Application of miR-574-5p related reagent in retinitis pigmentosa related products

Abstract

The invention belongs to the technical field of biomedical diagnosis products, and particularly relates to application of miR-574-5p related reagents in retinitis pigmentosa related products. According to the present invention, miRNA chip identification is performed on the retinal pigment epithelial cell exosome to obtain the miR-574-5p, and the expression of the miR-574-5p in the MNU-induced RP mouse plasma exosome is significantly up-regulated, such that the application of the miR-574-5p detection reagent in the preparation of the retinal pigment degeneration diagnosis product is provided.

Description

Technical Field

[0001] This invention belongs to the field of biomedical diagnostic product technology, specifically relating to the application of miR-574-5p related reagents in products related to retinitis pigmentosa. Background Technology

[0002] Retinitis pigmentosa (RP) is a hereditary blinding eye disease characterized by degeneration of photoreceptors. Typical clinical symptoms of RP include night blindness, progressive impairment of visual function such as visual acuity and visual field, ultimately leading to blindness. RP is a leading cause of vision impairment and blindness in people under 60 years of age, with a global prevalence of approximately 1 / 3000-1 / 7000, and about 1 / 4000 in China, affecting millions worldwide. However, with the increasing incidence of RP, there is currently no effective treatment.

[0003] Retinitis pigmentosa (RP) is a complex hereditary disease caused by mutations in more than 40 genes, most of which are related to retinal pigment epithelial (RPE) cells and photoreceptor cells. The RPE cell layer, a single-celled layer located between the retinal neural layer and the choroidal vascular layer, plays a crucial role in maintaining retinal homeostasis and the normal physiological function of photoreceptor cells. RPE cell atrophy leads to secondary choroidal capillary reduction and photoreceptor degeneration, further causing RPE cell loss, vascular leakage, and photoreceptor apoptosis, ultimately resulting in decreased vision and even blindness. Therefore, progressive photoreceptor apoptosis caused by RPE cell degeneration is considered a key pathogenic mechanism of RP. Thus, in-depth investigation of the molecular mechanisms of photoreceptor apoptosis caused by RPE cell degeneration is particularly important for identifying new diagnostic and therapeutic targets for RP.

[0004] N-Methyl-N-nitrosourea (MNU) is an alkylated carcinogen that restricts the formation of DNA adducts in the cell nucleus, thereby selectively inducing apoptosis of photoreceptor cells in the mammalian retina. Following a single systemic administration, MNU can induce retinal electrophysiological and morphological changes similar to those seen in retinopathy of prematurity (RP). Therefore, MNU-induced RP models are widely used in the study of RP disease.

[0005] Exosomes (Exos) are tiny membrane vesicles with a diameter of 30-150 nm, secreted by most cells in the body. They are widely distributed in various body fluids, carrying and transmitting important signaling molecules (proteins, lipids, DNA, and RNA, etc.), forming a novel intercellular communication mechanism that regulates various physiological or pathological responses. Reproductive vesicle (RPE) cells secrete Exos in a paracrine manner to regulate the function of neighboring cells. RPE-Exos can cross the blood-retinal barrier to deliver therapeutic factors to the lesion site. Exos contain various RNA molecules, with microRNAs (miRNAs) being the main component. miRNAs are a class of endogenous non-coding single-stranded RNA molecules containing 21-23 bases, widely present in animals and plants, regulating gene expression at the transcriptional and post-transcriptional levels, and playing an important regulatory role in the occurrence, development, and outcome of various diseases. Serum miRNAs are particularly stable and can tolerate extreme conditions (long-term storage, repeated freeze-thaw cycles, boiling, extremely high or low pH values, etc.). Furthermore, in the event of disease, the expression profile of serum miRNAs can undergo pathological changes, which are directly related to the diagnosis, staging, and prognosis of the disease. Therefore, serum miRNAs hold promise as a novel, non-invasive disease-related biomarker. Screening and identifying serum miRNAs with pathologically altered expression profiles is a crucial step in discovering novel, non-invasive disease biomarkers during the occurrence and development of human diseases. Currently, exosomal miRNAs derived from RPE cells have not been reported as serum biomarkers for RP disease.

[0006] Therefore, identifying serum miRNAs from exosomal cells derived from RPEs in RP is of great importance for the diagnosis or treatment of RP. Summary of the Invention

[0007] To address the above problems, this invention provides the application of miR-574-5p related reagents in products related to retinitis pigmentosa.

[0008] Application of reagents for detecting miR-574-5p in the preparation of diagnostic products for retinitis pigmentosa; Application of reagents that inhibit miR-574-5p expression in the preparation of products for the treatment of retinitis pigmentosa; The nucleotide sequence of miR-574-5p is shown in SEQ ID NO.7, which is: UGAGUGUGUGUGUGUGAGUGUGU.

[0009] Preferably, the reagent for detecting miR-574-5p is a reagent used to detect the expression level of miR-574-5p in a sample by employing high-throughput sequencing and / or quantitative PCR and / or probe hybridization methods.

[0010] Preferably, the primers in the quantitative PCR include a reverse transcription primer for detecting miR-574-5p, a specific upstream primer for the quantitative fluorescence reaction, and a specific downstream primer.

[0011] Preferably, the nucleotide sequence of the reverse transcription primer is shown in SEQ ID NO.1.

[0012] Preferably, the specific upstream primer and the specific downstream primer are as shown in SEQ ID NO.2~SEQ ID NO.3.

[0013] Preferably, the product is a reagent kit.

[0014] Preferably, the reagent for inhibiting miR-574-5p expression is rAAV8-miR-574-5p-sponge recombinant virus; The rAAV8-miR-574-5p-sponge recombinant virus was obtained by ligating the pAV-CMV-GFP-mirRNA sponge vector with miR-574-5p after enzyme digestion.

[0015] Preferably, during ligation, the primers shown in SEQ ID NO.9 and SEQ ID NO.11 are first used to perform an annealing reaction.

[0016] Preferably, during ligation, the primers shown in SEQ ID NO.10 and SEQ ID NO.12 are first used to perform an annealing reaction.

[0017] Preferably, the restriction sites are Asisl and Mlul.

[0018] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention identifies miR-574-5p by using a miRNA microarray to detect exosomes from retinal pigment epithelial cells. It was found that the expression of miR-574-5p was significantly upregulated in plasma exosomes of MNU-induced RP mice. Therefore, the application of reagents for detecting miR-574-5p in the preparation of diagnostic products for retinitis pigmentosa is proposed.

[0019] This invention inhibits miR-574-5p in the retina of mice with retinitis pigmentosa. Compared with mice with retinitis pigmentosa, the fundus symptoms were alleviated, fundus vascular leakage was reduced, and retinal thickness was significantly increased. Therefore, the application of reagents that inhibit miR-574-5p expression in the preparation of products for the treatment of retinitis pigmentosa is proposed. Attached Figure Description

[0020] Figure 1This is a map of the pAV-CMV-GFP-mirRNA sponge.

[0021] Figure 2 The spectrum of pAV-CMV-GFP-miR-574-5p sponge.

[0022] Figure 3 Transmission electron microscopy identification of RPEs-Exos.

[0023] Figure 4 Nanoparticle tracking and identification for RPEs-Exos.

[0024] Figure 5 The expression levels of RPEs-Exos surface marker proteins (CD63 and TSG101) were detected by Western blot.

[0025] Figure 6Heatmap of Exos intersection miRNAs from ARPE-19 and CP-M116 cells; in the figure, from top to bottom along the arrow direction, they are miR-3620-3p, miR-483-5p, miR-877-5p, miR-320a-3p, miR-339-3p, miR-17-5p, miR-99b-5p, miR-5100, miR-30c-1-3p, miR-324-3p, miR-188-5p, miR-718, miR-671-5p, miR-2861, miR-3960, miR-320c-3p, miR-328-5p, miR-762, miR-223 -3p,miR-451a,miR-320b-3p,miR-320d-3p,miR-320e-3p,miR-21-5p,miR-31-3p,miR-670-5p,miR-22-3p,miR-27b-3p,miR-23b-3p,miR-494-3p,mi R-1306-3p,miR-181a-5p,miR-30c-2-3p,miR-99b-3p,miR-3620-5p,miR-29c-3p,miR-425-5p,miR-296-5p,miR-29b-3p,miR-149-3p,miR-195-3p,m iR-139-3p,miR-30b-3p,miR-32-3p,miR-208a-5p,miR-574-5p,miR-210-3p,miR-34a-5p,miR-26b-5p,miR-140-5p,miR-31-5p,miR-20b-5p,miR-1 m iR-370-3p,miR-202-3p,miR-423-5p,mR-211-3p,miR-652-5p,miR-30e-5p,let-7i-5p,miR-26a-5p,miR-30d-5p,miR-342-3p,miR-30a-5p,miR-99a -5p,let-7b-5p,let-7c-5p,miR-130b-3p,miR-378a-3p,miR-181b-5p,miR-20a-5p,miR-27a-3p,miR-19b-3p,miR-93-5p,miR-155-5p,miR-29a-3p,miR-30b-5p, miR-361-5p, let-7a-5p, let-7f-5p, miR-92a-3p, let-7g-5p, let-7d-5p, miR-151-5p. ,

[0026] Figure 7 Dotted line plot of Exos intersection miRNAs from ARPE-19 and CP-M116 cells.

[0027] Figure 8 Heatmap analysis of the intersection of Exos-miRNAs in RPEs cells and the intersection of differentially expressed Exos-miRNAs in RP mouse plasma.

[0028] Figure 9 Dot-line plot analysis of the intersection of Exos-miRNAs in RPEs cells and the differentially expressed Exos-miRNAs in the plasma of RP mice.

[0029] Figure 10 The transcriptional level of miR-574-5p in plasma Exos of MNU-induced RP mice was detected by qPCR.

[0030] Figure 11 The qPCR-specific product of miR-574-5p in plasma Exos of MNU-induced RP mice was detected by agarose gel DNA electrophoresis, showing the results of two parallel experiments.

[0031] Figure 12 The transcriptional level of miR-574-5p in the retina of mice in the WT group, rd10 group, rd10+rAAV8–SCR–sponge group and rd10+rAAV8–miR–574–5p–sponge group was detected by qPCR.

[0032] Figure 13 Fundus examinations of mice in the WT group, rd10 group, rd10+rAAV8–SCR–sponge group, and rd10+rAAV8–miR–574–5p–sponge group are shown. In the figure, A is the fundus photograph of each group of mice, and B is the FFA image of each group of mice.

[0033] Figure 14 The OCT results are shown for mice in the WT group, rd10 group, rd10+rAAV8–SCR–sponge group, and rd10+rAAV8–miR–574–5p–sponge group. In the figure, A is the image and B is the retinal thickness statistics. Detailed Implementation

[0034] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods.

[0035] Example I. Extraction and Identification of RPE-Exos (Exosomes from Retinal Pigment Epithelial Cells) ARPE-19 cells and CM-M116 cells were cultured in DMEM and 1640 media containing exosome-free serum, respectively. After 48 h, cell supernatants were collected. The cell supernatant was centrifuged at 300×g for 10 min at 4 °C to precipitate the cells. The supernatant was then centrifuged at 2000×g for 10 min at 4 °C, and the supernatant was collected. The supernatant was then centrifuged at 10000×g for 30 min at 4 °C, and the supernatant was collected. The supernatant was then filtered through a 0.22 μm filter. The filtrate was ultracentrifuged at 120000×g for 70 min at 4 °C, and the precipitate was washed with PBS. The precipitate was resuspended in PBS and centrifuged again at 120000×g for 70 min at 4 °C. The supernatant was discarded, and the precipitate was collected to obtain RPE-Exos. RPE-Exos was diluted with PBS to the minimum volume and stored at -80 °C.

[0036] RPE-Exos were identified using electron microscopy, particle size analysis, and Western blot. The morphology of RPE-Exos was examined using transmission electron microscopy (JEM-1200EX). The particle size and concentration of RPE-Exos were determined using a nanoparticle tracking analyzer (ZetaView PMX110). The expression levels of surface markers (CD63 and TSG101) on RPE-Exos were detected using Western blot.

[0037] II. Extraction of total RNA from RPE-Exos Total RNA derived from RPE-Exos was extracted using the miRNeasy Serum / Plasma Kit. The procedure is as follows:

[0038] 1. Prepare the dissolved RPE-Exos sample.

[0039] 2. Add 5 times the volume of QIAzol Lysis Reagent. Vortex or whisk until well mixed.

[0040] 3. Let the tube containing the lysis solution stand at room temperature (15℃~25℃) for 5 minutes. In this example, let it stand at 20℃ for 5 minutes.

[0041] 4. Add 3.5 μL of miRNeasy Serum / Plasma Spike-In Control (1.6 x 10⁸ copies / μL working solution) and mix thoroughly.

[0042] 5. Add an equal amount of chloroform as the starting sample, and tighten the cap. Vortex or shake for 15 seconds.

[0043] 6. Let stand at room temperature (15℃~25℃) for 2 to 3 minutes. In this example, let stand at 20℃ for 3 minutes.

[0044] 7. Centrifuge at 12000×g for 15 min at 4℃. After centrifugation, heat the centrifuge to room temperature (15℃~25℃). After centrifugation, the sample separates into 3 layers: supernatant, colorless aqueous phase containing RNA; white intermediate layer; and red bottom layer, organic phase. In this example, the centrifuge is heated to 20℃.

[0045] 8. Transfer the aqueous phase to a new collection tube. Avoid introducing other impurities during the transfer. Add 1.5 times the volume of anhydrous ethanol and mix thoroughly by suction and stirring several times. Do not centrifuge. Proceed to step 9 immediately.

[0046] 9. Take 700 μL of sample, including any precipitate, and add it to one RNeasy MinElute spin column. Gently cap the column and centrifuge at 8000×g (10000rpm) for 15 seconds at room temperature (15℃~25℃). Discard the eluent (containing QIAzol Lysis Reagent or Buffer RWT, and cannot be coexisted with bleach), and continue to step 10 with the collection tube. In this example, centrifuge at 8000×g for 15 seconds at 20℃.

[0047] 10. Repeat step 9, adding the remaining sample. Discard the effluent (containing QIAzol Lysis Reagent or Buffer RWT, which cannot coexist with bleach), and continue to step 11 with the collection tube.

[0048] 11. Add 700 μL of Buffer RWT to the column. Gently cap the column and centrifuge at 8000×g (10000rpm) for 15s at room temperature (15℃~25℃) to clean the column. Discard the eluent (containing QIAzol Lysis Reagent or Buffer RWT, which cannot coexist with bleach). Keep the collection tube and continue to step 12. In this example, centrifuge at 8000×g for 15s at 20℃.

[0049] 12. Pipette 500 μL of Buffer RPE onto the column. Gently cap the column and centrifuge at 8000×g (10000 rpm) for 15 seconds at room temperature (15℃~25℃) to clean the column. Discard the eluent. Keep the collection tube and continue to step 13. In this example, centrifuge at 8000×g for 15 seconds at 20℃.

[0050] 13. Pipette 500 μL of 80% ethanol onto the column. Gently cap the column and centrifuge at 8000 × g (10000 rpm) for 2 min at room temperature (15℃~25℃) to wash the column membrane. Discard the collection tube and the eluent. In this example, centrifugation is performed at 8000 × g for 2 min at 20℃. Note: 80% ethanol must be prepared with ethanol (96%~100%) and RNase-free water. After centrifugation, carefully remove the column, ensuring the column does not come into contact with the eluent, otherwise ethanol will be carried out.

[0051] 14. Place the column onto a new 2 mL collection tube. Open the cap and centrifuge at full speed for 5 min to dry the column membrane. Discard the collection tube and the eluent. To avoid damaging the cap, leave a gap between the columns during centrifugation. It is crucial to ensure the cap is facing opposite directions to the rotor to allow the membrane to dry thoroughly, as residual ethanol can interfere with downstream reactions. Opening the cap during centrifugation ensures no ethanol is introduced into the subsequent RNA elution step.

[0052] 15. Transfer the column to a new 1.5 mL collection tube. Add 14 μL of RNase-free water to the center of the membrane. Carefully cap the tube and centrifuge at full speed for 1 min to elute RNA. A minimum of 10 μL of RNase-free water can be added to obtain a higher concentration of RNA, but the yield will decrease by approximately 20%. Do not add less than 10 μL of RNase-free water, as the column membrane will not be adequately wetted. The dead volume of the column is 2 μL: adding 14 μL of RNase-free water will yield 12 μL of eluent.

[0053] III. Microarray Detection and Data Analysis of RPE-Exos-derived miRNAs Shanghai Ouyi Biomedical Technology Co., Ltd. was commissioned to perform microarray detection of RPE-Exos-derived miRNA. Total RPE-Exos RNA was quantified using a NanoDrop ND-2000 (Thermo Scientific) and RNA integrity was detected using an Agilent Bioanalyzer 2100 (Agilent Technologies). After passing RNA quality control, sample labeling, microarray hybridization, and elution were performed according to the following Agilent miRNA microarray detection standard procedure.

[0054] 1. Dephosphorylation Transfer 100 ng of total RNA to a 0.2 mL centrifuge tube and add water to bring the volume to 2 μL. Prepare the dephosphorylation mixture according to Table 1. Add 2 μL of the reaction solution to the sample tube, making the total volume 4 μL. Mix the sample well, shake gently, and incubate at 37 °C for 30 min.

[0055] Table 1. Components of the dephosphorylation mixture 2. Sample denaturation Add 2.8 μL of 100% DMSO to each sample tube; after mixing and centrifugation, place the above reaction mixture at 100℃ for 5-10 min; after the reaction is completed, quickly transfer it to an ice bath to cool.

[0056] 3. Connection mark Incubate 10×T4 RNA Ligase Buffer at 37°C with intermittent vortexing until the precipitate is completely dissolved, then cool to room temperature. Prepare the ligation reaction mixture according to Table 2. Add 4.5 μL of the ligation reaction mixture to the sample tube, making a total volume of 11.3 μL. Mix well and incubate at 16°C for 2 hours on a PCR instrument. Table 2: Components of the ligation reaction mixture.

[0057] 4. Sample drying After the sample ligation reaction was completed, the sample was transferred to a 1.5 mL centrifuge tube. The transferred sample tube was then placed in a vacuum concentrator and concentrated at 45 °C for 3 h until completely dry. The dried sample was then redissolved in 17 μL of water. The chip hybridization reaction was then awaited.

[0058] 5. Prepare 10 Blocking Agents Add 125 μL of nuclease-free water to a lyophilized 10×GE Blocking Agent tube, vortex gently to dissolve completely; centrifuge gently and set aside for later use. The prepared 10×GE Blocking Agent can be stored at -20℃ for 2 months. Each time you thaw and use it, be sure to vortex and centrifuge.

[0059] 6. Chip hybridization Preheat the hybridization furnace to 55℃; prepare the hybridization reaction system according to Table 3 below; place the reaction solution in a metal bath at 100℃ for 5 minutes, then immediately place it in an ice bath for 5 minutes; centrifuge and wait for core loading; remove the cover plate and place it on the hybridization rack, add 40 μL of sample to each well, remove the chip to be hybridized with the Agilent label side down and place it horizontally on top to prevent excessive air bubbles. Assemble the hybridization device, making sure to tighten it to prevent leakage. Rotate the chip clockwise 2-3 times to ensure all air bubbles are rotated and the hybridization solution is fully combined with the probe; place the hybridization rack in the hybridization furnace and perform rolling hybridization at 55℃ and 20 rpm for 20 hours.

[0060] Table 3 Components of the hybridization reaction system 7. Chip cleaning and scanning After hybridization, remove the hybridization rack from the hybridization furnace and clean the chips according to the following steps: When removing the chips, immerse them in the cleaning solution before removal, and only touch the labeled side. After removal, place them in the #2 washing tank as soon as possible to reduce the time exposed to air; for the 1st Wash, it is recommended to use a 4cm magnetic rod at 350rpm to create a vortex wash; or a 2cm magnetic rod at 600rpm; for the 2nd Wash, use 370rpm, quickly place the chip in, and slowly remove it (5s~10s) to ensure no water droplets remain on the chip; after chip cleaning, carefully place the chip face up in the chip rack; place it in the scanner for chip scanning; after scanning, extract the data using FeatureExtraction software, and the generated raw data file is standardized by Genespring for subsequent data analysis.

[0061] Raw images were processed using Feature Extraction software (version 10.7.1.1, Agilent Technologies) to extract raw data. The raw data were then quantile-normalized. The normalized data were filtered, ensuring that at least 75% of probes in each comparison group were marked as "Detected" for subsequent analysis. Differentially expressed genes were screened using the p-value and fold change value of a t-test. The screening criteria were an up- or down-regulation fold change value ≥ 2.0 and a p-value ≤ 0.05. Scatter plots, volcano plots (corresponding to groups with biological replicates), and cluster plots were generated for each differential screening result.

[0062] IV. Establishment of MNU-induced RP mouse model and preparation of plasma 1. Establishment of MNU-induced RP mouse model (1) Ten-week-old wild-type C57BL / 6J male mice, weighing approximately 25g, were used as the research subjects in this experiment. The mice were fed in a constant temperature and humidity environment and were allowed free access to food.

[0063] (2) Preparation of MNU solution: Weigh 15.4 mg of MNU powder using a micro-electronic balance, dissolve it in 1 mL of physiological saline containing 0.05% acetic acid, vortex mix for 1 min, centrifuge at 12000 rpm for 5 min to remove undissolved particles, take the supernatant and filter it using a 0.22 μm sterile filter membrane, store the filtrate at 4℃ protected from light for later use, and use it within 2 h.

[0064] (3) Ten mice were randomly divided into two groups (MNU model group (n=5) + normal control group (n=5). The MNU model group was injected intraperitoneally with MNU solution at a dose of 60 mg / kg and the prepared solution was injected intraperitoneally at a dose of 0.01 mL / g. The five mice in the normal control group were injected intraperitoneally with physiological saline at a dose of 0.01 mL / g.

[0065] (4) Closely monitor the health status of the mice after injection. On the third day, blood was collected from each group of mice.

[0066] 2. Preparation of plasma in MNU-induced RP mouse model (1) Whole blood was collected from each group of mice using BD’s Vacutainer® Venous Blood Collection Tubes (containing EDTA).

[0067] (2) Centrifuge the blood sample in the collection tube at 1900×g (3000rpm) at 4℃ for 10min (basket rotor).

[0068] (3) Carefully transfer the supernatant (yellow) to a new collection tube (round bottom), being careful not to touch the pale yellow platelet layer (containing white blood cells and platelets). Usually, 10 mL of whole blood can yield 4 mL to 5 mL of plasma.

[0069] (4) Centrifuge the round-bottom tube containing the plasma sample at 16000×g at 4℃ for 10 min (fixed angle rotor).

[0070] (5) Carefully transfer the supernatant to a new tube, being careful not to touch the sediment (on the bottom wall of the tube).

[0071] (6) Store the plasma sample in a freezer at -80°C.

[0072] V. Extraction of plasma exosomes and total exosome RNA from MNU-induced RP mouse model 1. Extraction of plasma exosomes from MNU-induced RP mouse model The method is the same.

[0073] 2. Extraction of total RNA from plasma exosomes in MNU-induced RP mouse model The method is the same as the second one.

[0074] VI. Microarray detection of exosome-derived miRNAs in plasma of RP mouse model The method is the same as in step three.

[0075] VII. qRT-PCR detection of exosomal miRNAs 1. Reverse transcription miRNA primers were designed using a specific stem-loop primer method. U6 was selected as the internal control. The primers for mmu-miR-574-5p and mmu-U6 are shown in Table 4 below.

[0076] Table 4 Primer sequences The extracted total RNA was reverse transcribed into cDNA using the following reaction system: RT primer 1 μL, RNA 2 μL, DEPC water 3 μL, total 6 μL.

[0077] After mixing, denature and anneal at 70℃ for 10 min, quickly remove and place at 4℃ for 10 min, then perform low-temperature rapid operation in the following reaction system: 5×M-MLV buffer 2 μL, dNTP (10mM) 0.5 μL, RI (40U / μL) 0.25 μL, M-MLV (200 U / μL) 0.25 μL, DEPC water 1 μL, total 4 μL.

[0078] After mixing, perform extension reactions at 42℃ for 60 min, 70℃ for 15 min. After reverse transcription to cDNA, add sterile ddH2O to a final volume of 20 μL.

[0079] 2. Real-time PCR reaction The system is as follows: 5 μL of 2xSYBR qPCR Mix, 0.4 μL of upstream primer (10 μM), 0.4 μL of downstream primer (10 μM), 2 μL of template (cDNA), 2.2 μL of sterile ddH2O, and a total system volume of 10 μL.

[0080] After mixing in the dark, perform qPCR amplification under the following conditions: 95℃ for 30 seconds, 95℃ for 5 seconds, 55℃ for 10 seconds, 72℃ for 15 seconds, 10 cycles, 95℃ for 15 seconds, 60℃ for 60 seconds, 25℃.

[0081] 8. 2% agarose gel DNA electrophoresis miRNA qPCR products were identified using agarose gel DNA electrophoresis.

[0082] IX. Western blot method Prepare SDS-PAGE gels of appropriate concentrations according to the molecular weight of the proteins to be detected. Take 25-30 μg of total protein for electrophoresis separation, and transfer the separated protein bands to an NC membrane using wet transfer. Block with PBS containing 5% skim milk powder at room temperature for 60 min, then incubate the NC membrane and CD63, TSG101, and β-Actin primary antibody dilution buffer overnight at 4°C. The next day, wash the membrane three times with PBS for 10 min each time, then add an appropriate amount of IRDye800CW fluorescently labeled secondary antibody, incubate at room temperature for 50 min, wash the membrane three times with PBS for 10 min each time, and then develop it on an instrument.

[0083] 0. Verify the therapeutic effect of miR-574-5p on RP mice. 1. Constructing a reorganization vehicle (1) The mmu-miR-574-5p-sponge sequence was artificially synthesized.

[0084] (2) The target sequence of mmu-miR-574-5p-sponge was cut out using Asisl / Mlul. The nucleotide sequence of mmu-miR-574-5p-sponge is shown in SEQ ID NO.8. At the same time, the pAV-CMV-GFP-mirRNA sponge vector (purchased from Shandong Weizhen Biotechnology Co., Ltd., plasmid map is shown in [link to plasmid map]) was also cut out using Asisl / Mlul. Figure 1 Enzyme digestion was performed, and the enzyme digestion system is shown in Table 5 below.

[0085] SEQ ID NO. 8: GCGATCGCACACACTCACTGTACACACTCAGGGTCCCACACACTCACTGTACACACTCAGGGTCCCACACACTCACTGTACACACTCAGGGTCCCACACACTCACTGTACACACTCAACGCGT.

[0086] Table 5 Enzyme digestion system After adding the sample and mixing well, place it at 37℃ for 1-2 hours for enzyme digestion. In this example, enzyme digestion was performed for 1 hour. Then, 1 µL of Fast AP enzyme was added for 15 minutes for dephosphorylation. After the reaction was completed, the vector was recovered using a product purification kit.

[0087] (3) Annealing After receiving the miR-574-5p-sponge primers, centrifuge briefly. Add RNAase-free ddH2O to the primer powder to dilute it to a 100 μM stock solution. The volume of RNAase-free ddH2O added is (nmol of primer powder × 10) μL. The annealing reaction system is shown in Table 6 below.

[0088] Table 6 Annealing Reaction System Sponge F1: CGCACACACTCACTGTACACACTCAGGGTCCCACACACTCACTGTACACACTCAGG, recorded as SEQ ID NO.9; Sponge F2: GTCCCACACACTCACTGTACACACTCAGGGTCCCACACACTCACTGTACACACTCAA, recorded as SEQ ID NO.10; Sponge R1: CGCGTTGAGTGTGTACAGTGAGTGTGTGGGACCCTGAGTGTGTACAGTGAGTGTGTGG, recorded as SEQ ID NO.11; Sponge R2: GACCCTGAGTGTGTACAGTGAGTGTGTGGGACCCTGAGTGTGTACAGTGAGTGTGTGCGAT, recorded as SEQ ID NO. 12.

[0089] The reaction procedure is shown in Table 7 below.

[0090] Table 7 Reaction Procedure (4) Connection The annealing product was diluted 100 times and ligated with the enzyme-digested vector. The ligation system is shown in Table 8 below.

[0091] Table 8 Connection System After mixing, centrifuge briefly and connect at 22°C for 2 hours.

[0092] (5) Transformation The ligation product was transformed into E. coli DH5α competent cells and screened on LB plates with the corresponding resistance. The specific steps for transformation are as follows: Remove the pre-prepared DH5a competent cells from -80℃ and place them in an ice bath. After the DH5a competent cells thaw, add 5 μL of the ligation product to 20 μL of DH5a competent cells, mix thoroughly, and incubate on ice for 15 minutes. Place the centrifuge tube in a 42℃ water bath for 40 seconds (do not shake the centrifuge tube during this time), then quickly transfer it to an ice bath and incubate for 2 minutes. Add 200 μL of sterile LB medium (without antibiotics) to the centrifuge tube, mix well, and place it in a shaker at 37℃ and 200 rpm for 1 hour. This is to induce expression of the relevant resistance marker gene on the plasmid and revive the cells. Spread the mixture onto plates containing the appropriate antibiotic-containing solid culture medium. Incubate overnight at 37℃.

[0093] (6) Sequencing Single colonies were cultured, and plasmids were extracted for enzyme digestion to identify positive clones, followed by sequencing verification. The resulting pAV-CMV-GFP-miR-574-5p sponge was obtained. The constructed recombinant vector map is shown below. Figure 2 .

[0094] (7) Remove endotoxins and extract plasmids for virus packaging.

[0095] 2. Virus Packaging Shandong Weizhen Biotechnology Co., Ltd. was commissioned to package the virus, and the packaged virus was named rAAV8-miR-574-5p-sponge recombinant virus.

[0096] 3. Animal experiment grouping Fourteen-day-old rd10 mice, weighing approximately 9g, were used as the research subjects. The mice were fed in a constant temperature and humidity environment. The rd10 mice were purchased from Henan Saiye Biotechnology Co., Ltd., product number: C001276.

[0097] rd10+rAAV8-miR-574-5p-sponge group: rd10 mice were injected intravitreal with recombinant rAAV8-miR-574-5p-sponge virus (titer 4.42 × 10⁻⁶) 14 days after birth. 13 vg / ml, with a dose of 1μL injected into each eye), n=6.

[0098] rd10+rAAV8-SCR-sponge group: The rAAV8-miR-574-5p-sponge recombinant virus in the rd10+rAAV8-miR-574-5p-sponge group was replaced with a recombinant virus containing an empty pAV-CMV-GFP-miRNA vector, n=6.

[0099] rd10 group: rd10 mice 14 days after birth, n=6.

[0100] WT group: C57BL / 6J normal mice 14 days after birth, n=6.

[0101] 4. qRT-PCR detection of miR-574-5p expression level Twenty-eight days after injection of the recombinant virus, the mice in each group were sacrificed, and their retinas were harvested. Total RNA was extracted, and the expression level of miR-574-5p in each group was detected by qRT-PCR. The method was the same as in section seven.

[0102] 5. Fundus examination Testing time: 28 days after mice were injected with the recombinant virus; Tests include: fundus photography, fluorescein angiography (FFA), and optical coherence tomography (OCT).

[0103] result I. Characteristics of RPEs-Exos To identify ARPE-19 cell-derived Exos, the morphological characteristics of the isolated particles were first determined using transmission electron microscopy (TEM). For example... Figure 3 As shown, the TEM image reveals a cup-shaped vesicle structure enclosed by a double membrane. Next, Nano Sight technology was used to evaluate the diameter distribution of the separated particles, showing a single peak in particle diameter around 100 nm. Figure 4 Finally, the expression levels of Exos markers (CD63 and TSG101) were detected by Western blot. The results showed that both CD63 and TSG101 were highly expressed in the separated particles. Figure 5 These results indicate that the separated particles were RPEs-Exos.

[0104] II. Expression profiling analysis of RPEs-Exos-derived miRNAs Human retinal pigment epithelial cells (ARPE-19) and mouse retinal pigment epithelial cells (CP-M116) were cultured separately, and exos were extracted from them. miRNA microarrays were used to identify the exos from ARPE-19 and CP-M116, and heatmaps and dot plots of the overlapping miRNAs were created. The results showed that there were 96 overlapping miRNAs in the exos from ARPE-19 and CP-M116. Figure 6 and Figure 7 ).

[0105] III. Screening of Exos-miRNAs derived from RPEs cells in RP mouse plasma To screen for Exos-miRNAs derived from RPEs cells in the plasma of RP mice, heatmap and dot plot analyses were performed on the intersecting miRNAs of RPEs-Exos and the differentially expressed Exos-miRNAs in the plasma of MNU-induced RP mice. The results showed a total of 5 intersecting Exos-miRNAs: miR-574-5p, miR-2861, miR-5100, miR-188-5p, and miR-451a. Figure 8 and Figure 9 ).

[0106] IV. Identification of miR-574-5p in Exos cells derived from RPEs in RP mouse plasma The expression of miR-574-5p in plasma Exos of MNU-induced RP mice was detected by qPCR. The results showed that the expression of miR-574-5p in plasma Exos of mice in the MNU group was significantly upregulated compared with that in the Normal Control group. Figure 10 The results were consistent with those obtained from miRNA microarray detection. Agarose gel DNA electrophoresis was used to detect the miR-574-5p qPCR product (67bp) to identify its specificity. The results showed that the miR-574-5p qPCR product contained only a single target band. Figure 11 ).

[0107] Primer sequences were designed based on the target gene. The primer sequences are as follows: RT-2: GTCGTCGTATCCAGTGCAGGGTCCGAGGTATTCAC, denoted as SEQ ID NO.13; Forward primer-2: ATGGTTCGTGGGTGAGTGTGTGTGTGAGTGT, recorded as SEQ ID NO.14; Reverse primer-2: GCAGGGTCCGAGGTATTC, denoted as SEQ ID NO.15; RT-3: GCAGGGTCCGAGGTATTCGCACTGGATACGAC, denoted as SEQ ID NO.16; Forward primer-3: ATGGTTCGTGGGTGAGTGTGTGTGTGTGAGTGTGT, recorded as SEQ IDNO.17; Reverse primer-3: GCAGGGTCCGAGGTATTC, denoted as SEQ ID NO.18; qPCR was performed using primers shown in SEQ ID NO 1~SEQ ID NO 3, SEQ ID NO 13~SEQ ID NO 15, and SEQ ID NO 16~SEQ ID NO 18, respectively. The results showed that when using primers shown in SEQ ID NO 1~SEQ ID NO 3, the miR-574-5p qPCR product had only a single target band with a clear signal. However, when using primers shown in SEQ ID NO 13~SEQ ID NO 15 and SEQ ID NO 16~SEQ ID NO 18, the target product signal was too weak to be distinguished by the naked eye. This may be because the control primer itself first forms a dimer or the 3' end is blocked, resulting in poor stability of the control primer, more dimers, and low effective concentration, ultimately causing the target product signal to be extremely weak.

[0108] V. Verification of the therapeutic effect of low miR-574-5p expression on RP mice 1. qRT-PCR The expression of miR-574-5p in the retina of RP mice in each group was detected by qPCR. The results showed that compared with the rd10 group and the rd10+rAAV8-SCR-sponge group, the expression of miR-574-5p in the retina of mice in the rd10+rAAV8-miR-574-5p-sponge group was significantly downregulated. Figure 12 ).

[0109] 2. Fundus photography Fundus photography results showed that the fundus of mice in the WT group was normal, while the fundus of mice in the rd10 group and the rd10+rAAV8-SCR-sponge group showed a grayish-blue smudged appearance with visible osteocyte-like pigmentation. The fundus symptoms of mice in the rd10+rAAV8-miR-574-5p-sponge group were alleviated. Figure 13 A).

[0110] 3. Fluorescein fundus angiography (FFA) FFA results showed that the fundus vessels of mice in the WT group were normal, while the rd10 group and the rd10+rAAV8-SCR-sponge group showed a large amount of vascular leakage, and the fundus vascular leakage of mice in the rd10+rAAV8-miR-574-5p-sponge group was reduced. Figure 13 B).

[0111] 4. Optical coherence tomography (OCT) OCT results showed that, compared with the WT group, rd10 group, and rd10+rAAV8-SCR-sponge group, the retinal thickness of mice in the rd10+rAAV8-miR-574-5p-sponge group was significantly increased. Figure 14 ).

[0112] It should be noted that when numerical ranges are mentioned in the claims of this invention, it should be understood that the two endpoints of each numerical range and any value between the two endpoints can be selected. To avoid redundancy, the present invention describes preferred embodiments.

[0113] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including both the preferred embodiments and all changes and modifications falling within the scope of the invention.

[0114] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. The application of miR-574-5p related reagents in products related to retinitis pigmentosa, characterized in that, The applications shown include at least one of the following: Application of reagents for detecting miR-574-5p in the preparation of diagnostic products for retinitis pigmentosa; Application of reagents that inhibit miR-574-5p expression in the preparation of products for the treatment of retinitis pigmentosa; The nucleotide sequence of miR-574-5p is shown in SEQ ID NO.

7.

2. The application according to claim 1, characterized in that, The reagent for detecting miR-574-5p is a reagent used to detect the expression level of miR-574-5p in a sample by high-throughput sequencing and / or quantitative PCR and / or probe hybridization.

3. The application according to claim 2, characterized in that, The primers used in the quantitative PCR include a reverse transcription primer for detecting miR-574-5p, a specific upstream primer for the quantitative fluorescence reaction, and a specific downstream primer.

4. The application according to claim 3, characterized in that, The nucleotide sequence of the reverse transcription primer is shown in SEQ ID NO.

1.

5. The application according to claim 3, characterized in that, The specific upstream primer and specific downstream primer are shown in SEQ ID NO.2~SEQ ID NO.

3.

6. The application according to claim 1, characterized in that, The reagent used to inhibit miR-574-5p expression is rAAV8-miR-574-5p-sponge recombinant virus; The rAAV8-miR-574-5p-sponge recombinant virus was obtained by ligating the pAV-CMV-GFP-mirRNA sponge vector with miR-574-5p after enzyme digestion.

7. The application according to claim 6, characterized in that, During ligation, the primers shown in SEQ ID NO.9 and SEQ ID NO.11 are first used to perform an annealing reaction.

8. The application according to claim 6, characterized in that, During ligation, the primers shown in SEQ ID NO.10 and SEQ ID NO.12 are first used to perform an annealing reaction.

9. The application according to claim 6, characterized in that, The enzyme cleavage sites are Asisl and Mlul.

Images