SNP marker, primer pair, kit and application for identifying genetic sex of chinese softshell turtle

By developing sex-specific SNP markers and primer pairs for Chinese soft-shelled turtles, rapid and efficient sex identification of Chinese soft-shelled turtles was achieved using PCR amplification and sequencing methods, solving the problem of difficult sex identification in existing technologies and improving aquaculture efficiency.

CN120967001BActive Publication Date: 2026-04-28PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511168760.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-08-20
Publication Date
2026-04-28
Estimated Expiration
2045-08-20

AI Technical Summary

Technical Problem

Current technology cannot effectively, quickly, and accurately determine the sex of Chinese soft-shelled turtles, especially during the embryonic and juvenile stages, which makes it difficult to distinguish between males and females and affects the profitability of aquaculture.

Method used

Specific SNP markers were developed, and sex was determined by detecting the genotype located at the 106th and/or 109th bases in the nucleotide sequence, using primer pairs for PCR amplification and sequencing. A kit was provided for sex identification.

Benefits of technology

This technology enables rapid, efficient, and accurate identification of the sex of Chinese soft-shelled turtles, improves the screening efficiency and selection intensity of male individuals, enhances the economic benefits of aquaculture, and reduces costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120967001B_ABST
    Figure CN120967001B_ABST
Patent Text Reader

Abstract

The present application belongs to the technical field of molecular marker assisted breeding, and particularly relates to a SNP marker for identifying the genetic sex of Chinese soft-shelled turtles, a primer pair, a kit and application, wherein the SNP marker is located at the 106th and / or 109th base of the nucleotide sequence shown in SEQ ID NO. 3, when the 106th base is TT genotype, the to-be-tested Chinese soft-shelled turtle individual is male, and when the 106th base is TG genotype, the to-be-tested Chinese soft-shelled turtle individual is female; when the 109th base is GG genotype, the to-be-tested Chinese soft-shelled turtle individual is male, and when the 109th base is GA genotype, the to-be-tested Chinese soft-shelled turtle individual is female. The sex-specific SNP marker provided by the present application can realize the conversion of the judgment of the sex trait of the Chinese soft-shelled turtle individual into the judgment of the genotype of the molecular marker, and through the detection of the genotype of the molecular marker, the sex identification can be carried out quickly, efficiently, accurately and with high throughput at the genetic level.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular marker-assisted breeding technology, and in particular to an SNP marker, primer pair, kit, and application for genetic sex identification of Chinese soft-shelled turtles. Background Technology

[0002] The Chinese softshell turtle (Pelodiscus sinensis), belonging to the class Reptilia, order Chelonia, family Trionychidae, and genus Pelodiscus, is a significant aquaculture species and a prized food ingredient in my country, possessing high nutritional and medicinal value. In the Chinese softshell turtle farming industry, the faster growth rate, thicker skirts, lower fat content in the muscles of males, and relatively higher market prices make farming all-male or high-male-ratio populations an effective way to increase yield and economic benefits. This has led to early sex determination technology for Chinese softshell turtles becoming a current research focus.

[0003] Currently, there is no effective method for sex determination of Chinese soft-shelled turtles. During the embryonic and juvenile stages, there is no difference in external morphology between sexes, making early sex determination impossible through visual observation. This leads to mixed-sex farming and low economic efficiency. Histological methods, which identify sex through gonadal tissue, require dissection and collection, are invasive, and can easily result in individual mortality. They are also inefficient for processing large batches of samples and are unsuitable for early sex determination in large-scale farming. While karyotype analysis or comparative genomic hybridization analysis can theoretically be used to identify the sex of embryos and juveniles, the procedures are complex and time-consuming, and have a certain error rate, making them insufficient to meet the needs of rapid and accurate sex determination in large-scale farming.

[0004] In recent years, sex-specific molecular marker-assisted selection technology has had a wide and crucial application value in the farming, breeding, and basic research of Chinese soft-shelled turtles. By identifying molecular markers closely associated with target traits, molecular marker loci in candidate individuals can be identified and selected through DNA extraction and PCR detection in the early stages of farming (e.g., 1-2 weeks after hatching) or the juvenile stage, thereby quickly distinguishing between male and female individuals. Therefore, the discovery of sex-associated molecular markers and the establishment of marker-assisted selection methods will greatly solve the problem of difficult genetic sex identification in Chinese soft-shelled turtles.

[0005] Single nucleotide polymorphism (SNP) molecular markers refer to DNA sequence polymorphisms caused by variations in a single nucleotide at the genomic level, including single-base transversions, transitions, insertions, and deletions. They are the most numerous and widely distributed molecular markers in the genome, possessing advantages such as ease of genotyping, good genetic stability, and ease of automation and batch processing, making them considered the most valuable next-generation genetic markers. However, SNP molecular markers are relatively few in Chinese soft-shelled turtle sex research. The number of markers with clearly defined functions that can be directly used for breeding detection is limited, and some markers exhibit uncertainties in practical development and application, such as difficulty in normal amplification in some individuals, affecting the efficiency and accuracy of sex identification. Therefore, developing novel sex-specific SNP molecular markers for Chinese soft-shelled turtles will provide powerful tools and potential targets for early sex molecular identification technology and sex-controlled breeding research, and is of great significance for the rapid screening of male individuals and improving the economic benefits of aquaculture. Summary of the Invention

[0006] To address the problems existing in the prior art, this invention provides a SNP marker for genetic sex identification of the Chinese soft-shelled turtle. By detecting the genotype of this molecular marker, rapid, efficient, accurate, and high-throughput sex identification can be achieved at the genetic level. Therefore, this invention provides the application of this SNP marker, its detection primers, or kits in the sex identification of the Chinese soft-shelled turtle. This invention is specifically implemented through the following technical solutions:

[0007] The first aspect of this invention provides an application of SNP markers, primer pairs, or kits for the genetic sex identification of Chinese soft-shelled turtles; the SNP marker is located at the 106th and / or 109th bases of the nucleotide sequence shown in SEQ ID NO.3, where K is selected from T or G, and R is selected from G or A;

[0008] Among them, the 106th base has TT and TG genotypes. When it is TT genotype, the Chinese soft-shelled turtle being tested is male, and when it is TG genotype, the Chinese soft-shelled turtle being tested is female. The 109th base has GG and GA genotypes. When it is GG genotype, the Chinese soft-shelled turtle being tested is male, and when it is GA genotype, the Chinese soft-shelled turtle being tested is female.

[0009] The second aspect of the present invention provides a primer pair for genetic sex identification of Chinese soft-shelled turtles, the primer pair being used to detect SNP markers, the SNP markers being located at the 106th and / or 109th bases of the nucleotide sequence shown in SEQ ID NO.3, where K is selected from T or G, and R is selected from G or A;

[0010] The primer pair includes an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.1, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.2.

[0011] A third aspect of the present invention provides a kit for genetic sex identification of Chinese soft-shelled turtles, the kit comprising primer pairs as described above.

[0012] Furthermore, the kit also includes PCR amplification reagents, which include Taq DNA polymerase, dNTPs, and buffer reagents.

[0013] The fourth aspect of this invention provides a method for identifying the sex of the Chinese softshell turtle, comprising the following steps:

[0014] Genomic DNA was extracted from the Chinese soft-shelled turtle individuals to be tested;

[0015] The genomic DNA was amplified by polymerase chain reaction using primer pairs as shown in SEQ ID NO.1-2 to obtain amplification products;

[0016] The genotype of the amplification product at positions 106 and / or 109 is detected, and the sex of the Chinese soft-shelled turtle to be tested is determined based on the genotype.

[0017] Among them, the 106th base has TT and TG genotypes. When it is TT genotype, the Chinese soft-shelled turtle being tested is male, and when it is TG genotype, the Chinese soft-shelled turtle being tested is female. The 109th base has GG and GA genotypes. When it is GG genotype, the Chinese soft-shelled turtle being tested is male, and when it is GA genotype, the Chinese soft-shelled turtle being tested is female.

[0018] Furthermore, the PCR amplification reaction system, in 40 μL, includes: 20 μL of 2×Taq Master Mix, 1.6 μL of upstream primer, 1.6 μL of downstream primer, 1 μL of genomic DNA, and 15.8 μL of deionized water.

[0019] Furthermore, the PCR amplification reaction program includes: 94℃ pre-denaturation for 3 min, 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 15 s, for a total of 35 cycles; running at 72℃ for 5 min; and storing the amplification reaction solution at 4℃ for later use.

[0020] Furthermore, the genotype was detected using Sanger sequencing.

[0021] The advantages and positive effects of this invention are as follows:

[0022] The sex-specific SNP markers provided by this invention can transform the determination of the sex trait of Chinese soft-shelled turtle individuals into the determination of molecular marker genotypes. This facilitates the rapid, efficient, accurate, and high-throughput identification of the sex phenotype of Chinese soft-shelled turtle individuals in the early stages of breeding by detecting the genotype of these molecular markers. This greatly improves the screening efficiency and selection intensity of male Chinese soft-shelled turtle individuals, enhances the accuracy and reliability of early sex selection, significantly improves the economic benefits of Chinese soft-shelled turtle breeding, reduces breeding costs, and promotes the high-quality and sustainable development of the Chinese soft-shelled turtle breeding industry. Attached Figure Description

[0023] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0024] Figure 1 This is an agarose gel electrophoresis image of the sex-specific SNP marker amplification product of the Chinese soft-shelled turtle according to an embodiment of the present invention;

[0025] Figure 2 This is the sequencing peak diagram of the sex-specific SNP marker amplification product of the Chinese soft-shelled turtle corresponding to the 106th base in this embodiment of the invention;

[0026] Figure 3 This is the sequencing peak diagram of the sex-specific SNP marker amplification product of the Chinese soft-shelled turtle corresponding to the 109th base in this embodiment of the invention;

[0027] Figure 4 This is a sequencing comparison diagram of different genotypes of SNP markers in male and female Chinese soft-shelled turtles according to an embodiment of the present invention. Detailed Implementation

[0028] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. The embodiments described herein are for illustrative purposes only and are not intended to limit the invention.

[0029] Based on the information contained herein, various changes to the precise description of the invention can be readily made by those skilled in the art without departing from the spirit and scope of the appended claims. It should be understood that the scope of the invention is not limited to the defined processes, properties, or components, as these embodiments and other descriptions are merely illustrative of specific aspects of the invention. In fact, various modifications to embodiments of the invention that will be apparent to those skilled in the art or related fields are covered within the scope of the appended claims.

[0030] To better understand the invention and not to limit its scope, all figures and other numerical values ​​used in this invention to indicate amounts, percentages, or other quantities should, in all cases, be understood to be modified by the word "approximately." Therefore, unless specifically stated otherwise, the numerical parameters listed in the specification and appended claims are approximate values ​​and may vary depending on the desired properties being sought. Each numerical parameter should at least be considered as obtained based on reported significant figures and through conventional rounding methods.

[0031] The terms “comprising,” “including,” “containing,” “having,” and similar words are non-restrictive and can include other steps and other components that do not affect the result. The term “and / or” should be considered as a specific disclosure of each of the two specified features or components, with or without the other. For example, “A and / or B” is considered to include (i) A, (ii) B, and (iii) A and B.

[0032] To make the above-mentioned objectives, features and advantages of the present invention more apparent and understandable, the specific embodiments of the present invention will be described in detail below.

[0033] This invention involved whole-genome resequencing of 20 randomly selected Chinese soft-shelled turtles. The raw high-throughput sequencing data underwent quality filtering, and the differences between the sequenced genome and the reference genome were compared to obtain SNP genotyping data. Association analysis with sex revealed two SNP variants closely linked to sex traits in Chinese soft-shelled turtles. Primers were designed for these two sex-specific SNP loci, and population testing was conducted using 16 samples (8 females and 8 males) to verify the association between the genotype of the SNP loci and the sex of the Chinese soft-shelled turtles. These SNPs can be developed into sex-specific SNP molecular markers.

[0034] The two SNP loci are located at positions 3285228 and 3285231 on the Z chromosome (ChrZ) of the Chinese soft-shelled turtle (Pelodiscus sinensis isolate PRFRI1_Ps_1.0, GenBank assembly number GCA_048772765.1), or at positions 10561289 and 10561292 on the W chromosome (ChrW). The two SNP loci are named ZHB_SNP1 and ZHB_SNP2 according to their physical location on the chromosome, with ZHB being the abbreviation for Chinese soft-shelled turtle. ZHB_SNP1 exhibits T / G polymorphism, while ZHB_SNP2 exhibits G / A polymorphism.

[0035] The Chinese softshell turtle exhibits a ZW-type sex determination mechanism, with females having a ZW sex chromosome composition and males having a ZZ sex chromosome composition. The ZHB_SNP1 locus has genotypes TG and TT, with the TG genotype indicating females and the TT genotype indicating males. The ZHB_SNP2 locus has genotypes GA and GG, with the GA genotype indicating females and the GG genotype indicating males. Furthermore, these two variant loci are closely spaced and completely linked in genetics; that is, the TG+GA genotype combination at both ZHB_SNP1 and ZHB_SNP2 loci is linked in females, and the TT+GG genotype combination is linked in males. Therefore, either or both can be independently developed as SNP molecular markers for sex identification or auxiliary identification.

[0036] An embodiment of the present invention provides an application of SNP markers, primer pairs or kits for the genetic sex identification of Chinese soft-shelled turtles; the SNP marker is located at the 106th and / or 109th bases of the nucleotide sequence shown in SEQ ID NO.3, where K is selected from T or G, and R is selected from G or A, as shown in the SEQ ID NO.3 sequence below;

[0037] CAGTATTCTTTCCTTAAACTGTGTGCTTTACACATCATATGTGATTCTTTTTAGATTACAACAATATAGGAAAATTCTTGAATAGAATTCTGGGTATGGAGGTGCAKCARCAGAATGCTTTATTCCAGTATTTCTCTGATACGTTAAATGCAGTTATACAAAATGCTAAGAAGAATGGAAGATATGACATGGGTATTTTAGGT (see SEQ ID NO. 3);

[0038] Among them, the 106th base has TT and TG genotypes. When it is TT genotype, the Chinese soft-shelled turtle being tested is male, and when it is TG genotype, the Chinese soft-shelled turtle being tested is female. The 109th base has GG and GA genotypes. When it is GG genotype, the Chinese soft-shelled turtle being tested is male, and when it is GA genotype, the Chinese soft-shelled turtle being tested is female.

[0039] The development and application of sex-specific molecular markers provide a crucial tool for sex identification and sex-controlled breeding. This invention, through whole-genome resequencing data and sex association analysis, screened a novel sex-specific SNP molecular marker. This marker can transform the determination of sex traits in Chinese soft-shelled turtles into the determination of SNP marker genotypes, enabling sex identification at the genetic level. This facilitates rapid, efficient, accurate, and high-throughput identification of the predicted sex phenotype of Chinese soft-shelled turtles at any stage of the breeding process, such as the hatchling or juvenile stage. It solves the problem of accurately determining sex visually before gonadal maturity, significantly improving the screening efficiency and selection intensity for male Chinese soft-shelled turtles, promoting the breeding of all-male or high-male-ratio populations. Furthermore, by selecting the genetic background of the SNP locus, it helps reduce the interference of environmental factors, improving the accuracy and reliability of early sex selection in Chinese soft-shelled turtles. This allows for more precise screening of individuals of the desired sex in large-scale farming, significantly improving the economic benefits of Chinese soft-shelled turtle farming, reducing farming costs, and promoting the high-quality and sustainable development of the Chinese soft-shelled turtle farming industry.

[0040] The detection of the SNP marker genotype of this invention can be performed using methods commonly used in the prior art, such as gene chip technology, competitive allele-specific PCR (KASP) technology, Taqman probe technology, high-resolution melting curve (HRM) method, allele-specific PCR (AS-PCR) technology, direct sequencing method, and matrix-assisted laser desorption / ionization time-of-flight mass spectrometry.

[0041] This invention preferably employs a direct sequencing method, including the steps of extracting genomic DNA from the individual Chinese soft-shelled turtle to be tested, PCR amplification of the target fragment, and sequencing of the target fragment. In the sequencing peak diagram, a homozygous SNP marker genotype shows a single peak, while a heterozygous genotype shows a double peak, making it easy to distinguish between different genotypes. Specifically, in the sequencing peak diagram, a single peak of T at position 106 indicates the TT genotype, and a double peak of TG indicates the TG genotype; a single peak of G at position 109 indicates the GG genotype, and a double peak of GA indicates the GA genotype.

[0042] Another embodiment of the present invention provides a primer pair for genetic sex identification of Chinese soft-shelled turtles. The primer pair is used to detect SNP markers as described above. The primer pair includes an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer (F) is shown in SEQ ID NO.1, and the nucleotide sequence of the downstream primer (R) is shown in SEQ ID NO.2.

[0043] ZHB_SNP_F: CAGTATTCTTTCCTAAACTG (see SEQ ID NO.1);

[0044] ZHB_SNP_R: ACCTAAAATACCCATGTCA (see SEQ ID NO.2).

[0045] This invention uses the genomic DNA of the Chinese soft-shelled turtle as a template, performs PCR amplification using the above-mentioned detection primer pairs, and sequences the amplification products to obtain accurate base information of SNP marker sites. The primers have high specificity and good molecular marker genotyping effect, which is conducive to the rapid, accurate and efficient identification of SNP marker genotypes, and thus the identification of the sex of the Chinese soft-shelled turtle individual.

[0046] Another embodiment of the present invention provides a kit for genetic sex identification of Chinese soft-shelled turtles, the kit comprising primer pairs as described above.

[0047] The advantages of the kit over existing technologies are the same as those of the detection primers described above, and will not be repeated here.

[0048] Optionally, the kit may also include PCR amplification reagents. The present invention does not have any special limitation on the source of the PCR amplification reagents, and conventional commercially available products in the art can be used.

[0049] In a typical implementation, the PCR amplification reagents include Taq DNA polymerase, dNTPs, and buffer reagents, such as the 2×Taq Master Mix (Dye) kit from Jiangsu Kangwei Century Technology Co., Ltd.

[0050] This invention does not impose specific limitations on the total amount of PCR amplification reagents and detection primers in the kit; the amounts can be set according to the standard requirements of the kit. Generally, the concentrations of the upstream and downstream primers are 10-20 mM, which is usually the concentration of the stock solution.

[0051] Based on the same inventive concept as described above, another embodiment of the present invention provides a method for identifying the sex of a Chinese softshell turtle, comprising the following steps:

[0052] Genomic DNA was extracted from the Chinese soft-shelled turtle individuals to be tested;

[0053] The genomic DNA was amplified by polymerase chain reaction (PCR) using the primer pairs shown in SEQ ID NO.1-2 to obtain the amplification product;

[0054] The genotype of the amplification product at positions 106 and / or 109 is detected, and the sex of the Chinese soft-shelled turtle to be tested is determined based on the genotype.

[0055] Among them, the 106th base has TT and TG genotypes. When it is TT genotype, the Chinese soft-shelled turtle being tested is male, and when it is TG genotype, the Chinese soft-shelled turtle being tested is female. The 109th base has GG and GA genotypes. When it is GG genotype, the Chinese soft-shelled turtle being tested is male, and when it is GA genotype, the Chinese soft-shelled turtle being tested is female.

[0056] This invention does not specifically limit the method for extracting genomic DNA from individual Chinese soft-shelled turtles. Commonly used genomic DNA extraction methods in the field can be employed, such as the commonly used phenol-chloroform crude extraction method or CTAB extraction method, or commercially available genomic DNA extraction kits, such as the general-purpose column-type genomic DNA extraction kit from Jiangsu Kangwei Century Technology Co., Ltd.

[0057] Optionally, the PCR amplification reaction system, in 40 μL, includes: 20 μL of 2×Taq Master Mix (Dye), 1.6 μL of upstream primer, 1.6 μL of downstream primer, 1 μL of genomic DNA, and 15.8 μL of deionized water (ddH2O).

[0058] Optionally, the PCR amplification reaction program includes: 35 cycles of pre-denaturation at 94℃ for 3 min, denaturation at 94℃ for 30 s, annealing at 58℃ for 30 s, extension at 72℃ for 15 s; running at 72℃ for 5 min; and storing the amplification reaction solution at 4℃ for later use.

[0059] Optionally, the genotype of the amplified product at positions 106 and / or 109 is determined using Sanger sequencing.

[0060] The present invention will be further illustrated below with reference to specific embodiments. Experimental methods in the following embodiments that do not specify specific conditions are generally performed under conventional conditions, such as those described in *Molecular Cloning: A Laboratory Manual (Fourth Edition)* published by Cold Spring Harbor Laboratory, or generally under the conditions recommended by the manufacturer.

[0061] 1. Experimental group

[0062] The 20 Chinese softshell turtles used for genome resequencing were obtained from Guangdong Green Card Industry Co., Ltd. After confirming they were free of surface infections and exhibited normal activity, they were used for subsequent genome extraction. The 16 Chinese softshell turtles used for population validation of molecular markers were obtained from the Turtle and Softshell Turtle Breeding and Conservation Research Base of the Pearl River Fisheries Research Institute.

[0063] 2. Gender determination

[0064] The sex phenotype of the tested individuals was determined by collecting sexually mature individuals and observing their gonadal phenotypes after dissection. Chinese softshell turtles were cultured to sexual maturity, and preliminary classification was performed based on morphological observation. Male turtles had long, slender tails that naturally extended beyond the ventral edge, with a relatively stiff tail tip; female turtles had short, thick tails that did not protrude beyond the ventral edge, with a softer tail tip. Each individual was then anesthetized in an ice box, and after anesthesia, their entire body was disinfected with 75% ethanol to remove dirt. Subsequently, the genital opening was cut open to observe the gonads, ultimately determining their sex.

[0065] 3. Whole-genome resequencing and sex association analysis of the experimental population

[0066] Muscle tissue was collected from Chinese soft-shelled turtles cultured to 3 winter ages. Genomic DNA was extracted from the samples using a universal column-type genomic DNA extraction kit (purchased from Jiangsu Kangwei Century Technology Co., Ltd., catalog number CW2298M). The operation steps were performed according to the instruction manual.

[0067] After quality control of the extracted genomic DNA, high-throughput resequencing of the genome was performed using the DNBSEQ platform, with a sequencing depth of approximately 15×, a pair-end 150bp sequencing strategy, and a sequencing throughput of approximately 33Gb. Read alignment and filtering (CleanReads) were performed on the sequencing data to obtain high-quality whole-genome resequencing data. Base identification was performed on the raw image data obtained from the resequencing using CASAVA software, and these raw sequence data were further converted to FASTQ format. However, these raw data often contain sequencing adapter sequences and low-quality reads; therefore, strict filtering was required before further analysis. SOAPnuke (v2.1.0) software developed by BGI Genomics Co., Ltd. was used to remove reads contaminated by adapters, reads with excessively low base quality (i.e., bases with a quality value of 12 or less accounting for 50%), and reads containing too many N bases (more than 10%). The resulting high-quality CleanData was used for subsequent analysis (after filtering, CleanData Q20 was greater than 90%, and Q30 was greater than 80%). The aforementioned work was commissioned to Guangzhou Ruike Gene Technology Co., Ltd.

[0068] BWA alignment software and the mem alignment strategy were used to align paired-end (PaiR-end) sequencing data to the PRFRI1 reference genome of the Chinese soft-shelled turtle (GenBank assembly number GCA_048772765.1). Default alignment parameters were used. To improve the accuracy and reliability of molecular marker detection and reduce interference from alignment errors, sequencing reads that were paired-end aligned and uniquely aligned to the reference genome were selected for subsequent molecular marker screening analysis. After alignment, the aligned sequences were sorted using samtools (version 1.14).

[0069] After the alignment was completed, SNP variant sites across the entire genome were detected using the default parameters of the deepvaRiant software, and the molecular marker genotypes were re-verified using samtoolsmpileup and Python programs. The Chinese soft-shelled turtle exhibits a ZW-type sex determination mechanism; therefore, SNP sites on the sex chromosomes that conform to the pattern of homozygous genotype in males and heterozygous genotype in females were selected as potential sex-linked molecular markers.

[0070] Based on the gene sequences assembled from the high-throughput sequencing data analysis, two sex-specific SNP loci with different genotypes were discovered in male and female Chinese soft-shelled turtle samples, named ZHB_SNP1 and ZHB_SNP2, respectively. ZHB_SNP1 is located at 3285228 bases on the Z chromosome (ChrZ) of the reference genome (GCA_048772765.1), or at 10561289 bases on the W chromosome (ChrW). It exhibits T / G polymorphism and has TG and TT genotypes. In females, this locus is the TG genotype, and in males, it is the TT genotype. ZHB_SNP2 is located at 3285231 bases on the Z chromosome (ChrZ) of the reference genome (GCA_048772765.1), or at 10561292 bases on the W chromosome (ChrW). It exhibits G / A polymorphism and has GA and GG genotypes. In females, this locus is the GA genotype, and in males, it is the GG genotype.

[0071] 4. Molecular marker validation at the natural population level

[0072] Primers were designed for the two sex-specific SNP loci mentioned above. Genomic DNA was extracted from 16 randomly selected population samples (8 females and 8 males) for PCR amplification. Finally, Sanger sequencing was used to verify the SNP loci genotypes and their association with sex. The final sex of the population samples was confirmed by observing the gonads after dissection. Eight female samples were named ZHB-F1 to ZHB-F8, and eight male samples were named ZHB-M1 to ZHB-M8.

[0073] 4.1 PCR detection primer sequence design

[0074] Based on the genome sequence and upstream and downstream sequences of molecular markers assembled from high-throughput sequencing data analysis, PCR validation primer pairs ZHB_SNP_F and ZHB_SNP_R were designed using Primer3version 4.1.0 software (web link: https: / / bioinfo.ut.ee / primer3-0.4.0 / ). The primer sequences are as follows, with upstream and downstream primers denoted by F and R, respectively:

[0075] ZHB_SNP_F: CAGTATTCTTTCCTAAACTG (see SEQ ID NO.1);

[0076] ZHB_SNP_R: ACCTAAAATACCCATGTCA (see SEQ ID NO.2).

[0077] ZHB_SNP1 and ZHB_SNP2 are located at 106 and 109 bases respectively in the amplification product, and exhibit T / G and G / A polymorphisms. The amplification product sequences are as follows:

[0078] CAGTATTCTTTCCTAAACTG TGTGCTTTACACATCATATGTGATTCTTTTTAGATTACA

[0079] ACAATATAGGAAAATTCTTGAATAGAATTCTGGGTATGGAGGTGCAKCARCAGAATGCTT

[0080] TATTCCAGTATTTCTCTGATACGTTAAATGCAGTTATACAAAATGCTAAGAAGAATGGAA

[0081] GATA TGACATGGGTATTTTAGGT (See SEQ ID NO.3), K = T or G, R = G or A, and the underlined part indicates the primer sequence.

[0082] 4.2 PCR amplification and band detection

[0083] Muscle tissue was collected from Chinese soft-shelled turtles cultured to 3 winter ages, and the genome was extracted using a universal column-type genomic DNA extraction kit from Jiangsu Kangwei Century Technology Co., Ltd.

[0084] PCR amplification was performed using extracted genomic DNA as a template. The PCR amplification system (40 μL) consisted of: 20 μL of 2×TaqMaster Mix (Dye) (purchased from Jiangsu Kangwei Century Technology Co., Ltd., catalog number CW0682L), 1.6 μL of upstream primer, 1.6 μL of downstream primer, 1 μL of genomic DNA, and 15.8 μL of deionized water (ddH2O). The reaction program included: 94℃ pre-denaturation for 3 min, 94℃ denaturation for 30 s, 58℃ annealing for 30 s, and 72℃ extension for 15 s, for a total of 35 cycles; followed by a 5 min run at 72℃. The amplified reaction solution was stored at 4℃ for later use.

[0085] 3 μL of the amplification product was subjected to electrophoresis on a 1.1% agarose gel at 160 V for 30 min. The electrophoresis gel image is shown below. Figure 1 As shown, lane M is the molecular marker (DM2000, purchased from Jiangsu Kangwei Century Biotechnology Co., Ltd., catalog number CW0632M). The DM2000 DNA marker consists of six DNA fragments, with lengths of 2000bp, 1000bp, 750bp, 500bp, 250bp, and 100bp. Lanes 1-16 represent female samples ZHB-F1 to ZHB-F8 and male samples ZHB-M1 to ZHB-M8, respectively. The amplified fragment size is 202bp, exhibiting a single target band, demonstrating the good specificity of the detection primers.

[0086] The gel electrophoresis bands were cut off, the amplification products were recovered, and Sanger sequencing was performed. The sequencing peak diagrams for female and male individuals of ZHB_SNP1 and ZHB_SNP2 are shown in Figures 2-3. The sequencing results were analyzed using Codoncode software. After removing low-quality bases, the sequences were spliced ​​to obtain the PCR product sequences. Sequence alignment confirmed the genotypes of the SNP loci. The sequence alignment results for female and male individuals are shown in Figure 2-3. Figure 4 .

[0087] In male individuals, ZHB_SNP1 sequencing yielded only individuals with the TT genotype, and ZHB_SNP2 sequencing yielded only individuals with the GG genotype. Their sequencing sequences are as follows:

[0088] CAGTATTCTTTCCTAAACTGTGTGCTTTACACATCATATGTGATTCTTTTTAGATTACA

[0089] ACAATATAGGAAAATTCTTGAATAGAATTCTGGGTATGGAGGTGCATCAGCAGAATGCTT

[0090] TATTCCAGTATTTCTCTGATACGTTAAATGCAGTTATACAAAATGCTAAGAAGAATGGAA

[0091] GATATGACATGGGTATTTTAGGT (see SEQ ID NO. 4).

[0092] In female individuals, ZHB_SNP1 sequencing yielded individuals with the TG genotype, and ZHB_SNP2 sequencing yielded individuals with the GA genotype. Their sequencing sequences include SEQ ID NO.4 and SEQ ID NO.5. The sequence of SEQ ID NO.5 is as follows:

[0093] CAGTATTCTTTCCTAAACTGTGTGCTTTACACATCATATGTGATTCTTTTTAGATTACA

[0094] ACAATATAGGAAAATTCTTGAATAGAATTCTGGGTATGGAGGTGCAGCAACAGAATGCTT

[0095] TATTCCAGTATTTCTCTGATACGTTAAATGCAGTTATACAAAATGCTAAGAAGAATGGAA

[0096] GATATGACATGGGTATTTTAGGT (see SEQ ID NO. 5).

[0097] Sex was classified based on the ZHB_SNP1 and ZHB_SNP2 molecular marker genotypes. Females were heterozygous and males were homozygous, as follows: at ZHB_SNP1 (106 locus), the genotype of female samples was TG, and the genotype of male samples was TT; at ZHB_SNP2 (109 locus), the genotype of female samples was GA, and the genotype of male samples was GG. Furthermore, the TG+GA genotype combination at ZHB_SNP1 (106 locus) and ZHB_SNP2 (109 locus) was completely linked in female individuals, and the TT+GG genotype combination was completely linked in male individuals. Either or both combinations could be used for sex identification. The sex information based on the aforementioned SNP loci or their combinations was consistent with the sex information confirmed by physiological anatomy (see Table 1), proving that the molecular markers of this invention are completely linked to sex, and their genotypes can be used for rapid identification of the genetic sex of Chinese soft-shelled turtles, with a sex differentiation accuracy of 100%.

[0098] Table 1. Statistics on SNP loci genotypes and inherited sex.

[0099]

[0100] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. The application of an SNP marker, primer pair, or kit for genetic sex identification of the Chinese soft-shelled turtle in the sex identification of the Chinese soft-shelled turtle, characterized in that, The SNP marker is located at the 106th or 109th base of the nucleotide sequence shown in SEQ ID NO.3, where K is selected from T or G, and R is selected from G or A; Among them, the 106th base has TT and TG genotypes. When it is TT genotype, the Chinese soft-shelled turtle being tested is male, and when it is TG genotype, the Chinese soft-shelled turtle being tested is female. The 109th base has GG and GA genotypes. When it is GG genotype, the Chinese soft-shelled turtle being tested is male, and when it is GA genotype, the Chinese soft-shelled turtle being tested is female. The primer pair includes an upstream primer and a downstream primer, the nucleotide sequences of which are shown in SEQ ID NO.1-2, respectively, and the kit includes the primer pair.

2. The application of the SNP markers, primer pairs, or kits for genetic sex identification of Chinese soft-shelled turtles according to claim 1 in the sex identification of Chinese soft-shelled turtles, characterized in that, The kit also includes PCR amplification reagents, which include Taq DNA polymerase, dNTPs, and buffer reagents.

3. A method for determining the sex of the Chinese soft-shelled turtle, characterized in that, Includes the following steps: Genomic DNA was extracted from the Chinese soft-shelled turtle individuals to be tested; The genomic DNA was amplified by polymerase chain reaction using primer pairs as shown in SEQ ID NO.1-2 to obtain amplification products; The genotype of the amplification product at position 106 or 109 is detected, and the sex of the Chinese soft-shelled turtle to be tested is determined based on the genotype. Among them, the 106th base has TT and TG genotypes. When it is TT genotype, the Chinese soft-shelled turtle being tested is male, and when it is TG genotype, the Chinese soft-shelled turtle being tested is female. The 109th base has GG and GA genotypes. When it is GG genotype, the Chinese soft-shelled turtle being tested is male, and when it is GA genotype, the Chinese soft-shelled turtle being tested is female.

4. The method for determining the sex of the Chinese soft-shelled turtle according to claim 3, characterized in that, The polymerase chain reaction amplification reaction system, in 40 μL volume, includes: 20 μL of 2×Taq Master Mix, 1.6 μL of upstream primer, 1.6 μL of downstream primer, 1 μL of genomic DNA, and 15.8 μL of deionized water; The polymerase chain reaction amplification reaction program includes: pre-denaturation at 94 °C for 3 min; denaturation at 94 °C for 30 s, annealing at 58 °C for 30 s, extension at 72 °C for 15 s, for a total of 35 cycles; and running at 72 °C for 5 min.

5. The method for determining the sex of the Chinese soft-shelled turtle according to claim 3, characterized in that, The genotype was detected using Sanger sequencing.