The invention discloses a high-yield 3apos; genetic engineering strain of-deoxyadenosine and application thereof

By optimizing the growth performance and precursor supply of yeast strains through genetic modification and metabolic regulation, the yield of 3'-deoxyadenosine was significantly increased, solving the problem of low efficiency in traditional synthesis methods and realizing efficient and stable industrial production.

CN120944725APending Publication Date: 2025-11-14NANJING TECH UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202511124798.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2025-05-21
Filing Date
2025-08-12
Publication Date
2025-11-14

AI Technical Summary

Technical Problem

Traditional methods for synthesizing 3'-deoxyadenosine are costly and inefficient. There is room for optimization in the regulation of the metabolic network of the microbial host, resulting in yields and conversion rates that are difficult to meet the needs of industrial production.

Method used

By genetically modifying and overexpressing the ribonucleotide reductase gene rnr1, inactivating the adenosine kinase gene ado1, the adenine deaminase gene aah1, and the ribonuclease gene rny1, and combining it with the inactivation of the repressive vacuolar alkaline phosphatase gene pho8, the growth performance and precursor supply of the strain were optimized. Hypoxanthine was used to replace adenine as a substrate, and the substrate metabolic kinetics were precisely matched by an intermittent feeding strategy.

Benefits of technology

It significantly increased the yield of 3'-deoxyadenosine to 20.58 g/L, forming a technological barrier driven by both gene and process, and providing an efficient, stable, and low-cost solution for the industrial production of nucleoside compounds.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120944725A_ABST
    Figure CN120944725A_ABST
Patent Text Reader

Abstract

The invention discloses a gene engineering strain with high yield of 3 '-deoxyadenosine and application of the gene engineering strain, and belongs to the technical field of gene engineering. The genetic engineering strain is obtained by carrying out genetic modification on the strain, and the genetic modification comprises at least one of the following steps: a) overexpressing a ribonucleotide reductase gene rnr1; b) inactivating / weakening an adenosine kinase gene ad1; c) inactivating / weakening the adenine deaminase gene aah1; d) overexpressing a ribonuclease gene rny1; and e) an inactivation / weakening inhibition type vacuolar alkaline phosphatase gene pho8. According to the method, substrate metabolism kinetics is accurately matched in combination with an intermittent feeding strategy, finally, the yield of 3 '-deoxyadenosine reaches 20.58 g / L and reaches the highest yield reported at present, a'gene-process' dual-drive technical barrier is formed, and an efficient, stable and low-cost solution is provided for industrial production of nucleoside compounds.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, specifically to a genetically engineered strain that produces high levels of 3'-deoxyadenosine and its applications. Background Technology

[0002] 3'-Deoxyadenosine, also known as cordycepin or cordycepin, is a nucleoside antibiotic with various pharmacological activities. However, traditional synthetic methods such as chemical synthesis and natural extraction suffer from high costs and low efficiency, limiting its widespread application. In recent years, the biosynthesis of 3'-deoxyadenosine using microbial cell factories has shown promising development prospects. However, in practical applications, there is still room for optimization in the regulation of the metabolic network of the microbial host: on the one hand, the synthesis of 3'-deoxyadenosine in microorganisms involves multiple metabolic pathways, with related enzymes randomly distributed intracellularly, and intermediate products requiring long-distance diffusion, resulting in insufficient precursor supply and limited metabolic flux; on the other hand, there is often a competitive relationship between the growth performance of the strain and product accumulation, making it difficult to improve production efficiency. Especially for eukaryotic expression systems such as yeast, although they possess complete post-translational modification capabilities, their complex metabolic regulatory networks make it difficult for the product yield and conversion rate to meet the needs of industrial production. These factors together lead to the limited accumulation of 3'-deoxyadenosine in microbial hosts, becoming a major technical obstacle restricting its industrial production. Therefore, how to regulate the growth performance of strains and optimize precursor supply to promote the biosynthesis of 3'-deoxyadenosine is a problem that needs to be solved by those skilled in the art. Summary of the Invention

[0003] The purpose of this invention is to provide a genetically engineered strain that produces high levels of 3'-deoxyadenosine and its applications. By optimizing the strain's growth performance and precursor supply through multi-gene regulation, the yield of 3'-deoxyadenosine is significantly increased, making it suitable for industrial production.

[0004] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0005] This invention provides a genetically engineered strain that produces high levels of 3'-deoxyadenosine, obtained through genetic modification of the strain, wherein the genetic modification includes at least one of the following:

[0006] a) Overexpress the ribonucleotide reductase gene rnr1;

[0007] b) Inactivate / weaken the adenosine kinase gene ado1;

[0008] c) Inactivate / weaken the adenine deaminase gene aah1;

[0009] d) Overexpression of the ribonuclease gene rny1;

[0010] e) Inactivation / weakening of the repressive vacuole alkaline phosphatase gene pho8.

[0011] Preferably, the genetically modified strains include strains capable of naturally producing 3′-deoxyadenosine and host strains containing exogenously introduced key enzymes for 3′-deoxyadenosine synthesis; the host strains include, but are not limited to, filamentous fungi and yeasts, and the yeasts include, but are not limited to, *Saccharomyces cerevisiae*, *Pichia pastoris*, and *Yersinia lipolytica*. *Saccharomyces cerevisiae* BY4742 is preferred, containing exogenously introduced key enzymes for 3′-deoxyadenosine synthesis (ketodeoxyadenosine reductase and adenosine dephosphatase).

[0012] Preferably, the genetic modification further includes modifying the strain to encode a protein with the same catalytic function, with a protein sequence similarity greater than 50%, 60%, 70%, 80%, 90%, 95%, or 98%.

[0013] Preferably, the ribonuclease gene rnr1 and the ribonuclease gene rny1 are expressed by any one of the strong promoters PGK1, TEF1, GPD, TPI1, ADH1 or TDH3, with TDH3 being preferred.

[0014] This invention also provides the application of the above-mentioned genetically engineered strain in the preparation of 3'-deoxyadenosine. 3'-Deoxyadenosine is prepared from the fermentation culture of the genetically engineered strain constructed in this invention.

[0015] Preferably, the method for preparing 3'-deoxyadenosine includes: inoculating the genetically engineered strain into a fermentation medium and fermenting it at 20-40°C for 48-220 h; wherein the fermentation medium comprises 10-100 g / L of carbon source, 10-50 g / L of nitrogen source, 0-15 g / L of adenine and 0-15 g / L of hypoxanthine.

[0016] More preferably, the carbon source is glucose, and the nitrogen source is yeast extract and / or peptone.

[0017] More preferably, all strains with inactivated / weakened adenine deaminase gene aah1 used hypoxanthine instead of adenine as a substrate for fermentation, with a hypoxanthine concentration of 0.1–15 g / L.

[0018] Preferably, the method for preparing 3'-deoxyadenosine includes: activating and culturing the genetically engineered strain, then inoculating it into a 5L fermenter containing fermentation medium. The parameters of the 5L fermenter are controlled as follows: 28–30°C, stirring speed 200–1000 rpm, aeration rate 2–7, liquid volume 1–3L, pH 4–7, dissolved oxygen maintained at 1–70%. More preferably, the temperature is 30°C, stirring speed 600 rpm, aeration rate 6, liquid volume 2L, pH 5.5 ± 0.1, and dissolved oxygen maintained at 30%. After the carbon source in the fermentation broth is depleted, intermittent feeding is carried out. During the feeding process, the carbon source concentration in the fermentation broth is maintained at 0-15 g / L, and the fermentation is carried out for 220 h. The fermentation medium includes 50 g / L glucose, 10 g / L yeast extract, 20 g / L peptone, 1 g / L adenine, and 1 g / L hypoxanthine. The feeding medium used is 200-600 g / L glucose, 0-15 g / L adenine, and 0-15 g / L hypoxanthine, more preferably 400 g / L glucose, 3 g / L adenine, and 3 g / L hypoxanthine.

[0019] The above fermentation process can increase the cell density (in terms of OD) of genetically engineered strains. 600 The measured value was above 30.

[0020] More preferably, the genetically engineered strain is obtained by genetically modifying Saccharomyces cerevisiae BY4742 containing a key enzyme for the synthesis of exogenously introduced 3′-deoxyadenosine. The genetic modification involves overexpressing the ribonuclease gene rnr1 and the ribonuclease gene rny1 while simultaneously inactivating / weakening the adenosine kinase gene ado1, the adenine deaminase gene aah1, and the repressed vacuolar alkaline phosphatase gene pho8.

[0021] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in:

[0022] (1) This invention significantly improves the growth performance of the strain by expressing the ribonucleotide reductase gene and inactivating / weakening the adenosine kinase gene, thereby increasing the biomass and stress resistance of the strain during fermentation.

[0023] (2) This invention significantly improves the supply efficiency of the precursor by inactivating / weakening the adenine deaminase gene, overexpressing the ribonuclease gene, and inactivating the repressive vacuolar alkaline phosphatase gene;

[0024] (3) By combining the intermittent feeding strategy to accurately match the substrate metabolic kinetics, the yield of 3'-deoxyadenosine reached 20.58 g / L, which is the highest yield reported to date. This forms a technical barrier driven by both gene and process, providing an efficient, stable and low-cost solution for the industrial production of nucleoside compounds. Attached Figure Description

[0025] Figure 1 The yield of 3'-deoxyadenosine in single-gene and combined-gene modifications in Examples 1, 3, 4, 5 and 6.

[0026] Figure 2 The yield of 3'-deoxyadenosine after fed-batch fermentation of recombinant strain B5U3-20 in a 5L fermenter in Example 7.

[0027] Figure 3 This refers to the precipitation of 3'-deoxyadenosine crystals from the fermentation broth in Example 7. Detailed Implementation

[0028] The present invention can be better understood from the following embodiments. However, those skilled in the art will readily understand that the descriptions in the embodiments are for illustrative purposes only and should not, and will not, limit the invention as detailed in the claims.

[0029] Example 1: Preliminary verification of the effectiveness of five gene modifications (single gene modification)

[0030] In this application, the EC number (Enzyme Commission number) for ribonucleotide reductase is 1.17.4.1; the EC number for adenosine kinase is 2.7.1.20; the EC number for adenine deaminase is 3.5.4.2; the EC number for ribonuclease is 4.6.1.19; and the EC number for repressed vacuole alkaline phosphatase is 3.1.3.1.

[0031] RNR1 is the core catalytic subunit of ribonucleotide reductase, responsible for reducing ribonucleotides (NTPs) to deoxyribonucleotides (dNTPs). Overexpression of rnr1 can accelerate cell cycle progression and shorten doubling time, thereby improving the growth performance of the strain and increasing biomass.

[0032] ADO1 catalyzes the phosphorylation of adenosine to produce adenosine monophosphate (AMP), while simultaneously consuming ATP to generate ADP. This reaction is a core step in the purine nucleotide salvage pathway, responsible for recovering free adenosine to maintain the intracellular AMP / ADP / ATP balance. 3'-Deoxyadenosine is structurally highly similar to adenosine but lacks a 3'-hydroxyl group (3'-OH). When 3'-deoxyadenosine enters the cell, ADO1 phosphorylates it to produce 3'-deoxyadenosine monophosphate (3'-dAMP), which can be further phosphorylated to form 3'-deoxyadenosine triphosphate (3'-dATP). 3'-dATP, as an ATP analog, can competitively bind to RNA polymerase and participate in mRNA chain elongation. However, due to the absence of 3'-OH, phosphodiester bonds cannot be formed, leading to premature termination of mRNA synthesis (chain termination effect). This can inhibit the mRNA synthesis of key genes, causing cellular metabolic disorders; abnormal nucleotides can be incorporated into the DNA chain, interfering with replication and repair; and ineffective phosphorylation consumes ATP, exacerbating the intracellular energy crisis. This toxicity mechanism is the core reason why 3'-deoxyadenosine has antitumor and antiviral activities, but it also has a negative impact on the host strain itself, limiting its survival rate and final yield in high-concentration fermentation. Therefore, knocking out the ado1 gene can improve the growth performance and product tolerance of engineered strains by blocking the 3'-deoxyadenosine autotoxicity pathway and optimizing energy metabolism and nucleotide balance.

[0033] AAH1 catalyzes the deamination of adenine to inosine. When adenine is used as a substrate, it can be utilized via both direct salvage and indirect deamination pathways. To block the precursor loss caused by deamination, AAH1 was knocked out, but this resulted in a decrease of approximately 50% in 3'-deoxyadenosine production. Further metabolic analysis revealed that excessive adenine accumulation after AAH1 knockout triggered feedback inhibition of AMP and oxidative stress. Therefore, a strategy of replacing adenine with inosine was adopted, which both circumvented the deamination pathway and eliminated metabolic inhibition.

[0034] Rny1 can hydrolyze RNA in vacuoles to generate 3'-AMP (a precursor for the synthesis of 3'-deoxyadenosine), therefore overexpression of rny1 can optimize the supply of 3'-deoxyadenosine precursors;

[0035] Pho8 catalyzes the conversion of 3'-NMP to nucleosides. Therefore, knocking out this gene can block the degradation pathway of 3'-deoxyadenosine precursor (3'-AMP), reduce the ineffective loss of intermediate products, and thus improve the synthesis efficiency of 3'-deoxyadenosine.

[0036] The primer sequences used in this embodiment for single-gene modification and verification are shown in Table 1.

[0037] Table 1. Sequences of primers used in this embodiment.

[0038]

[0039]

[0040]

[0041] Using the engineered Saccharomyces cerevisiae strain B5U3 (filed on March 12, 2025, application number 202510290708.3, entitled "A highly efficient Saccharomyces cerevisiae strain for cordycepin synthesis and its construction method and application", with the accompanying prior application 202510654077.9 "Certificate guaranteeing the release of biological materials to the public within twenty years from the application date") as the starting strain (3'-deoxyadenosine yield of 2.92 g / L), the effectiveness of overexpressing the ribonucleotide reductase gene rnr1 was verified.

[0042] Using the genome of Saccharomyces cerevisiae BY4742 as a template, the ribonucleotide reductase gene rnr1 was amplified using primers RNR1-F / RNR1-R. The promoter sequence TDH3 was amplified using primers TDH3-RNR1-F / TDH3-RNR1-R, and the terminator sequence ADH1 was amplified using primers ADH1-F / ADH1-R. The fragments obtained by the above amplification were then overlapped using primers TDH3-RNR1-F / ADH1-R to obtain the rnr1 expression cassette. The homologous fragment X-3 at the X-3 site was integrated into the genome of the *Saccharomyces cerevisiae* strain without affecting its growth. Using the genome of *Saccharomyces cerevisiae* BY4742 as a template, the upper homologous fragment X-3-up at the X-3 site was amplified using primers X-3-up-F / X-3-up-R, and the lower homologous fragment X-3-down at the X-3 site was amplified using primers X-3-down-F / X-3-down-R. Then, using primers X-3-up-F / X-3-down-R, the upper homologous fragment X-3-up, the lower homologous fragment X-3-down, and the rnr1 expression cassette were overlapped to obtain the rnr1 expression cassette with homologous fragments. The relevant primer sequences are shown in Table 1.

[0043] The N20 sequence at the X-3 site is CTAATGTGTCCGCGTTTCTA. N20 primers were designed as X-3-F / X-3-R, with primer sequences shown in Table 1. Annealing amplification was performed using these primers as templates. The 10 μL reaction mixture consisted of: 1 μL X-3-F, 1 μL X-3-R, 1 μL 10× ligase buffer, and 7 μL ddH2O. The PCR program was 94℃ for 5 min. After annealing amplification, the mixture was diluted 10-fold to obtain the N20 fragment. The N20 fragment was then ligated overnight with the linear vector fragment pCas9-Hyg using Novizan's T4 ligase. The ligation product was heat-shocked into Trans1T1 competent cells, cultured overnight, and transformants were picked for sequencing. The final CRISPR / Cas9 tool plasmid pCas9-Hyg-X-3 was obtained.

[0044] The B5U3 strain was cultured at 30℃ for 48 hours. Single colonies were picked and activated to prepare competent cells. The pCas9-Hyg-X-3 plasmid and the rnr1 expression cassette containing the X-3 site homolog were transformed using electroporation at a ratio of 300 ng: 1500 ng. Transformants were screened using yeast extract peptone dextrorose (YPD) solid medium containing 400 mg / L hygromycin (HygR). Transformants were verified by PCR. The verified strain was inoculated into fermentation medium and named B5U3-1. The fermentation medium consisted of 50 g / L glucose, 10 g / L yeast extract, 20 g / L peptone, and 1 g / L adenine. The culture was carried out at 30℃ and 220 rpm for 144 hours.

[0045] The production of 3'-deoxyadenosine was detected using high-performance liquid chromatography (HPLC). The method for analyzing 3'-deoxyadenosine was as follows: 3'-deoxyadenosine in the fermentation broth supernatant was separated and quantitatively determined using an Agilent 1260 Infinity II HPLC system equipped with a UV detector (VWD). The chromatographic column was a ZORBAX SB-Aq, the mobile phase was 2% acetonitrile and 98% 3‰ trifluoroacetic acid, the flow rate was 0.8 mL / min, the column temperature was set to 40℃, and the absorbance was 260 nm. The sample was centrifuged at 13000 rpm for 5 min, and the supernatant was filtered through a 0.22 μm membrane to remove impurities before analysis. The yield of strain B5U3-1 was 3.29 g / L (results are shown in the figure). Figure 1 As shown), where the OD of B5U3 is... 600 The OD of B5U3-1 is 30.8. 600 The result increased to 36.4, demonstrating the effectiveness of overexpressing rnr1 to increase biomass, thereby promoting the production of 3'-deoxyadenosine.

[0046] 1. Using strain B5U3 as the starting strain, verify whether the inactivation of the adenosine kinase gene ado1 is effective.

[0047] Using the genome of *Saccharomyces cerevisiae* strain BY4742 as a template, PCR was performed using primers ADO1-knockout-up-F / ADO1-knock out-up-R to amplify the upper homologous arm sequence deleting ado1. The lower homologous arm sequence deleting ado1 was obtained using primers ADO1-knock out-down-F / ADO1-knock out-down-R. Using the upper and lower homologous arm sequences as templates, the ADO1-knock out-up-F / ADO1-knock out-down-R primers were overlapped to obtain the homologous fragment inactivated by ado1. The primer sequences used are shown in Table 1. The N20 sequence of ado1 was selected as AAGACTGTCATCTTCACCCA. Its N20 primers, ADO1-F / ADO1-R, were designed, and their sequences are shown in Table 1. The plasmid pCas9-Hyg-ADO1 was obtained using the same construction method as described above. The ado1 gene was inactivated using the same transformation method described above, resulting in recombinant strain B5U3-2. Following the same fermentation and detection methods, the 3'-deoxyadenosine yield of recombinant strain B5U3-2 was 3.38 g / L (results are shown below). Figure 1 (As shown).

[0048] 2. Using strain B5U3 as the starting strain, verify whether inactivating the adenine deaminase gene aah1 is effective.

[0049] Using the genome of *Saccharomyces cerevisiae* strain BY4742 as a template, PCR was performed using primers AAH1-knockout-up-F / AAH1-knock out-up-R to amplify the upper homologous arm sequence deleting aah1. The lower homologous arm sequence deleting AAH1 was obtained using primers AAH1-knock out-down-F / AAH1-knock out-down-R. Using the upper and lower homologous arm sequences as templates, the AAH1-knock out-up-F / AAH1-knock out-down-R primers were overlapped to obtain the homologous fragment inactivated by aah1. The primer sequences used are shown in Table 1. The N20 sequence of aah1, TATCAACAGTCAATACGACG, was selected, and its N20 primers, AAH1-F / AAH1-R, were designed. The primer sequences are shown in Table 1. The plasmid pCas9-Hyg-AAH1 was obtained using the same construction method as described above. The gene aah1 was inactivated using the same transformation method described above, resulting in recombinant strain B5U3-3. Following the same fermentation and detection methods, the 3'-deoxyadenosine yield of recombinant strain B5U3-3 was 1.61 g / L (results are shown below). Figure 1 (As shown).

[0050] 3. Using strain B5U3 as the starting strain, verify whether overexpression of the ribonuclease gene rny1 is effective.

[0051] Using the genome of *Saccharomyces cerevisiae* strain BY4742 as a template, the ribonuclease gene *rny1* was amplified using primers RNY1-F / RNY1-R. The promoter sequence TDH3 was amplified using primers TDH3-RNY1-F / TDH3-RNY1-R, and the terminator sequence CYC1 was amplified using primers CYC1-F / CYC1-R. The amplified fragments were then overlapped using primers TDH3-RNY1-F / CYC1-R to obtain the *rny1* expression cassette. This cassette was integrated into site 511b of the genome, which does not affect the growth of the *Saccharomyces cerevisiae* strain. Using the BY4742 genome as a template, the upper homologous fragment 511b-up at the 511b site was amplified using primers 511b-up-F / 511b-up-R, and the lower homologous fragment 511b-down at the 511b site was amplified using primers 511b-down-F / 511b-down-R. Then, using 511b-up-F / 511b-down-R as primers, the upper homologous fragment 511b-up, the lower homologous fragment 511b-down, and the rny1 expression cassette were overlapped to obtain the rny1 expression cassette containing the homologous fragments. The relevant primer sequences are shown in Table 1. The N20 sequence of 511b is CAGTGTATGCCAGTCAGCCA. Its N20 primers were designed as 511b-F / 511b-R, and the primer sequences are shown in Table 1. The plasmid pCas9-Hyg-511b was obtained using the same construction method described above. Overexpression of rny1 using the same transformation method described above yielded recombinant strain B5U3-4. Following the same fermentation and detection methods, the 3'-deoxyadenosine yield of recombinant strain B5U3-4 was 3.1 g / L (results are shown below). Figure 1 (As shown).

[0052] 4. Using B5U3 as the starting strain, verify whether inactivating the repressed vacuole alkaline phosphatase gene pho8 is effective.

[0053] Using the genome of *Saccharomyces cerevisiae* strain BY4742 as a template, PCR was performed using primers PHO8-knockout-up-F / PHO8-knock out-up-R to amplify the upper homologous arm sequence deleting pho8. The lower homologous arm sequence deleting pho8 was obtained using primers PHO8-knock out-down-F / PHO8-knock out-down-R. Using the upper and lower homologous arm sequences as templates, the PHO8-knock out-up-F / PHO8-knock out-down-R primers were overlapped to obtain the homologous fragment inactivated with pho8. The primer sequences used are shown in Table 1. The N20 sequence of pho8, CAAACCAATACAGACCACAG, was selected, and its N20 primers, PHO8-F / PHO8-R, were designed. The primer sequences are shown in Table 1. The plasmid pCas9-Hyg-PHO8 was obtained using the same construction method as described above. The pho8 gene was inactivated using the same transformation method described above, resulting in recombinant strain B5U3-5. Following the same fermentation and detection methods, the 3'-deoxyadenosine yield of recombinant strain B5U3-5 was 3.36 g / L (results are shown below). Figure 1 (As shown).

[0054] Example 2: Production of 3'-deoxyadenosine using xanthine as a substrate

[0055] In Example 1, the 3'-deoxyadenosine (3'-Adenosine) production of strain B5U3-3, which had its aah1 inactivated, decreased by 45%. A deeper analysis from the perspective of metabolic network regulation reveals that adenine is metabolized in vivo through two parallel pathways: one is the direct generation of AMP catalyzed by APRT (adenine phosphoribosyltransferase), and the other is the conversion to hypoxanthine via deamination catalyzed by aah1. After aah1 inactivation, this balance is disrupted. The single APRT metabolic pathway of adenine, due to its inherent inefficiency and strong AMP feedback inhibition, leads to insufficient precursor supply, resulting in a significant decrease in the overall efficiency of the 3'-deoxyadenosine biosynthesis pathway. Therefore, using hypoxanthine as a substrate for 3'-deoxyadenosine production restored and increased the yield of strain B5U3-3 to 3.21 g / L. Therefore, in the subsequent examples, the fermentation of strains involving inactivated aah1 all used hypoxanthine instead of adenine as the substrate. In some experiments, it was observed that when the concentration of hypoxanthine was 0.1-15 g / L, the yield of 3'-deoxyadenosine reached 3-10 g / L.

[0056] Example 3: Dual-gene combination modification

[0057] Using strain B5U3-1 from Example 1 as the chassis strain, strain B5U3-1 was passaged 3-4 times and then plated. Single colonies were simultaneously picked and placed on YPD plates containing 400 mg / L hygromycin (HygR) and on antibiotic-free YPD plates. The absence of single colonies on the antibiotic-containing plate and the presence of single colonies on the antibiotic-free plate confirmed the loss of the CRISPR / Cas9 tool plasmid. The corresponding single colonies were activated and modified according to the construction method described in Example 1 for the remaining four genes. Inactivation of ado1 yielded recombinant strain B5U3-6, inactivation of aah1 yielded recombinant strain B5U3-7, overexpression of rny1 yielded recombinant strain B5U3-8, and inactivation of pho8 yielded recombinant strain B5U3-9. Following the same fermentation and detection methods as in Examples 1 and 2, the 3'-deoxyadenosine yields of recombinant strains B5U3-6, 7, 8, and 9 were 3.43, 3.28, 3.41, and 3.47 g / L, respectively (results are shown in Figure 1). Figure 1 (As shown).

[0058] Example 4: Three-gene combination modification

[0059] Using strain B5U3-1 from Example 1 as the chassis strain, the following modifications were performed: simultaneous inactivation of ado1 and aah1; simultaneous overexpression of rny1 and inactivation of pho8; simultaneous inactivation of ado1 and pho8; simultaneous inactivation of ado1 and overexpression of rny1; simultaneous inactivation of aah1 and pho8; simultaneous inactivation of aah1 and overexpression of rny1. Recombinant strains B5U3-10, B5U3-11, B5U3-12, B5U3-13, B5U3-14, and B5U3-15 were obtained. Following the same fermentation and detection methods as in Examples 1 and 2, the 3'-deoxyadenosine yields of recombinant strains B5U3-10, 11, 12, 13, 14, and 15 were 3.63, 4.16, 4.03, 3.39, 3.76, and 3.84 g / L, respectively (results are shown in Figure 1). Figure 1 (As shown).

[0060] Example 5: Four-gene combination modification

[0061] Using strain B5U3-1 from Example 1 as the chassis strain, the following modifications were performed: simultaneous inactivation of ado1 and pho8, and overexpression of rny1; simultaneous inactivation of aah1 and pho8, and overexpression of rny1; simultaneous inactivation of ado1, aah1, and pho8; and simultaneous inactivation of ado1 and aah1, and overexpression of rny1. Recombinant strains B5U3-16, B5U3-17, B5U3-18, and B5U3-19 were obtained. Following the same fermentation and detection methods as in Examples 1 and 2, the 3'-deoxyadenosine yields of recombinant strains B5U3-16, 17, 18, and 19 were 3.51, 3.74, 4.42, and 3.76, respectively (results are shown in Figure 1). Figure 1 (As shown).

[0062] Example 6: Five-Gene Combination Modification

[0063] Using the B5U3-1 strain from Example 1 as the chassis strain, ado1, aah1, and pho8 were simultaneously inactivated, and rny1 was overexpressed to obtain the recombinant strain B5U3-20. Following the same fermentation and detection methods as in Examples 1 and 2, the 3'-deoxyadenosine yield of the recombinant strain B5U3-20 was 4.39 g / L (results are shown in Figure 1). Figure 1 As shown in the figure, in some experiments, the yield of 3'-deoxyadenosine can reach up to 10 g / L. After multi-gene synergistic modification, the yield of 3'-deoxyadenosine in the engineered strain reached 4.39 g / L, which is 50.3% higher than that of the original strain (2.92 g / L), proving that the genetic modification strategy can effectively overcome the metabolic bottleneck.

[0064] Example 7: Fermentation of engineered brewer's yeast B5U3-20 in a 5L fermenter to produce 3'-deoxyadenosine.

[0065] Fermentation was carried out in a 5L fermenter using recombinant strain B5U3-20. Single colonies were picked and incubated in 5mL of YPD liquid medium at 30℃ and 220rpm for 18h. The culture was then transferred to 200mL of YPD liquid medium at a 5% v / v inoculation ratio and incubated in a 30℃ shaker at 220rpm for 16h. Finally, the culture was transferred to the fermentation medium, which consisted of: 50g / L glucose, 10g / L yeast extract, 20g / L peptone, 1g / L adenine, and 1g / L hypoxanthine, with adenine and hypoxanthine as precursors. The fed medium consisted of 400g / L glucose, 3g / L adenine, and 3g / L hypoxanthine. The parameters of the 5L fermenter were controlled as follows: temperature 30℃, stirring speed 600rpm, aeration rate 6, liquid volume 2L, pH 5.5±0.1, and dissolved oxygen maintained at approximately 30%. After the carbon source in the fermentation broth was depleted, intermittent feeding was performed, maintaining the carbon source concentration in the fermentation broth at 0–5 g / L during the feeding process, and fermentation lasted for 220 h. The results showed that the engineered strain produced 20.58 g / L of 3'-deoxyadenosine in a 5L fermenter, with an OD... 600 Reaching 140 (result as follows) Figure 2 As shown), after the fermentation broth was left to stand for a period of time, a 3'-deoxyadenosine crystal precipitate layer was observed (as shown). Figure 3 (As shown).

[0066] This invention provides a genetically engineered strain that enhances 3'-deoxyadenosine production through multi-gene metabolic regulation and its applications. Various methods and approaches can be used to implement this technical solution; the above description is merely a preferred embodiment of the invention. It should be noted that those skilled in the art can make various improvements and modifications to this invention without departing from its fundamental principles, and these improvements and modifications are naturally included within the scope of protection of this invention. All components not described in detail in this embodiment can be implemented using existing technologies.

Claims

1. A genetically engineered strain that produces high levels of 3'-deoxyadenosine, characterized in that, Obtained by genetic modification of the strain, wherein the genetic modification includes at least one of the following: a) Overexpress the ribonucleotide reductase gene rnr1; b) Inactivate / weaken the adenosine kinase gene ado1; c) Inactivate / weaken the adenine deaminase gene aah1; d) Overexpression of the ribonuclease gene rny1; e) Inactivation / weakening of the repressive vacuole alkaline phosphatase gene pho8.

2. The genetically engineered strain according to claim 1, characterized in that, The genetically modified strains include strains capable of naturally producing 3′-deoxyadenosine and host strains containing exogenously introduced key enzymes for 3′-deoxyadenosine synthesis; the host strains include filamentous fungi and yeasts, and the yeasts include Saccharomyces cerevisiae, Pichia pastoris, and Yersinia lipolytica.

3. The genetically engineered strain according to claim 1, characterized in that, The ribonuclease gene rnr1 and the ribonuclease gene rny1 are expressed by any one of the strong promoters PGK1, TEF1, GPD, TPI1, ADH1 or TDH3.

4. The use of the genetically engineered strain according to any one of claims 1 to 3 in the preparation of 3'-deoxyadenosine.

5. The application according to claim 4, characterized in that, The method for preparing 3'-deoxyadenosine includes: inoculating the genetically engineered strain into a fermentation medium and fermenting it at 20-40°C for 48-220 h; wherein the fermentation medium comprises 10-100 g / L of carbon source, 10-50 g / L of nitrogen source, 0-15 g / L of adenine and 0-15 g / L of hypoxanthine.

6. The application according to claim 5, characterized in that, All strains with inactivated / weakened adenine deaminase gene aah1 were fermented using hypoxanthine instead of adenine as a substrate, with a hypoxanthine concentration of 0.1–15 g / L.

7. The application according to claim 4, characterized in that, The method for preparing 3'-deoxyadenosine includes: activating and culturing the genetically engineered strain, then inoculating it into a 5L fermenter containing fermentation medium. The parameters of the 5L fermenter are controlled as follows: temperature 28–30℃, stirring speed 200–1000 rpm, aeration rate 2–7, liquid volume 1–3L, pH 4–7, dissolved oxygen maintained at 1–70%. After the carbon source in the fermentation broth is depleted, intermittent feeding is performed, maintaining the carbon source concentration in the fermentation broth at 0–15 g / L during feeding, and fermentation for 220 h. The fermentation medium includes 50 g / L glucose, 10 g / L yeast extract, 20 g / L peptone, 1 g / L adenine, and 1 g / L hypoxanthine. The feeding medium used is 200–600 g / L glucose, 0–15 g / L adenine, and 0–15 g / L hypoxanthine.

8. The application according to claim 7, characterized in that, The parameters of the 5L fermenter are controlled as follows: temperature is 30℃. The stirring speed was 600 rpm, the aeration rate was 6, the liquid volume was 2 L, the pH was 5.5 ± 0.1, and the dissolved oxygen was maintained at 30%. The feed medium used was 400 g / L glucose, 3 g / L adenine, and 3 g / L hypoxanthine.

9. The application according to claim 8, characterized in that, The genetically engineered strain was obtained by genetically modifying Saccharomyces cerevisiae BY4742, which contains a key enzyme for the synthesis of exogenously introduced 3′-deoxyadenosine. The genetic modification involved overexpressing the ribonuclease gene rnr1 and the ribonuclease gene rny1, while simultaneously inactivating / weakening the adenosine kinase gene ado1, the adenine deaminase gene aah1, and the repressed vacuolar alkaline phosphatase gene pho8.

Citation Information

Patent Citations

  • Saccharomyces cerevisiae strain for efficiently synthesizing cordycepin as well as construction method and application thereof

    CN120098813A