Application of adeno-associated virus of liver-specific overexpression Trem2 in preparation of medicine for relieving alcohol-associated steatohepatitis
By overexpressing Trem2 in liver macrophages using adeno-associated virus that specifically overexpresses Trem2, the lack of treatment options for alcohol-related steatohepatitis was addressed, resulting in improved liver function and delayed disease progression.
Patent Information
- Application Number
- CN202510887842.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-30
- Publication Date
- 2025-11-14
AI Technical Summary
Currently, there are no effective drugs for treating alcohol-related steatohepatitis. Existing research shows that TREM2 plays an important role in the progression of liver diseases, especially in alcohol-related steatohepatitis, where the expression level of TREM2 is associated with disease progression. There is a need to explore new therapeutic targets to improve liver function.
Adeno-associated virus (AAV) that specifically overexpresses Trem2 was used to infect liver tissue via the AAV8 viral subtype. The F4/80p promoter in the GV650 vector was used to mediate the specific overexpression of the Trem2 gene in macrophages. The therapeutic effect of Trem2 overexpression in hepatic macrophages on delaying the progression of alcohol-related steatohepatitis was investigated.
Liver-specific overexpression of Trem2 increases the antioxidant activity of hepatocytes, reduces apoptosis and programmed ferroptosis, improves hepatic steatosis and inflammatory response, and delays the progression of alcohol-related steatohepatitis.
Smart Images

Figure CN120939251A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedicine, specifically relating to the application of adeno-associated virus that specifically overexpresses Trem2 in the preparation of drugs to alleviate alcohol-related steatohepatitis. Background Technology
[0002] Alcohol-related liver disease (ALD) is caused by long-term, heavy alcohol consumption and is one of the leading causes of chronic liver disease. Approximately 3.5% of the global population suffers from ALD, and the number of deaths caused by ALD is steadily increasing. China currently has 6.4 million cases of ALD-related cirrhosis. Without effective regulatory policies, it is projected that from 2022 to 2040, there will be a cumulative increase of 3.61 million new cases of alcohol-related cirrhosis (95% IUI: 3.03-4.44 million), and a cumulative death toll of 1.96 million (1.66-2.32 million), significantly increasing the disease burden of ALD. Despite significant progress in the field of ALD research over the past 20 years, due to the complexity of alcohol addiction, the difficulty of withdrawal, and the still incomplete understanding of its pathogenesis, there are currently no specific therapeutic drugs. Therefore, elucidating new pathogenic mechanisms of ALD, exploring new therapeutic targets, and developing new treatment strategies have become crucial issues that urgently need to be addressed.
[0003] The pathological progression of alcohol-related liver disease (ALD) begins with simple hepatic steatosis, i.e., alcohol-associated fatty liver (AFL), gradually evolving into alcohol-associated steatohepatitis (ASH) with inflammation, and then progressing to the irreversible stage of liver fibrosis, cirrhosis, and even hepatocellular carcinoma. More than 10%–35% of AFL cases progress to ASH, with 8%–20% of these progressing to alcohol-related cirrhosis. Alcohol-induced liver disease involves multiple mechanisms, such as endoplasmic reticulum stress, oxidative stress, pro-inflammatory cytokines, risk-related molecular patterns, and autophagy dysregulation, leading to hepatic steatosis, inflammation, and fibrosis. Immune cells play a crucial role in ALD progression, particularly in the inflammatory response, with neutrophil and macrophage infiltration, especially Kupffer cells and the activation of other types of immune cells, playing a dominant role in the pathogenesis of ASH. Recent studies have identified many macrophage subsets that play important roles in promoting liver repair and fibrosis regression. However, further research is needed to elucidate their roles in ASH and assess their potential as therapeutic targets.
[0004] Two genes on human chromosome 6p21 encode triggering receptor 1 (TREM1) and triggering receptor 2 (TREM2), both expressed on myeloid cells. These are members of the immunoglobulin-like superfamily. TREM1 promotes inflammation, while TREM2 exerts anti-inflammatory effects, thereby maintaining tissue homeostasis during pathological processes. TREM2 is a transmembrane receptor of the immunoglobulin superfamily, consisting of an extracellular domain comprising a type V immunoglobulin domain, a short extracellular region, a transmembrane helix, and a short cytoplasmic tail lacking any signal transduction or transport motifs. TREM2 is primarily expressed in non-parenchymal cells of the liver, such as immature monocyte-derived dendritic cells, certain neutrophils, and tissue-specific macrophages. TREM2 is a receptor that can interact with a variety of ligands, many of which are markers of tissue damage. Therefore, TREM2 is considered a major hub for pathologically induced immune signaling, capable of sensing tissue damage and activating robust immune remodeling. It plays an important role in the progression of Alzheimer's disease (AD), obesity-related metabolic syndrome, and cancers such as hepatocellular carcinoma (HCC) and central nervous system cancers.
[0005] Numerous studies have found that TREM2 can regulate liver disease progression. In experimental toxic liver injury experiments induced by carbon tetrachloride or acetaminophen overdose, TREM2 maintains liver function by inhibiting the recruitment of extrahepatic monocytes / macrophages derived from monocyte chemoattractant protein-1 (MCP-1). In advanced chronic liver disease, TREM2 in Kupffer cells, hepatic stellate cells (HSCs), and tissue-associated macrophages inactivates reactive oxygen species (ROS) and lipid peroxides (LPO), promoting cell survival and combating inflammation. TREM2 has been reported to be highly expressed in liver tissues of HCC patients and mouse-related models, and Trem2 knockout (Trem-2...) is also observed. - / - Mice induced with diethylnitrosamine (DEN) showed more liver tumors, exhibiting more severe liver damage, inflammation, oxidative stress, and hepatocyte proliferation; Trem-2 - / -Mice developed more and larger tumors in a fibrosis-associated HCC model, suggesting that TREM2 plays a protective role in hepatocellular carcinoma development in mice. Studies have found that Trem2 is upregulated in macrophages associated with human metabolic-associated fatty liver disease / metabolic steatohepatitis (MASLD / MASH) and is associated with hepatic steatosis and inflammatory progression. In MASLD mice, knockout of bone marrow Trem2 exacerbates hepatic steatosis and inflammatory responses, while overexpression of Trem2 in mice exhibits the opposite effect. Myeloid Trem2 improves MASLD progression by regulating macrophage pyroptosis and inflammatory resolution. Hendrikx et al. also found increased Trem2 expression in liver tissue of MASH-positive humans or mice, along with elevated systemic soluble Trem2 levels, suggesting that soluble TREM2 levels can be used to differentiate different stages of fatty liver disease in MASLD across two independent clinical cohorts, providing a superior biomarker compared to traditional laboratory parameters. Hou et al. found that in a mouse model of non-alcoholic fatty liver disease-associated sepsis, TREM2 deficiency accelerated the initial progression of the disease and subsequent susceptibility to sepsis; conversely, overexpression of TREM2 in hepatic macrophages improved hepatic energy supply and sepsis prognosis, and played a role in maintaining macrophage-hepatocyte metabolic coordination. + Macrophages play a hepatoprotective role in MASLD and can even reverse acute (acetaminophen) or chronic (carbon tetrachloride) liver injury. Therefore, targeting myeloid Trem2 may be a key point in the treatment of many liver diseases.
[0006] TREM2 is a key signaling center in metabolic syndrome and cancer, making it a popular therapeutic target in many disease studies. One prominent approach is to directly target the receptor's active domain with specific monoclonal antibodies or small molecules to activate downstream signaling; another is to control TREM2 expression levels. In the brain of Alzheimer's disease (AD), TREM2 can directly interact with pathological β-amyloid (Aβ) oligomers, as well as anionic and zwitterionic lipids and lipoproteins / apolipoproteins, forming plaques with Aβ—a hallmark of AD pathology. Therefore, it is believed that TREM2 activation may improve AD. The R47H variant of human TREM2 impairs ligand binding and increases the risk of AD. In a mouse AD model expressing common TREM2 variants (CV) or R47H variants, Wang et al. administered the anti-human TREM2 agonist monoclonal antibody AL002c systemically. Single-cell RNA-seq data showed that AL002c induced microglia proliferation in both CV and R47H transgenic mice. Long-term administration of AL002c reduced filamentous plaques and neurite dystrophy, and alleviated microglial inflammatory responses. Furthermore, several studies have explored the control of TREM2 expression. Glioblastoma (GBM) is an incurable central nervous system (CNS) cancer characterized by extensive myeloid cell infiltration. Single-cell and spatial sequencing have shown that TREM2 is downregulated in GBM-infiltrating myeloid cells. Genetic or pharmacological interventions leading to TREM2 deficiency promote GBM progression in vivo, while adeno-associated virus-mediated TREM2 overexpression inhibits GBM progression and synergizes with anti-PD-1 therapy.
[0007] In screening key autophagy genes in acute alcoholic hepatitis (AH), Yuan et al. identified 11 genes related to AH autophagy, all of which were upregulated, including TREM2. Furthermore, the relative expression level of TREM2 in the liver tissues of AH patients and mice was higher than that in controls, suggesting that TREM2 may play an important role in alcohol metabolism, although its specific function is unclear. Previous experimental data showed a significant decrease in TREM2 in the liver membrane proteins of ASH mice. Further investigation using adeno-associated virus (AAV) to overexpress TREM2 in hepatic macrophages downregulated hepatic steatosis, inflammation, oxidative stress, and ferroptosis in mice, indicating that overexpression of TREM2 in hepatic macrophages can improve ASH. Summary of the Invention
[0008] The purpose of this invention is to provide the application of adeno-associated virus that specifically overexpresses Trem2 in the preparation of drugs to alleviate alcohol-related steatohepatitis.
[0009] The first object of the present invention is to provide the use of a reagent for overexpressing the Trem2 gene in the liver in the preparation of a drug for alleviating alcohol-related steatohepatitis, wherein the nucleotide sequence of the Trem2 gene is shown in SEQ ID NO.1.
[0010] Preferably, the reagent is an adeno-associated virus overexpressing Trem2.
[0011] A further optimization involves inserting Trem2 into an overexpression vector, then coating it with adeno-associated virus to obtain an adeno-associated virus overexpressing Trem2.
[0012] Preferably, the adeno-associated virus is adeno-associated virus AAV8.
[0013] Preferably, the overexpression vector is GV650, and the gene Trem2 is expressed in macrophages under the F4 / 80p promoter.
[0014] The present invention also provides a drug for alleviating alcohol-related steatohepatitis, which contains an active ingredient that induces overexpression of the Trem2 gene in the liver.
[0015] This invention utilizes AAV8 virus subtype-specific infection of liver tissue and the F4 / 80p promoter in the vector GV650 to mediate specific overexpression of the Trem2 gene in macrophages, exploring the therapeutic effect of overexpression of Trem2 in hepatic macrophages on delaying the progression of acute liver injury (ASH). The results showed that liver-specific overexpression of Trem2 increased the antioxidant activity of hepatocytes, reduced apoptosis and programmed ferroptosis levels, and improved hepatic steatosis and inflammatory responses, indicating that high expression of Trem2 has a delaying or protective effect against ASH progression. Attached Figure Description
[0016] Figure 1 This involves the preparation of ASH mice and Trem2 detection;
[0017] A. H&E and Oil Red O staining of mouse liver tissue; B. Serum AST level; C. Serum ALT level; D. Total cholesterol (TC) level in liver tissue; E. Triglyceride (TG) level in liver tissue; F. Relative mRNA expression levels of adipogenesis-related factors Acc, Fasn, and Srebf1 in liver tissue; G. Relative mRNA expression levels of inflammation-related factors Il-6, Tnf-α, Il-1β, and F4 / 80 in liver tissue; H. Protein expression levels of adipogenesis-related factors ACC and FASN, and inflammation-related factors IL-1β and TNF-α in liver tissue; I. Relative mRNA expression level of Trem2 in liver tissue; J. Protein expression level of TREM2 in liver tissue membrane proteins. Note: Pair-fed refers to mice fed a control liquid diet; EtOH-fed refers to mice fed an alcoholic liquid diet.
[0018] Figure 2 Liver-specific overexpression of Trem2 alleviates liver damage and lipid deposition in ASH mice.
[0019] A. TREM2 protein expression in liver tissue membrane proteins; B. Serum AST level; C. Serum ALT level; D. TC and TG levels in liver tissue; E. H&E and Oil Red O staining of liver tissue; F. SOD activity level in liver tissue. Note: Pair-fed refers to mice fed a control liquid diet and injected with physiological saline; AAV8-Vector refers to ASH mice injected with the control vector adeno-associated virus; AAV8-Trem2 refers to ASH mice injected with Trem2-overexpressing adeno-associated virus.
[0020] Figure 3 Liver-specific overexpression of Trem2 in mice reduces hepatic steatosis and inflammatory response in ASH mice.
[0021] A. Relative mRNA expression levels of adipogenesis-related factors Acc, Fasn, and Srebf1 in liver tissue; B. Protein levels of ACC and FASN in liver tissue; C. F4 / 80 expression in liver tissue detected by IHC; D. IHC plot quantifying F4 / 80; E. Relative mRNA expression levels of inflammation-related factors F4 / 80, TNF-α, Il-6, and Il-1β in liver tissue; F. Protein levels of TNFα and IL-1β in liver tissue. Note: Pair-fed refers to mice fed a control liquid diet and injected with physiological saline; AAV8-Vector refers to ASH mice injected with the control vector adeno-associated virus; AAV8-Trem2 refers to ASH mice injected with Trem2-overexpressing adeno-associated virus.
[0022] Figure 4 Liver-specific overexpression of Trem2 in mice reduces hepatocyte apoptosis and ferroptosis in ASH mice.
[0023] A. TUNEL staining and quantification of liver tissue; C. Protein expression levels of apoptosis-related factors (CASP3, CASP8, CASP9) in liver tissue; D. Protein expression levels of ferroptosis-related factors (ACSL4, HO-1, GPX4) in liver tissue. Note: Pair-fed refers to mice fed a control liquid diet and injected with physiological saline; AAV8-Vector refers to ASH mice injected with the control vector adeno-associated virus; AAV8-Trem2 refers to ASH mice injected with Trem2-overexpressing adeno-associated virus. Detailed Implementation
[0024] The following embodiments are further illustrations of the present invention, but not limitations thereof.
[0025] Example 1:
[0026] I. Experiment Content:
[0027] 1. Preparation of ASH mice and detection of TREM2 expression.
[0028] ASH mice were constructed using the NIAAA method. After completion, serum was collected to detect liver function indicators (AST and ALT), triglycerides, and inflammatory factors. Fresh liver tissue was frozen sectioned and stained with Oil Red O to detect steatosis. Liver tissue was prepared into paraffin blocks and stained with H&E to examine liver morphology. Total RNA and protein were collected from mouse liver tissue to detect the expression levels of lipid metabolism-related genes and inflammatory factors. Total RNA and membrane proteins from liver tissues of the experimental and control groups were collected for quantitative RT-PCR and Western blotting to detect Trem2 expression levels.
[0029] 2. Specific overexpression of Trem2 in liver tissue macrophages improves ASH in mice.
[0030] Trem2 was overexpressed in mouse hepatic macrophages using adeno-associated virus (AAV8-Trem2), with AAV8-Vector as a control. One week after injection, mice were fed an ethanol-based liquid diet, and modeling was performed according to the NIAAA method. Serum and liver tissue were collected afterward to detect liver function (AST and ALT), oxidative stress, etc. Fresh liver tissue was frozen sectioned and stained with Oil Red O to detect steatosis; liver tissue was prepared into paraffin blocks, and liver morphology was analyzed using H&E; RNA and proteins were extracted from liver tissue, and the expression of genes related to lipid metabolism, inflammation, apoptosis, and ferroptosis was detected to explore the ameliorative effect of Trem2 overexpression in hepatic macrophages on liver function, hepatic steatosis, and inflammation in ASH mice.
[0031] II. Experimental Methods:
[0032] 1. ASH mouse model: Following the NIAAA method (Bertola A, Mathews S, Ki SH, et al. Mouse model of chronic and binge ethanol feeding (the NIAAA model)[J]. Nat Protoc, 2013, 8(3):627-637), each group consisted of 8 female C57BL / 6 wild-type mice, approximately 8-10 weeks old and weighing about 20 grams. The procedure was as follows: all purchased mice were fed a normal diet for 3 days, followed by acclimatization feeding with liquid feed for 2 days, and then randomly divided into cages of 2 mice each. The control group (Pair-fed group) mice were fed the control liquid diet; the alcohol experimental group (EtOH-fed group) was first fed with Lieber-DeCarli liquid diet with alcohol concentrations of 1%, 2%, and 4% (V / V) for one day each, and then continuously fed with 5% alcohol liquid diet for 10 days; all feeding times were in the evening, and the amount of food fed on the day was adjusted according to the previous day's diet. The amount of food fed to the control group was adjusted according to the experimental group (because the alcohol group mice consumed less food). On the morning of the sampling day, between 7 and 9 a.m., mice were administered maltodextrin via gavage using a 1 mL injection. The Pair-fed group mice were administered maltodextrin at a final concentration of 45% (wt / v) or 0.45 g / ml (both methods are acceptable but should not be mixed), while the EtOH-fed group mice were administered 31.5% (v / v) alcohol via gavage. The gavage volume for each mouse was calculated at 20 μl / g body weight. Subsequently, the mice were placed in their original cages in a warm room. After fasting for 8-9 hours, the mice were anesthetized with isoflurane, their weight was weighed and recorded, and finally, blood from the eyeballs and liver tissue were collected.
[0033] 2. Preparation of mouse liver-specific overexpression of Trem2 and ASH models:
[0034] 1) Preparation of adeno-associated virus (AAV8-Trem2) targeting Trem2 overexpression in liver macrophages: This was commissioned to Shanghai Jikai Company. The overexpression vector was GV650 (Thermo Fisher Scientific), and the vector element was pAAV-F4 / 80p-MCS-EGFP-3Flag-SV40PolyA. The mouse gene Trem2 (its nucleotide sequence is shown in SEQ ID NO.1) was ligated into the MCS (multiple cloning site) of GV650 to construct the GV650-Trem2 overexpression plasmid. An empty GV650 vector was used as a control.
[0035] The constructed plasmid GV650-Trem2 and the empty vector GV650 were coated with adeno-associated virus (AAV8) to generate AAV8-Trem2 and AAV8-Vector viral particles, respectively, thus obtaining AAV8-Trem2 and AAV8-Vector. AAV8 is a viral subtype that specifically infects liver tissue. The overexpression vector GV650 utilizes the F4 / 80p promoter to mediate the specific expression of the Trem2 gene in macrophages.
[0036] 2) Preparation of ASH mice overexpressing Trem2. Ten-week-old female C57BL / 6 mice were fed a normal diet for 3 days and then divided into groups of 8. Recombinant virus (AAV8-Trem2) and control virus (AAV8-Vector) were diluted with physiological saline and injected intravenously into the experimental and control groups, respectively. The viral load per mouse was 1.5 × 10⁻⁶. 11 The virus (vg) was diluted with 0.2 mL of physiological saline. Mice were injected with the virus and fed a normal diet and sterile water for one week. After one week, the mice were fed an ethanol-based liquid diet, and modeling was performed according to the NIAAA method. ASH mice were administered 31.5% (v / v) alcohol by gavage at a dose of 20 μl / g per mouse before sampling, followed by fasting for 8-9 hours. Control group (Pair-fed group) mice were injected with an equal volume of physiological saline via tail vein and fed a normal diet and sterile water for one week; after one week, they were fed a control liquid diet; on the morning of sampling, they were administered 45% (wt / v) maltodextrin by gavage at a dose of 20 μl / g body weight.
[0037] 3. TREM2 protein level detection: Membrane proteins were extracted from liver tissue using the PC202 cell membrane protein / plasma protein extraction kit and then subjected to Western blot reaction.
[0038] 4. Paraffin embedding of liver tissue: Left lateral lobe liver tissue from mice was placed in approximately 6 ml of 10% neutral formalin solution and fixed at room temperature for approximately 24 hours, but not exceeding 48 hours, followed by placement in 75% ethanol. The liver tissue was then dehydrated using a dehydrator and finally embedded in paraffin.
[0039] 5. Detection of liver tissue apoptosis: Paraffin-embedded liver tissue samples were obtained and sectioned to a thickness of 4 μm. The apoptosis was detected using the One-step TUNEL In Situ Apoptosis Kit (Green, Elab). In situ apoptosis detection was performed using 488)(Elabscience, E-CK-A321), following the reagent instructions.
[0040] 6. Immunohistochemical (IHC) detection: Paraffin-embedded liver tissue samples were cut into 4μm thick sections and processed according to the IHC procedure, with F4 / 80 antibody used as the primary antibody.
[0041] III. Experimental Results:
[0042] 1. Preparation of ASH mice and detection of TREM2 expression
[0043] ASH mice were prepared according to the NIAAA method. The control group (Pair-fed) was fed a control liquid diet, while the alcohol group (EtOH-fed) was fed an alcoholic liquid diet. After H&E staining of paraffin-embedded liver tissue samples, the vacuolation of liver lipid droplets was more pronounced in the EtOH-fed group than in the Pair-fed group. Similar results were obtained from Oil Red O staining of fresh liver tissue. Figure 1 A); Compared with the control group, the serum aspartate aminotransferase (AST) and alanine aminotransferase (ALT) levels of mice in the EtOH-fed group were significantly increased, and the levels of triglycerides (TG) and total cholesterol (TC) in liver tissue were also increased. Figure 1 B-1E); Total RNA was extracted from mouse liver tissue, and the relative mRNA expression levels of lipid synthesis-related factors and inflammation-related factors were detected by qRT-PCR. It was found that the EtOH-fed group had higher levels of Acc (acetyl-CoA carboxylase), Fasn (fatty acid synthase), Srebf1 (sterol regulatory element-binding transcription factor 1), interleukin-6 (Il-6), tumor necrosis factor-α (Tnf-α), interleukin-1β (Il-1β), and F4 / 80 than the control group. Protein detection also showed a similar trend. Figure 1 These results indicate that alcohol-induced liver damage in mice leads to lipid deposition and inflammation in the liver.
[0044] Furthermore, total RNA was extracted from 0.1 g of mouse liver tissue and reverse transcribed into first strand. Real-time quantitative PCR detection revealed that the relative expression level of Trem2 mRNA in the liver tissue of alcohol-fed mice was lower than that in the control group. Membrane proteins were extracted from liver tissue using a kit and Western blot analysis showed that TREM2 protein was also reduced in the EtOH-fed group. Figure 1 These data indicate that alcohol downregulates TREM2 expression in mouse liver tissue.
[0045] 2. Specific overexpression of Trem2 in hepatic macrophages reduces liver injury and lipid deposition in ASH mice.
[0046] To investigate the role of Trem2 in the progression of acute liver injury (ASH) in mice, ASH was induced using mice overexpressing Trem2 (AAV8-Trem2) in hepatic macrophages, with AAV8-Vector serving as a control. A pair-fed control group was fed a liquid diet and injected with physiological saline. After sampling, hepatic steatosis, oxidative stress, inflammation, and apoptosis factors in the mouse liver tissue were measured. Figure 2 , Figure 3 , Figure 4 ).
[0047] After modeling, membrane proteins from mouse liver tissue were subjected to Western blot analysis. Compared with Pair-fed mice, TREM2 expression was significantly decreased in the AAV8-Vector group of ASH mice; while TREM2 expression was increased in ASH mice overexpressing Trem2. Figure 2 A). Serum samples from mice were used to detect liver damage markers. Compared to the Pair-fed group, the AAV8-Vector group showed significantly increased ALT and AST, while the AAV8-Trem2 group showed decreased ALT and AST. Figure 2 (BC). The kit detected triglyceride (TC) and total cholesterol (TG) levels in mouse liver tissue. The results showed that compared with the pair-fed group, both TC and TG levels increased in the alcohol-fed group, but were downregulated in the AAV8-Trem2 treatment group compared to AAV8-Vector. H&E and Oil Red O staining results of mouse liver tissue indicated that, compared with the pair-fed group, lipid deposition was more severe in the liver tissue of the AAV8-Vector group under alcohol stimulation, while overexpression of Trem2 reduced the size of fat vesicles and the number of oil droplets in the liver tissue. Figure 2 DE). Frozen liver tissue was homogenized, and superoxide dismutase (SOD) activity was detected using a kit. The results showed that SOD activity in the liver of mice in the AAV8-Trem2 group was increased compared with that in the AAV8-Vector group. Figure 2 F). These results indicate that specific overexpression of Trem2 in mouse liver tissue can improve alcohol-induced liver injury and steatosis, and increase antioxidant activity.
[0048] 3. Hepatic macrophage-specific overexpression of Trem2 reduces hepatic lipid synthesis and inflammation levels in ASH mice.
[0049] 0.1g of mouse liver tissue was collected, frozen and ground, and total RNA was extracted. After reverse transcription, qPCR was performed to detect the mRNA levels of lipid synthesis metabolism and inflammatory factors. It was found that the relative expression levels of Acc, Fasn, and Srebf1 mRNA in the AAV8-Trem2 group were lower than those in the control group. Figure 3A); Western blot analysis of liver tissue revealed that, compared to the Pair-fed group, the AAV8-Vector group showed increased expression of ACC and FASN, while the AAV8-Trem2 group showed decreased expression. Figure 3 B). Paraffin-embedded sections of mouse liver tissue were obtained and subjected to immunohistochemical analysis. The results showed that the positive area of F4 / 80 in the AAV8-Vector group was greater than that in the Pair-fed group, while the positive area of F4 / 80 in the AAV8-Trem2 group was less than that in the AAV8-Vector group. Figure 3 CD). Expression of inflammatory factors such as F4 / 80, Tnf-α, and Il-1β in liver tissue was detected, and it was found that the AAV8-Trem2 group had lower levels than the AAV8-Vector group, while Il-6 showed no significant change. Protein detection yielded similar results. Figure 3 These results indicate that specific overexpression of Trem2 on mouse hepatic macrophages reduces hepatic fat synthesis and inflammatory response in ASH mice.
[0050] 4. Specific overexpression of Trem2 in hepatic macrophages reduces hepatocyte apoptosis and ferroptosis in ASH mice.
[0051] Paraffin-embedded sections of mouse liver tissue were used to detect cell apoptosis. Figure 4 As shown in A and 4B, apoptosis was minimal in the Pair-fed group, increased in the AAV8-Vector group, and lower in the liver tissue of ASH mice in the AAV8-Trem2 group compared to the AAV8-Vector group. Analysis of total protein from mouse liver tissue for apoptosis-related markers revealed that the AAV8-Vector group had higher levels of apoptosis-related caspase-3, caspase-8, and caspase-9 than the Pair-fed group, while the AAV8-Trem2 group had lower levels than the AAV8-Vector group. Figure 4C). In addition, we also detected ferroptosis-related factors in liver tissue, such as heme oxygenase 1 (HO-1), selenoprotein glutathione peroxidase 4 (GPX4), and acyl-CoA synthase long chain family member 4 (ACSL4 / FACL4). GPX4 is a major regulator of ferroptosis, converting lipid hydroperoxides into non-toxic lipid alcohols, thereby preventing ferroptosis. Heme oxygenase plays an important biological role in antioxidant, anti-inflammatory, and cytoprotective functions. ACSL4 is an important component in the process of ferritin deposition. Western blot results showed that compared with the pair-fed group, ACSL4 levels were increased in ASH mice injected with AAV8-Vector, while ACSL4 levels were downregulated in the liver tissue of ASH mice overexpressing Trem2. The expression of GPX4 and HO-1 in ASH mice injected with AAV8-Vector was lower than that in the pair-fed group. Overexpression of Trem2 increased the levels of GPX4 and HO-1 in the liver tissue of ASH mice. Figure 4 D). These results indicate that overexpression of Trem2 in mouse liver macrophages can reduce alcohol-induced apoptosis and ferroptosis.
[0052] In summary, chronic and excessive alcohol intake can damage liver function, worsen hepatic steatosis and inflammatory response, while liver-specific overexpression of Trem2 can increase antioxidant activity, reduce apoptosis and programmed ferroptosis levels, and improve hepatic steatosis and inflammatory response, indicating that overexpression of Trem2 in hepatic macrophages has a delaying or protective effect on the progression of ASH.
[0053] Gene name: Trem2, Gene description: Mus musculus triggering receptor expressed on myeloid cells2 (Trem2)
[0054] SEQ ID NO.1
[0055] ATGGGACCTCTCCACCAGTTTCTCCTGCTGCTGATCACAGCCCTGTCCCAAGCCCTCAACACCACGGTGCTGCAGGGCATGGCCGGCCAGTCCTTGAGGGTGTCATGTACTTATGACGCCTTGAAGCACTGGGGGAGACGCAAGGCCTGGTGTCGGCAGCTGGGTGAGGAGGGCCCATGCCAGCGTGTGGTGAGCACACACGGTGTGTGGCTGCTGGCCTTCCTGAAGAAG CGGAATGGGAGCACAGTCATCGCAGATGACACCCTTGCTGGAACCGTCACCATCACTCTGAAGAACCTCCAAGCCGGTGACGCGGGCCTCTACCAGTGTCAGAGTCTCCGAGGCCGAGAGGCTGAGGTCCTGCAGAAAGTACTGGTGGAGGTGCTGGAGGACCCTCTAGATGACCAAGATGCTGGAGATCTCTGGGTCCCCGAGGAGTCATCGAGTTTCGAGGGTGCCCAAGTGGAACACAGCACCTCCAGGCAGGTTTCATCCTGTGGGTCACCTCTAGCCTACCACCTTCCTCCTCTTTCCAAGGAATCAAGAGACCTCCTTCCCACCCACCTCCATTCTTCTCCTCCTGGCCTGCGTTCTCCTGAGCAAGTTTCTTGCAGCCAGCATCCTCTGGGCTGTGGCCAGGGGCAGGCAGAAGCCGGGAACACCTGTGGTCAGAGGGCTGGACTGTGGCCAAGATGCTGGGCACCAACTTCAGATCCTCACTGGACCCGGAGGTACGTGAGAGAATTCTGA。
Claims
1. The application of a reagent for overexpressing the Trem2 gene in the liver in the preparation of a drug to alleviate alcohol-related steatohepatitis, wherein the nucleotide sequence of the Trem2 gene is shown in SEQ ID NO.
1.
2. The application according to claim 1, characterized in that, The reagent described is an adeno-associated virus overexpressing Trem2.
3. The application according to claim 2, characterized in that, The adeno-associated virus overexpressing Trem2 is obtained by inserting the Trem2 gene into an overexpression vector and then coating it with adeno-associated virus.
4. The application according to claim 2 or 3, characterized in that, The adeno-associated virus mentioned is adeno-associated virus AAV8.
5. The application according to claim 3, characterized in that, The overexpression vector is GV650, and the gene Trem2 is expressed in macrophages under the F4 / 80p promoter.
6. A drug for alleviating alcohol-related steatohepatitis, characterized in that, It contains a reagent that induces overexpression of the Trem2 gene in the liver as its active ingredient.