Gene and protein for regulating tobacco polyphenol aroma substances and application of gene and protein

Abstract

The invention discloses a gene and a protein for adjusting tobacco polyphenol aroma substances and application of the gene and the protein. The gene is a tobacco NtMYB28 gene, and the CDS sequence of the tobacco NtMYB28 gene is as shown in SEQ ID No. 1. The invention further discloses application of the tobacco NtMYB28 gene in regulating the content of endogenous polyphenol substances in tobacco and regulating and controlling the metabolic pathway of phenylpropane in tobacco. The key gene NtMYB28 capable of simply and effectively adjusting the content of polyphenol substances in tobacco and the metabolic pathway of phenylpropane is found, and the gene can be applied to efficient cultivation of new high-aroma tobacco materials and development and utilization of new high-value functional tobacco germplasm.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of plant molecular biology and genetic engineering, in particular to a gene, protein and application for regulating tobacco polyphenolic aroma substances. BACKGROUND

[0002] Polyphenolic compounds are important natural products with phenolic hydroxyl structure in plant secondary metabolites, which widely exist in various plant tissues and organs. According to the different structure types, polyphenolic compounds include flavonoids (flavones, rutin, rhamnose), tannins (caffeic acid, chlorogenic acid and quinic acid), coumarins (anisatin, anisatin, aesculetin) and the like. Among them, the chlorogenic acid formed by the dehydration condensation of caffeic acid and quinic acid is a tannin compound (also known as coffee tannin) produced by the shikimic acid pathway in the aerobic respiration process of plants, which has a high content and biological activity in many plants. Due to the presence of ester bond, unsaturated double bond and multiple phenol in the molecule, chlorogenic acid usually exists in the form of coexistence of multiple isomers in plants. In tobacco leaves, the content of chlorogenic acid can reach 3%. As one of the important potential aroma components in tobacco, the content of chlorogenic acid is closely related to the aroma and color of tobacco, and has an important influence on the growth and development of tobacco, the color of tobacco and the aroma of tobacco. Chlorogenic acid is a weakly fragrant substance, which is a diester of quinic acid and caffeic acid, and neochlorogenic acid is its isomer. In addition to its own fragrance, chlorogenic acid can also generate pyrazine, pyridine and pyrrole under the action of polyphenol oxidase and other enzymes, which can impart elegant aroma to tobacco products and increase the aroma amount of tobacco products. In addition, chlorogenic acid is also an important natural antioxidant, which can remove "free radicals" harmful to the human body, reduce the occurrence of various human diseases such as cancer and cardiovascular disease, and is often used for the development and utilization of high-value plant resources. Therefore, the study on the biosynthesis and accumulation of chlorogenic acid in tobacco has important significance for improving the quality of tobacco and developing new germplasm of functional crops.

[0003] The biosynthesis of polyphenols in higher plants is mainly generated via the phenylpropanoid metabolic pathway. The pathway starts from phenylalanine, which is generated by phenylalanine ammonia-lyase (PAL), cinnamic acid-4-hydroxylase (C4H), and p-coumarate CoA ligase (4CL). Subsequently, 4-coumaroyl-CoA is generated by the action of hydroxycinnamoyl-CoA shikimate / quinate hydroxycinnamoyltransferase (HCT), hydroxycinnamoyl-CoA quinate hydroxycinnamoyltransferase (HQT), and p-coumarate-3'-hydroxylase (C3H), and finally chlorogenic acid is generated. Meanwhile, coumaroyl-CoA can also be generated by the action of HCT and shikimic acid, and then by the action of C3H to generate caffeoylshikimic acid, and finally by the action of HQT to generate chlorogenic acid. PAL, C4H, and 4CL are considered to be key enzymes in the phenylpropanoid metabolic pathway and are crucial for the synthesis and accumulation of polyphenols such as chlorogenic acid.

[0004] Unlike the catalytic enzyme genes (structural genes) in the metabolic pathway, transcription factors can play a whole regulatory role in specific plant secondary metabolic pathways by directly recognizing and activating the expression of multiple structural enzyme genes in the metabolic pathway. Although the research on the biosynthetic pathway of plant polyphenols has been relatively clear, a series of synthetic enzyme genes in the pathway have been better explored and identified, but the research on the transcription factors involved in the upstream regulation of the polyphenol biosynthetic pathway is still relatively less. In particular in tobacco, the molecular regulation network of polyphenol biosynthesis and metabolism is not clear. There are still a large number of transcription factors involved in the synthesis and accumulation of tobacco polyphenols, especially chlorogenic acid, which need to be explored, identified and utilized.

[0005] The present application provides a gene and protein for regulating tobacco polyphenolic aroma substances, and the identified tobacco NtMYB28 gene can regulate the synthesis and accumulation of polyphenols by directly regulating the expression of key synthetic enzyme genes in the phenylpropanoid metabolic pathway. The gene can not only be used for creating new tobacco materials with high aroma, but also can be used for developing and utilizing new tobacco germplasm with high value. SUMMARY

[0006] The present application aims to provide a gene NtMYB28 and protein for regulating tobacco polyphenolic aroma substances.

[0007] Another object of the present application is to provide an application of the tobacco transcription factor NtMYB28 gene.

[0008] The object of the present application can be achieved by the following technical solutions.

[0009] The tobacco NtMYB28 gene has a CDS sequence as shown in SEQ ID No. 1.

[0010] The protein encoded by the tobacco NtMYB28 gene has an amino acid sequence shown as SEQ ID No. 2.

[0011] The recombinant expression plasmid overexpressing the tobacco NtMYB28 gene.

[0012] The tobacco NtMYB28 gene provided by the application is applied to regulating the content of endogenous polyphenols in tobacco, regulating the phenylpropanoid metabolic pathway in tobacco, preferably applied to increasing the content of endogenous chlorogenic acid, neochlorogenic acid, cryptochlorogenic acid and caffeic acid in tobacco, or preferably applied to promoting the gene expression in the phenylpropanoid metabolic pathway in tobacco.

[0013] The content of endogenous polyphenols in tobacco is increased in the NtMYB28 overexpression material.

[0014] The gene expression in the phenylpropanoid metabolic pathway in tobacco is increased in the NtMYB28 overexpression material.

[0015] Beneficial effects:

[0016] The experiments of the application prove that by inhibiting the expression level of the NtMYB28 gene in tobacco, the content of endogenous chlorogenic acid, neochlorogenic acid, cryptochlorogenic acid and caffeic acid and the transcription level of the key genes Nt4CL2 and NtPAL2 in the phenylpropanoid metabolic pathway in tobacco can be reduced, and by promoting the expression level of the NtMYB28 gene in tobacco, the content of endogenous chlorogenic acid, neochlorogenic acid, cryptochlorogenic acid and caffeic acid and the transcription level of the key genes Nt4CL2 and NtPAL2 in the phenylpropanoid metabolic pathway in tobacco can be increased.

[0017] Therefore, the application finds the key gene NtMYB28 for regulating the content of polyphenols in plants and regulating the phenylpropanoid metabolic pathway, which can be used for creating new tobacco materials with high aroma and for efficiently cultivating functional plant materials with high polyphenols, and has very important value and significance in the fields of food science, medicine and molecular plant breeding. BRIEF DESCRIPTION OF DRAWINGS

[0018] Figure 1 Identification of NtMYB28 overexpression and gene editing materials (Note: a. Target site sequence after NtMYB28 gene editing; b. Expression level of NtMYB28 gene in NtMYB28 overexpression material).

[0019] Figure 2The protein sequence encoded by the NtMYB28 gene after mutation. (Note: a. The protein sequence encoded by the NtMYB28 gene after deletion of TGGGA bases (KO#11); b. The protein sequence encoded by the NtMYB28 gene after insertion of T bases (KO#14).

[0020] Figure 3 Identification of the content of endogenous chlorogenic acid, neochlorogenic acid, cryptochlorogenic acid and caffeic acid in NtMYB28 mutant and overexpression materials.

[0021] Figure 4 Identification of the expression pattern of key genes Nt4CL2 and NtPAL2 in the phenylpropanoid metabolic pathway in NtMYB28 mutant and overexpression materials. DETAILED DESCRIPTION

[0022] The instruments, reagents, materials and the like involved in the following examples, if not specifically stated, are all conventional instruments, reagents, materials and the like in the prior art, which can be obtained through regular commercial channels. The technologies, experimental methods, detection methods and the like involved in the following examples, if not specifically stated, are all conventional technologies, experimental methods, detection methods and the like in the prior art.

[0023] Example 1 Preparation of NtMYB28 gene mutant and overexpression materials

[0024] 1. Construction of NtMYB28 gene editing vector

[0025] According to the DNA sequence of NtMYB28 gene, specific target sites were designed in the exon region of the target gene using CRISPR MultiTargeter online website (http: / / www.multicrispr.net / index.html), and specific target sequences Targetl: CTTGGAATCATGATTTTTGG and Target2: AGAAGTAGTAGGACCCTTGG were obtained, wherein the last three bases TGG were PAM region. The target site sequence with PAM region (TGG) removed and added with enzyme cutting site linker (GATT added to upstream F sequence and AAAC added to downstream R sequence) and its reverse complementary sequence were sent to the company for primer synthesis. The synthesized 2 pairs of single-stranded Oligo DNA primers (labeled as Targetl-F: GATTCTTGGAATCATGATTTT, Targetl-R: AAACAAAATCATGATTCCAAG; Target2-F: GATTAGAAGTAGTAGGACCCT, Target2-R: AAACAGGGTCCTACTACTTCT) were diluted to 50 μM. In 2 PCR tubes, Targetl-F / R and Target2-F / R were mixed respectively, and each primer was taken by 10 ul, after mixing, annealing reaction was carried out in PCR instrument to form dsDNA, labeled as Targetl and Target2. The annealing program was as follows: 95°C for 5 min, 90°C for 1 min, 80°C for 1 min, 70°C for 1 min, 60°C for 1 min, 50°C for 1 min, 40°C for 1 min, 30°C for 1 min, 20°C for 1 min, 10°C for 1 min.

[0026] The gene editing expression vector pORE-CAS9 / gRNA was linearized by Bsal enzyme. The enzyme cutting system was as follows: pORE-CAS9 / gRNA plasmid 5ul, 10X buffer 5ul, Bsal 2ul, H2O 38ul. The reaction time was 37℃, 1 hour. After enzyme cutting, the linearized plasmid was recovered by a gel recovery kit and named Cas-PF. The linearized plasmid Cas-PF and the dsDNA formed after annealing (Target1 and Target2) were linked by T4 ligase. The enzyme connection system was as follows: Cas-PF 3ul, annealing product Target1 or Target2 10ul, T4 DNA buffer 2ul, T4 DNA ligase 1ul, H2O 4ul. The reaction time was 25℃, 10 minutes. The ligation product was transformed into E. coli DH5a competent cells (for details, refer to the E. coli DH5a competent cell instruction), and positive clones were identified by colony PCR. The forward primer for colony PCR was JP-F: aaggaatctttaaacatacgaacag, and the reverse primer was the reverse sequence of annealed sgRNA, Target1 / 2-R. The target band size was about 450bp. After positive clones were cultured at 37℃ for 8 hours, the plasmid was extracted and sent to the company for sequencing with JP-F. The sequencing results were analyzed to determine whether the target site sequence was correct. The plasmid with correct sequencing results was named Target1-cas and Target2-cas.

[0027] 2. Construction of NtMYB28 gene overexpression vector

[0028] (1) NtMYB28 gene CDS cloning

[0029] According to the CDS sequence information of NtMYB28 gene in the tobacco reference genome, specific primers NtMYB28-CDS-F: ATGGGGAGAGCTCCTTGTTGTGAGA and NtMYB28-CDS-R: TCAAAATTCTGGTAATTCTGGC were designed. NtMYB28 gene CDS sequence was cloned using tobacco leaf cDNA as a template. The PCR reaction system was as follows: tobacco leaf cDNA 1ul, NtMYB28-CDS-F 1ul, NtMYB28-CDS-R 1ul, PrimeSTAR Max Premix (2x) 25ul, H2O 22ul. The reaction conditions were as follows: 98℃ 2min; 94℃ 30s, 55℃ 30s, 72℃ 30s, 35 cycles; 72℃ 5min. The PCR product was detected by 1% agarose gel electrophoresis, and the fragment size was 834bp. The PCR product was purified and sent to the company for sequencing. The sequencing results were consistent with those shown in SEQ ID No. 1.

[0030] (2) Construction of NtMYB28 gene overexpression vector

[0031] The plant binary expression vector pBI121 was used as the backbone vector for constructing the NtMYB28 overexpression vector. The pBI121 vector was linearized by double digestion with BamHI and SacI, and the purified product with correct PCR sequencing in step (1) was used as the template to recombine the CDS sequence of the NtMYB28 gene between the BamHI and SacI digestion sites of the expression vector by one-step cloning. The specific operation steps are described in the OneStep Clone kit of Novagen (catalog number: C112-01). The constructed vector was named NtMYB28-OE.

[0032] 3. Tobacco genetic transformation

[0033] 1 ul of Target1 / 2-cas and NtMYB28-OE plasmid was taken respectively, and the above plasmids were transformed into GV3101 Agrobacterium competent cells according to the method described in the GV3101 Agrobacterium competent cell instruction manual, and stored at -80°C for standby. Using Nicotiana tabacum K326 as the background material, the Agrobacterium-mediated tobacco leaf disc transformation method was used for routine operation, and the Agrobacterium containing the target gene overexpression vector NtMYB28-OE and Target1 / 2-cas was transformed into tobacco cells. After 3 days of dark co-culture (G), S1 differentiation screening for 3 weeks, S2 screening for 1-2 weeks, and rooting culture in rooting medium, the antibiotic kanamycin was used for screening. When the transgenic seedlings grew to 2-3 leaves, they were taken out from the culture medium, washed with the culture medium, and then transplanted into pots for further culture until the seeds were harvested.

[0034] 4. Genetic material identification

[0035] (1) Identification of NtMYB28 gene overexpression material

[0036] According to the sequence of the resistance gene on the expression vector, specific primers OE-F1: GATTGCACGCAGGTTCTCCG and OE-R1: GAAGAACTCGTCAAGAAGGCG were designed. The genomic DNA of NtMYB28 gene overexpression material (OE) of seedlings of about 30 days was extracted, and different strains of transgenic plants were identified by PCR using OE-F1 / R1 primers. The PCR reaction system was as follows: tobacco leaf DNA 1 ul, OE-F1 1 ul, OE-R1 1 ul, PrimeSTAR Max Premix (2x) 25 ul, H2O 22 ul. The reaction conditions were as follows: 98°C for 2 min; 94°C for 30 s, 55°C for 30 s, 72°C for 30 s, 35 cycles; 72°C for 5 min. The PCR product was detected by 1% agarose gel electrophoresis, and the fragment size was 770 bp. The positive plants of different strains were transplanted into pots and cultured in an artificial climate room for 10 days.

[0037] The leaves of positive OE and wild type control (WT) plants were collected, RNA was extracted using a plant total RNA extraction kit, and sent to a sequencing company for RNA-seq sequencing, with three biological replicates for each sample. The sequencing data was analyzed using conventional plant transcriptome analysis methods, and the expression level of the target gene was calculated (represented by FPKM value). Meanwhile, the extracted RNA was reverse transcribed into cDNA. According to the CDS sequence of NtMYB28 gene, specific quantitative primers were designed, NtMYB28-q-F: AGCAAGAAGAAATGGAGTCGT, NtMYB28-q-R: GTCCGTTGATAATTTGTCCGTC. The target gene was detected by real-time fluorescence quantitative detection using the Premix ExTaq TM (Perfect Real Time) kit, and the overexpression effect of NtCYC gene was identified. The specific reaction system was as follows:

[0038]

[0039] The running program was designed as follows:

[0040]

[0041] The qRT-PCR reaction was performed on a Roche fluorescence PCR instrument, and the data was exported by Roche Software. The relative expression amount of the target gene was calculated by 2 -ΔCT method.

[0042] As Figure 1As shown in b, the relative expression amount of NtMYB28 gene in NtMYB28 overexpression transgenic materials (OE#8 and OE#13) was significantly higher than that of the wild type control WT.

[0043] (2) Identification of NtMYB28 gene knockout material.

[0044] The NtMYB28 gene knockout mutant tobacco genomic DNA of 30-day-old seedlings was extracted by SLS method. The tobacco genomic DNA was used as a template, and mutant identification primers NtMYB28-KO-F: CTCACATGTGCAGATGGTCAG and NtMYB28-KO-R: GATCATCGACTAGTGTCACAG were used for PCR identification. The PCR reaction system was as follows: tobacco leaf DNA 1 ul, NtMYB28-KO-F 1 ul, NtMYB28-KO-R 1 ul, PrimeSTAR Max Premix (2x) 25 ul, H2O 22 ul. The reaction conditions were as follows: 98℃ for 2 min; 94℃ for 30 s, 55℃ for 30 s, 72℃ for 30 s, 35 cycles; 72℃ for 5 min. The PCR product was detected by 1% agarose gel electrophoresis, and the fragment size was 303 bp. The PCR product was sent to the company for sequencing, and the NtMYB28 gene mutation was analyzed. From 25 mutant lines, two homozygous NtMYB28 mutants ntmyb28-KO11 and ntmyb28-KO14 were screened. Figure 1 As shown in a, the two mutant lines have 5 bases TGGGA inserted (ntmyb28-KO11) and 1 base T inserted (ntmyb28-KO14) at the target position, respectively. The 5 bases TGGGA inserted and 1 base T inserted at the gene editing target position can both make NtMYB28 gene lose function. Figure 2

[0045] Example 2 Determination of endogenous polyphenols content in NtMYB28 mutant and overexpression material

[0046] ​The homozygous NtMYB28 mutant ntmyb28-KO, overexpression material NtMYB28-OE and wild type tobacco WT seeds obtained by the above identification were treated with 0.1% AgNO3 for 10 min, washed with water and dried, then seedbed cultivation was carried out according to the tray seedling method, and 6-week-old tobacco seedlings with uniform growth were selected, the middle leaves were collected and ground into uniform fine powder in liquid nitrogen; 200 mg of powder was accurately weighed in a 2 mL centrifuge tube, 1.0 mL of methanol was added, and it was shaken and mixed; ultrasonic oscillation at 4°C for 1 h; centrifugation at 4°C, 12000 r / min for 5 min, and the supernatant was dried; redissolved with acetonitrile water, filtered, and stored at 4°C for testing, for LCMS / MS-SRM analysis. The LCMS / MS-SRM chromatographic column was C18, 2.5 um, 2.1*100 mm; the mobile phase was A-acetonitrile, C-0.1% formic acid water; the flow rate was 0.3 ml / min; the injection volume was 5.0 ul; the column oven temperature was 35°C; the elution gradient is shown in the following table:

[0047]

[0048]

[0049] The results are shown in Figure 3 It can be seen that in the leaves of two NtMYB28 overexpression materials NtMYB28-OE#8 and NtMYB28-OE#13, the contents of Chlorogenic acid, Neochlorogenic acid, Cryptochlorogenic acid and Caffeic acid are significantly higher than those of WT; while in NtMYB28 mutants ntmyb28-KO#11 and ntmyb28-KO#14, the contents of Chlorogenic acid, Neochlorogenic acid, Cryptochlorogenic acid and Caffeic acid are significantly lower than those of wild type tobacco WT, which shows that NtMYB28 gene in tobacco strongly participates in the regulation of tobacco polyphenol biosynthesis accumulation, and thus it can be seen that this gene has important use in cultivating high-polyphenol plant materials.

[0050] Example 3 Expression pattern analysis of key genes in tobacco phenylpropanoid metabolic pathway in NtMYB28 mutant and overexpression material

[0051] NtMYB28 mutant ntmyb28-KO, overexpression material NtMYB28-OE and wild type tobacco WT plants were cultivated to 6 weeks old according to the method of Example 2. About 0.1 g of middle leaves were sampled, ground into powder in liquid nitrogen, and RNA was extracted. The obtained RNA was stored with dry ice and sent to a sequencing company for transcriptome sequencing. Three biological replicates for each sample. RNA sequencing was performed using Illumina HiSeq TM4000 platform, and sequencing data analysis was performed using conventional plant transcriptome analysis method. The relative expression of key genes Nt4CL2 and NtPAL2 in tobacco phenylpropanoid metabolic pathway was calculated using FPKM method. The results are shown in Figure 4 Figure 2, the relative expression of Nt4CL2 and NtPAL2 was significantly increased in NtMYB28 overexpression material NtMYB28-OE, and significantly decreased in NtMYB28 mutant ntmyb28-KO. This result showed a highly consistent change trend with the polyphenolic substance content, proving that NtMYB28 is a regulatory factor of key genes in tobacco phenylpropanoid metabolic pathway and polyphenolic substance biosynthetic pathway.

Claims

1. A gene NtMYB28 that regulates tobacco polyphenolic aroma substances, characterized by, The CDS sequence of which is shown as SEQ ID No.

1.

2. The protein encoded by the tobacco NtMYB28 gene according to claim 1, characterized in that, The amino acid sequence of which is shown as SEQ ID No.

2.

3. A recombinant expression plasmid over-expressing the tobacco NtMYB28 gene according to claim 1.

4. The tobacco NtMYB28 gene according to claim 1 for use in any of the following, 1) regulating the content of tobacco polyphenols; 2) regulating the expression of key genes in the tobacco phenylpropanoid metabolic pathway. The tobacco polyphenols are endogenous polyphenols of tobacco.

5. Use according to claim 4, characterized in that, The endogenous polyphenols of tobacco are selected from endogenous chlorogenic acid, neochlorogenic acid, cryptochlorogenic acid and caffeic acid of tobacco.

6. Use according to claim 5, characterized in that, The key genes in the tobacco phenylpropanoid metabolic pathway are selected from Nt4CL2 and NtPAL2 which are key genes in the tobacco phenylpropanoid metabolic pathway.

7. Use according to claim 4, characterized in that, Over-expression of the tobacco NtMYB28 gene can:

8. Use according to any one of claims 4 to 7, characterized in that, 1) increase the content of tobacco polyphenols; 2) promote the expression of key genes in the tobacco phenylpropanoid metabolic pathway.

9. The recombinant expression plasmid according to claim 3 for use in any of the following, 1) increasing the content of tobacco polyphenols; 2) promoting the expression of key genes in the tobacco phenylpropanoid metabolic pathway. The tobacco polyphenols are selected from endogenous chlorogenic acid, neochlorogenic acid, cryptochlorogenic acid and caffeic acid of tobacco; and the key genes in the tobacco phenylpropanoid metabolic pathway are selected from Nt4CL2 and NtPAL2 which are key genes in the tobacco phenylpropanoid metabolic pathway. ​ ​ 10. Use according to claim 9, characterized in that, ​

Images