5 different animals that were intramuscularly inoculated with 10 2 TCDI 50 / mL dose of the ΔCD candidate vaccine was administered and collected from 0 to 54 days post-vaccination (dpv). All DPs were negative for pEP153R after 21 dpv and positive for eGFP after 14 dpv (Table 2).

[0126] For example, Figure 5This shows the antibody response of animals to C17 and C7.

[0127] Table 2. Summary of the analysis of the potential of pEP153R and eGFP as DIVA antigens in domestic pigs.

[0128] Negative pigs died at 12 dpi.

[0129] dpi: Days post-infection; dpv: Days post-vaccination; IM: Intramuscular; ΔCD: Lv17 / WB / Rie1ΔEP402RΔEP153R; Ab: Antibody.

[0130] Regarding the immunogenicity of pEP153R in Western blotting, a total of 91 serum samples from 6 different animals experimentally inoculated with the parental virus were analyzed. Three of the 6 animals were inoculated orally with 10... 3 TCDI 50 Lv17 / WB / Rie1 was administered at a dose of / mL, and serum was collected from 0 to 89 dpi: 100% WB seroconversion was observed at different time points after 11 dpi for p72 seroconversion and at different time points after 25 dpi for pEP153R seroconversion. All animals were negative for eGFP. Furthermore, analysis was performed on samples from animals inoculated orally and nasally with 10... 4 TCDI 50 Forty-six serum samples were collected from three Western blots (WBs) at a dose of Lv17 / WB / Rie1 per mL, collected between 0 and 89 dpi. Under these conditions, 100% of the WBs seroconverted against p72 protein at different time points after 11 dpi and against pEP153R at different time points after 25 dpi. Some animals exhibited a nonspecific response to eGFP around 11 dpi.

[0131] Regarding Western blot analysis of vaccination, 103 serum samples from a cohort of 9 animals vaccinated with the ΔCD candidate vaccine were analyzed. Four of the 9 animals received the vaccine orally and nasally. 4 TCDI 50 The candidate vaccine was administered at a dose of / mL, and serum was collected between 0 and 61 dpv: 100% WB seroconversion to p72 protein occurred after 13 ± 3 dpv, and seroconversion to eGFP occurred after 18 ± 2 dpv. All animals were negative for pEP153R. Furthermore, analyses were performed on samples from animals 10 orally and nasally vaccinated. 2 TCDI 50 / mL dose of candidate vaccine and booster dose after 30 dpv. 4 TCDI 50Fifty-nine serum samples were collected from five Western blots (WB) of Lv17 / WB / Rie1 per mL. Serum was collected between 0 and 63 dpi. Under these conditions, 100% of the WBs were seroconverted to p72 protein at different time points after 16 dpv and to eGFP after 23 dpv. All animals were negative for pEP153R (Table 3).

[0132] For example, Figure 6 The antibody responses of animals to RA1 and MU4 were shown.

[0133] Table 3. Summary of the analysis of the potential of pEP153R and eGFP as DIVA antigens in wild boar.

[0134] Two animals showed a nonspecific response to eGFP at around 11 dpi.

[0135] dpi: Days post-infection; dpv: Days post-vaccination; OM: Oral / nasal; ΔCD: Lv17 / WB / Rie1ΔEP402RΔEP153R; Ab: Antibody.

[0136] To verify whether the antibody response against pEP153R was maintained in a timely manner, serological samples collected from two experimentally infected patients with the parental virus between 0 and 126 dpi were analyzed. The response to pEP153R stabilized at 126 dpi. Figure 7 ).

[0137] Finally, to investigate the specificity of the eGFP and pEP153R ELISAs, a cohort of 386 wild-type negative samples from ASF-free regions were analyzed for pEP153R and eGFP: 152 serum samples were from pigs and 234 serum samples were from wild boars. In both ELISAs, 100% preliminary diagnostic specificity was obtained for pigs, and 99.9% preliminary diagnostic specificity was obtained for wild boars.

[0138] Example 2: Design of a triple real-time PCR method to differentiate between ASFV infection and vaccination (DIVA trial) Target A DIVA molecular method is being developed to complement the ASFV vaccine prototype Lv17 / WB / Rie1-ΔCD, which is a double mutant constructed by deleting adjacent ASFV EP153R and EP402R genes, which are replaced by incorporation of eGFP as a reporter gene. Therefore, a triple real-time PCR method is planned for simultaneous and differential detection of the deleted ASFV-EP153R and inserted eGFP genes, as well as the control ASFV-VP72 gene.

[0139] Methodology The genomic sequences of the parental Lv17 / WB / Rie1 and the vaccine Lv17 / WB / Rie1-ΔCD strain were aligned to place regions corresponding to the missing viral genes EP153R-EP402R and the inserted reporter gene eGFP. Artificial primer pairs and hydrolyzed TaqMan probe sets were designed to target the EP153R or eGFP genomic regions. In addition, primers and probes previously designed for the detection of the ASFVVP72-coding gene (J. Fernández-Pinero et al, 2013 TransboundEmerg Dis. 60(1):48-58), which are recommended and widely used in routine ASF diagnosis, were incorporated into multiplex real-time PCR as a control for the presence of ASFV. To obtain sensitivity similar to each PCR target gene, special attention was paid to selecting primers and probes with similar Tm values ​​in the experimental design. Finally, each probe was labeled with a different reporter fluorescent dye, allowing differential detection of the three target genes in triplet reactions (Table 4).

[0140] Table 4: Primers and probes designed for triple DIVA PCR assay. a Based on the location of the ASFV Lv17 / WB / Rie1 genome; b Based on the position of Lv17 / WB / Rie1-ΔCD.

[0141] JOE can be replaced by VIC or HEX fluorescent dyes.

[0142] Note: R = A + G; nucleic acids marked with bold and a+ correspond to LNA positions (locked nuclei). Different primer / probe concentrations and several PCR reagents were tested to optimize reaction conditions for maximum sensitivity to each target gene without compromising the specificity of the technique. Finally, triplet PCR was established using the Luna Universal Probe qPCR Master mixkit (New England Biolabs) with the reaction conditions disclosed in Table 5.

[0143] Table 5: Reaction conditions for triple PCR.

[0144] The incubation curve for DNA amplification was established as follows: 45 cycles of 95℃ for 1 minute, 95℃ for 15 seconds, and 60℃ for 30 seconds. Fluorescence was collected in the FAM, JOE-VIC-HEX, and Cy5 channels at the end of each PCR cycle.

[0145] Positive results in triplet real-time PCR were determined by identifying the threshold cycle number (Ct) at which any reporter dye signal exceeded the background value within 40 cycles. Interpretations of fluorescence signals obtained from porcine samples are summarized in Table 6.

[0146] Table 6: Summary of Results Interpretation

[0147] result The initial PCR experiments aimed to establish a primer / probe combination with optimal performance for detecting the vaccine-deficient EP153R gene. This, along with the adjacent EP402R gene, corresponds to an ASFV genomic region with extremely high A / T content, making primer / probe design highly complex. Conversely, the reporter eGFP sequence contains a high G / C ratio, which also hindered designs compatible with the simultaneous detection of ASFVVP72 and EP153R targets. Achieving similar sensitivity for each PCR target gene was crucial in setting up the final DIVA triplet PCR assay (Tables 7 and 8).

[0148] Table 7: Triple PCR analysis of 10-fold serial dilutions of blood samples collected from pigs experimentally infected with a virulent genotype II strain at 7 dpi. E70 is the reference strain, Spain70 genotype I.

[0149] Table 8. 10 genotypes of parental Lv17 / wb / RIE1 and vaccine Lv17 / WB / Rie1-ΔCD strain II -2 Comparison of single and triplet PCR analyses of each amplification target for the dilutions. E70 is the reference Spain70 genotype I strain.

[0150] After optimizing triple DIVA PCR conditions, a cohort of 53 pig samples collected from previous in vivo experimental studies were analyzed to determine the safety and protection of the Lv17 / WB / Rie1-ΔCD vaccine prototype. An additional 66 blood samples collected during experimental studies detecting two other Lv17 / WB / Rie1-derived mutants (Lv17 / WB / Rie1-ΔCD+ΔUK and Lv17 / WB / Rie1-ΔEP153) were also analyzed. Finally, 19 pig samples from pigs experimentally vaccinated with parental Lv17 / WB / Rie1 were included in this study.

[0151] Specifically, DNA was extracted and then subjected to triple DIVA PCR assay, which was performed simultaneously with the routine ASFV diagnostic PCR assay (VP72 gene, described in J. Fernández-Pinero et al, 2013 Transbound EmergDis. 60(1):48-58). The following are noteworthy results from the PCR: • As expected, PCR results for blood samples (n=21) collected prior to vaccination with any prototype vaccine were all negative.

[0152] • After immunization with any mutant containing ΔEP153, DIVA PCR results for VP72 and eGFP gene detection were consistent with parallel results for conventional VP72 PCR, while the samples remained negative for EP153R (n=32).

[0153] • Following challenge with a virulent Armenian strain, DIVA PCR allowed for the differentiation of the vaccine prototype and challenge virus in 97% of blood samples that were positive for routine VP72 PCR (n=32). Furthermore, DIVA PCR reported very similar Ct values ​​for any target gene, confirming high similarity sensitivity and the ability to identify co-infection status in four samples. Some inconsistent (n=2) and indeterminate (n=7) results were obtained for samples showing Ct>36 for any target gene due to extremely low levels of viremia induced in the animals. These samples were at the limits of PCR detection and are generally difficult to replicate. Finally, 27 blood samples remained negative for all target genes.

[0154] • Additionally, DIVA PCR reported consistent results for the VP72 and EP153R genes in 75% of blood samples collected from pigs inoculated with parental Lv17 / WB / Rie1, while eGFP remained negative in all samples (n=12). Specifically, three blood samples showing VP72 gene amplification (Ct range 30-33) were negative for the EP153R gene. Further investigation of these samples is needed to interpret and resolve these inconsistent results.

Claims

1. An in vitro diagnostic method for distinguishing between animals infected with African swine fever virus (ASFV) and animals vaccinated against ASFV using an immunogenic composition containing attenuated ASFV, wherein the EP153R and EP402R genes in the attenuated ASFV have been inactivated, and regions of the ASFV genome containing the EP402R and EP153R genes have been replaced with heterologous genes, the method comprising: (i) Detecting the presence of a first biomarker and a second biomarker in a sample from the animal, wherein the first biomarker is selected from the group consisting of: - Antibodies against ASFV-specific antigens that are not EP402R or EP153R gene products, and - An ASFV gene or fragment thereof that is not the EP402R or EP153R gene. And the second biomarker is a "first ASFV vaccine biomarker" and / or a "second ASFV vaccine biomarker", wherein the first ASFV vaccine biomarker is selected from the group consisting of: - Antibodies targeting the EP402R gene product or the EP153R gene product, and -EP402R gene or a fragment thereof or EP153R gene or a fragment thereof And the second ASFV vaccine biomarker mentioned therein is selected from the following group: -Antibodies specific to the heterologous gene product, or -The heterologous gene or its fragment, and and (ii) Identify the animal as a) If at least one of the first biomarker and the second ASFV vaccine biomarker is detected, then the individual has been vaccinated, or b) If at least one of the first biomarkers is detected, and optionally the first ASFV vaccine biomarker is detected or the second ASFV vaccine biomarker is not detected, then the person has been infected.

2. The method of claim 1, wherein the identification of the animal being vaccinated is further confirmed by detecting the first ASFV vaccine marker, wherein if the marker is not detected, the animal is identified as having been vaccinated.

3. The method of claim 1, wherein the identification of the animal's infection is further confirmed by detecting the first ASFV vaccine marker, wherein the first ASFV vaccine marker is a genotype II specific marker, wherein if the marker is detected, the animal is identified as being infected with an ASFV strain of genotype II, or if the marker is not detected, the animal is identified as being infected with an ASFV strain of a genotype other than genotype II.

4. The method of claim 1, wherein if the first marker is detected, the first ASFV vaccine marker is detected, and the second ASFV vaccine marker is detected, the animal is identified as having been vaccinated and infected with the ASFV strain.

5. The method according to any one of claims 1 to 4, wherein the antibody against an ASFV-specific antigen that is not an EP402R gene product or an EP153R gene product is an anti-p72 antibody, an anti-CP312 antibody, or an antibody against a p30 gene product, or wherein the ASFV gene that is not an EP402R gene or an EP153R gene is a p72 gene, a CP312 gene, or a p30 gene.

6. The method according to any one of claims 1 to 5, wherein the first ASFV vaccine biomarker is an anti-EP153R antibody, an anti-EP402R antibody, the EP153R gene or a fragment thereof, or the EP402R gene or a fragment thereof.

7. The method according to claim 6, wherein the anti-EP153R antibody is specific to EP153R as defined in SEQ ID NO:1, wherein the EP153R gene is as defined in SEQ ID NO:2, wherein the anti-EP402R antibody is specific to EP402R as defined in SEQ ID NO:3, wherein the EP402R gene is as defined in SEQ ID NO:

4.

8. The method according to any one of claims 1-7, wherein the heterologous gene is the eGFP gene.

9. The method according to any one of claims 1-8, wherein the method does not include detecting antibodies against the gene products of DP143R, 9GL / B119L, MGF_360-12L, MGF-13L and MGF_360-14L in the sample, and / or wherein the method does not include detecting the presence of the genes or fragments thereof of DP143R, 9GL / B119L, MGF_360-12L, MGF-13L and MGF_360-14L in the sample.

10. The method according to any one of claims 1-9, wherein the first marker and the second marker are genes or gene fragments.

11. The method of claim 10, wherein the detection of the first marker and the second marker is performed by polymerase chain reaction (PCR), preferably real-time PCR.

12. The method of claim 11, wherein each PCR fragment is detected using a specific TaqMan probe.

13. The method of claim 11 or 12, wherein the PCR is a multiplex PCR, wherein the first marker and the second marker are detected in the same reaction.

14. The method according to claims 11 to 13, wherein: - The first biomarker is the ASFV p72 gene, and the PCR was performed using the forward primer of SEQ ID NO:5 and the reverse primer of SEQ ID NO:

6. - The first ASFV vaccine biomarker is the EP153R gene, and the PCR is performed using the forward primer of SEQ ID NO:8 and the reverse primer of SEQ ID NO:9, and / or - The second ASFV vaccine biomarker is the eGFP gene, and the PCR was performed using the forward primer of SEQ ID NO:11 and the reverse primer of SEQ ID NO:

12.

15. The method of claim 14, wherein the p72 gene PCR fragment is detected using a TaqMan probe containing the sequence defined in SEQ ID NO:7, the EP153R gene PCR fragment is detected using a TaqMan probe containing the sequence defined in SEQ ID NO:10, and / or the eGFP gene PCR fragment is detected using a TaqMan probe containing the sequence defined in SEQ ID NO:

13.

16. The method according to any one of claims 14 or 15, wherein a TaqMan probe specific to the p72 gene PCR fragment is labeled with 6-FAM, a TaqMan probe specific to the EP153R gene PCR fragment is labeled with JOE, and / or a TaqMan probe specific to the eGFP gene PCR fragment is labeled with Cy5.

17. The method of claim 16, wherein the TaqMan probe specific to the p72 gene PCR fragment contains BHQ1 as a quencher, the TaqMan probe specific to the EP153R gene PCR fragment contains BHQ1 as a quencher, and / or the TaqMan probe specific to the eGFP gene PCR fragment contains BBQ as a quencher.

18. The method of claim 17, wherein the reagent for detecting the first biomarker comprises a primer pair having the sequences of SEQ ID NO: 5 and 6 and a TaqMan probe having the sequence 6FAM-TCCTGGCCRACCAAGTGCTT-BHQ1 (SEQ ID NO: 7), the reagent for detecting the first ASFV vaccine biomarker comprises a primer pair having the sequences of SEQ ID NO: 8 and 9 and a TaqMan probe having the sequence JOE*-AGGAG+AGATTAATAAA+C+CAATA+T+GTTACC-BHQ1 (SEQ ID NO: 10), and the reagent for detecting the second ASFV vaccine biomarker comprises a primer pair having the sequences of SEQ ID NO: 11 and 12 and a TaqMan probe having the sequence Cy5-TGTAGTTGTACTCCAGCTTGTGCC-BBQ (SEQ ID NO: 13), wherein R represents A or G, and + represents LNA nucleotides.

19. The method according to any one of claims 1 to 9, wherein the first and second markers are antibodies.

20. The method of claim 18, wherein the detection of the first and second markers is performed by an immunoassay.

21. The method of claim 19, wherein the immunoassay comprises capturing the antibody using an immobilized antigen that can be specifically bound by the antibody.

22. The method of claim 20, wherein the immunoassay comprises capturing an antibody against the EP153R gene product, and the capture is performed using the EP153R gene product or a fragment thereof.

23. The method according to any one of claims 20 to 22, wherein the immunoassay is a sandwich immunoassay, wherein the antibody is captured using the EP153R gene product or a fragment thereof, and the captured antibody is detected using an antibody specific to porcine antibodies.

24. The method according to any one of claims 1 to 23, wherein if the first and second markers are antibodies, the sample is a serum sample, or wherein if the first and second markers are genes or gene fragments, the sample is a blood sample.

25. A reagent kit comprising: (i) A reagent suitable for detecting a first marker, wherein the first marker is selected from the group consisting of: - Antibodies against ASFV-specific antigens that are not EP402R or EP153R gene products, and - ASFV genes or fragments thereof that are not EP402R or EP153R genes, and (ii) A reagent suitable for detecting a second biomarker, wherein the second biomarker is a "first ASFV vaccine biomarker" and / or a "second ASFV vaccine biomarker", wherein the first ASFV vaccine biomarker is selected from the group consisting of: - Antibodies targeting the EP402R gene product or the EP153R gene product, and -EP402R gene or a fragment thereof or EP153R gene or a fragment thereof And the second ASFV vaccine biomarker mentioned therein is selected from the following group: - Antibodies specific to heterologous gene products, or - Heterologous genes or fragments thereof, and.

26. The kit of claim 25, wherein the first biomarker is an antibody against an ASFV-specific antigen that is not the EP402R gene product or the EP153R gene product, in which case the reagent is an ASFV-specific antigen.

27. The kit according to claim 25 or 26, wherein the first biomarker is an ASFV gene or a fragment thereof that is not the EP402R gene or the EP153R gene, and wherein the reagent is a primer pair and / or probe specific to the gene or gene fragment.

28. The kit according to any one of claims 25 to 27, wherein if the second biomarker is an antibody against the EP402R gene product, the reagent is the EP402R gene product or an immunogenic fragment thereof, and wherein if the second biomarker is an antibody against the EP153R gene product, the reagent is the EP153R gene product or an immunogenic fragment thereof.

29. The kit according to any one of claims 25 to 28, wherein if the second marker is the EP402R gene or a fragment thereof, the reagent is a primer or probe specific to the EP402R gene product or a fragment thereof, and wherein if the second marker is the EP153R gene or a fragment thereof, the reagent is a primer or probe specific to the EP153R gene product or a fragment thereof.

30. The kit according to claim 28 or 29, wherein the reagent specific for the anti-EP153R antibody is specific for the antibody against EP153R of SEQ ID NO:1, and / or wherein the reagent specific for the anti-EP402R antibody is specific for the antibody against EP402R of SEQ ID NO:

2.

31. The kit according to any one of claims 25 to 30, wherein if the second biomarker is an antibody against the heterologous gene product, then the reagent is the heterologous gene product or an immunogenic fragment thereof.

32. The kit according to any one of claims 25 to 31, wherein if the second biomarker is a heterologous gene or a fragment thereof, the reagent is a primer or probe specific to the heterologous gene product or a fragment thereof.

33. The kit according to any one of claims 25 to 32, wherein the ASFV-specific antigen that is not the EP402R gene product or the EP153R gene product is the p72, CP312 and / or p30 antigen, or wherein the ASFV gene that is not the EP402R gene or the EP153R gene is the p72 gene, the CP312 gene or the p30 gene.

34. The kit according to any one of claims 25 to 33, wherein the heterologous gene is the eGFP gene, or wherein the heterologous gene product is the eGFP protein.

35. The kit according to any one of claims 25 to 34, wherein the kit does not contain reagents for detecting antibodies against the gene products of DP143R, 9GL / B119L, MGF_360-12L, MGF-13L and MGF_360-14L, and / or does not contain reagents for detecting the genes of DP143R, 9GL / B119L, MGF_360-12L, MGF-13L and MGF_360-14L or fragments thereof.

36. The kit according to any one of claims 25 to 35, wherein the first and second reagents are primers and / or probes.

37. The kit according to claim 36, wherein the primers are primers according to SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:11 and SEQ ID NO:

12.

38. The kit according to claim 36 or 37, wherein the probe is a probe according to SEQ ID NO:7, SEQ ID NO:10, or SEQ ID NO:

13.

39. The kit according to claim 38, wherein the TaqMan probe specific to the p72 gene PCR fragment contains BHQ1 as a quencher, the TaqMan probe specific to the EP153R gene PCR fragment contains BHQ1 as a quencher, and / or the TaqMan probe specific to the eGFP gene PCR fragment contains BBQ as a quencher.

40. The kit according to any one of claims 25 to 35, wherein the first and second reagents are peptides.

41. The kit of claim 40, wherein the polypeptide is immobilized on a support.

42. The kit according to claim 40 or 41, wherein the kit further comprises an antibody specific for porcine antibodies.

43. Use of the kit according to any one of claims 25 to 42 in an in vitro diagnostic method for distinguishing between animals infected with African swine fever virus (ASFV) and animals vaccinated against ASFV using an immunogenic composition containing attenuated ASFV, wherein the EP153R and EP402R genes in the attenuated ASFV have been inactivated, and regions of the ASFV genome containing the EP402R and EP153R genes have been replaced with heterologous genes.

Images