Detection method and kit for identifying DNA (Deoxyribose Nucleic Acid) of Changlin bark beetles

Abstract

The invention relates to the technical field of molecular biological detection, in particular to a method for detecting DNA (Deoxyribose Nucleic Acid) of Changlin bark beetles in a sample, which can realize visual rapid detection of Changlin bark beetles based on an RPA-CRISPR / Cas12a system. The invention provides a primer combination and a specific crRNA sequence for detecting DNA (Deoxyribose Nucleic Acid) of Changlin bark beetles. The detection method disclosed by the invention is simple and convenient to operate, short in reaction time, high in sensitivity and specificity, and suitable for port quarantine, forestry monitoring and field screening, the detection result can be directly interpreted, the detection can be carried out without a heating instrument, and the limitation that traditional detection depends on laboratories and professional operation is broken through; an efficient and convenient detection means is provided, and powerful technical support is provided for early warning and precise prevention and control of the beetles.

Description

Technical Field

[0001] This invention relates to the field of molecular biological detection technology, specifically to detection methods and kits for forest pests. Background Technology

[0002] The forest bark beetle (Hylurgus ligniperda) is an important invasive quarantine pest in forestry, possessing extremely strong dispersal capabilities and adaptability. In recent years, it has been spreading globally, posing a serious threat to forestry ecosystems. Native to Europe, the Mediterranean coast, and nearby Atlantic islands, this insect has been intercepted or found to have established itself in several countries and regions in recent years. In 2021, a large number of individuals were first discovered in black pine (Pinus thunbergii) forests in Yantai, Tai'an, and Weihai areas of Shandong Province, China, confirming its successful invasion and establishment of a stable population. This insect primarily reproduces at the base of the trunk and on exposed roots, causing nutritional deficiencies and mechanical damage to host trees, and easily inducing bacterial or fungal diseases. In severe cases, it can lead to tree death, posing a significant ecological and economic hazard.

[0003] Currently, the quarantine and monitoring of bark beetles such as the forest bark beetle mainly rely on morphological and molecular identification methods. Although morphological identification is an important means of identifying different developmental stages, the small size of bark beetles (about 1 mm) and the extremely similar morphological characteristics between closely related species such as *Hylurgus* and *Tomicus* make it difficult to achieve rapid and accurate differentiation using traditional morphological identification methods. In addition, to obtain obvious characteristics, it is usually necessary to raise the eggs to adults, which is time-consuming and carries a certain risk of failure during isolation and rearing.

[0004] Currently, various molecular biology techniques have been applied to the rapid identification of pests, including:

[0005] PCR amplification and barcoding identification techniques for the mitochondrial COI gene and ribosomal gene 28S, as well as single-gene PCR detection based on specific primers (SS-PCR), are among the methods used. While these methods have improved quarantine efficiency to some extent, they typically rely on laboratory environments, expensive equipment, and skilled personnel. The detection process is often not sensitive enough, complex, time-consuming (requiring hours to days), and cannot achieve on-site visual detection.

[0006] Traditional polymerase chain reaction (PCR) methods (e.g., Ren et al., 2021) detect target species by amplifying the mitochondrial gene COI or the ribosomal gene 28S. However, this method relies on high-temperature denaturation, has a long amplification cycle (usually 2–3 hours), and the amplified products need to be analyzed by agarose gel electrophoresis before being sent to a third-party company for sequencing. The detection cycle is long and the sensitivity is limited. Furthermore, this technology has high requirements for experimental conditions and is only suitable for laboratory environments.

[0007] Species-specific PCR (Li et al., 2024) is another rapid detection method based on specific primer design. Although this method has improved accuracy with a detection limit of 0.46 ng / μL, it still has problems such as complex operation, long detection time (2–3 hours) and low sensitivity, making it difficult to meet the needs of rapid detection in the field and large-scale sample screening.

[0008] Currently, patent literature discloses a detection method for *H. ligniperda* based on recombinase polymerase amplification (RPA) (e.g., CN 118621021 A). This method detects *H. ligniperda* DNA by specifically amplifying it, with a detection limit as low as 13.6 copies / μL. However, the primers used have not been validated for specificity in the *Tomicini* family, posing a risk of cross-amplification. Summary of the Invention

[0009] This invention provides a rapid, highly sensitive, and highly specific visual detection method for detecting the DNA of *Tomicini* based on RPA-CRISPR / Cas12a. The method can detect the DNA of *Tomicini* and distinguish it from other bark beetles, preferably the Tomicini tribe. The Tomicini tribe includes the genera *Tomicus*, *Dendroctonus*, and *Hulurgus*. The *Dendroctonus* genus includes *T. piniperda*, *T. minor*, *T. brevipilosus*, *T. yunnanensis*, and *T. pilifer*. The genus *D. micans* includes *D. valens*. The genus *H. miklitzi* includes *Hulurgus ligniperda* and *H. miklitzi*.

[0010] The recombinase polymerase amplification (RPA) primers used in this invention were designed targeting the conserved region of the COI gene in the mitochondria of *Bark Borer*. The mitochondrial COI gene sequence of *Bark Borer* is as follows:

[0011] AATTGGAGGCTTCGGAAACTGATTAATTCCTTTAATATTAGGGGCCCCAGATATAGCTTTTCCCGCGACTTAATAATAAGATTTTGATTATTACCTCCTTCTTTAACCTTTCTCTTATTAAGAAGAATTGTTGATAAGGGAGCAGGGACAGGTTGAACTGTTTACCCCCCTTTAGC TTCTAATATTTCTCATGAGGGGGCATCAGTTGATCTAGCTATTTTTAGACTTCACATAGCAGGAGTATCATCTATTTTAGGAGCAATAAATTTTATCTCAACTATTATAAATATAAACCCCCCTGGAATAAAATCTGATCGCCTTACTCTCTTCTCATGAGCAGTAAAAATTA (SEQ ID NO.11)

[0012] The present invention adopts the following technical solution:

[0013] This invention provides a method for detecting Bark Borer DNA in a sample, the method comprising the following steps:

[0014] (1) Obtain DNA from the sample;

[0015] (2) Using a combination of recombinase polymerase amplification primers, the DNA is subjected to a recombinase polymerase amplification reaction to obtain a recombinase polymerase amplification product; wherein the combination of recombinase polymerase amplification primers includes a first primer and a second primer, the sequence of the first primer is SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3, and the sequence of the second primer is SEQ ID NO.4, SEQ ID NO.5 or SEQ ID NO.6;

[0016] (3) In the presence of crRNA, the amplification product is reacted with Cas12a protein to generate a single-stranded DNA product; wherein the sequence of the crRNA is SEQ ID NO.7, SEQ ID NO.8 or SEQ ID NO.9;

[0017] (4) Detect the single-stranded DNA product.

[0018] The samples may be animal samples, plant samples, or samples containing animal or plant components, especially samples from logs, timber, wood products, wood packaging, as well as insect samples and samples containing insect fragments.

[0019] The sequence of the first primer is preferably SEQ ID NO.3, and the sequence of the second primer is preferably SEQ ID NO.4. The sequence of the crRNA is preferably SEQ ID NO.7. The Cas12a protein is preferably LbCas12 protein. The crRNA and Cas12a protein can be pre-synthesized using a T7 in vitro transcription kit.

[0020] The reaction time of step (2) can be 5-30 minutes, preferably 20 minutes; the reaction temperature of steps (2) and (3) is 20-45℃, preferably 37℃; the concentration of crRNA in step (3) is greater than or equal to 2.5 nM, and the concentration of Cas12a protein is greater than or equal to 50 nM.

[0021] In step (3), the Cas12a protein activates its non-specific single-stranded DNA enzyme activity after recognizing the target sequence, cleaving the amplification product to generate a single-stranded DNA product. This product releases a fluorescent signal in the presence of the ssDNA fluorescent probe. The preferred sequence of the ssDNA fluorescent probe is TTATT (SEQ ID NO.10), with a FAM fluorescent reporter group (FAM) labeled at its 5' end and a fluorescence quencher group (BHQ-1) labeled at its 3' end.

[0022] In step (4), the emitted fluorescence signal can be detected in the following manner:

[0023] a) Observe the fluorescence signal visible to the naked eye, preferably under a 365 nm ultraviolet lamp; or

[0024] b) Interpret the results using the lateral flow test strip. During operation, the lateral flow test strip can be vertically inserted into a PCR tube containing 50µL of Cas enzyme-treated or diluted product. After incubation at room temperature for 5-10 minutes, the results can be observed.

[0025] This invention also provides a primer combination and crRNA for detecting the DNA of *Bark Borer chinensis*. The primer combination consists of RHPBB-F and RHPBB-R.

[0026] The RHPBB-F includes:

[0027] RHPBB-F1: GGCCCCAGATATAGCTTTTCCCGCGACTT (SEQ ID NO. 1);

[0028] RHPBB-F2: TCCTTTAATATTAGGGGCCCCAGATATAGCT (SEQ ID NO. 2);

[0029] RHPBB-F3: CGGAAACTGATTAATTCCTTTAATATTAGGG (SEQ ID NO. 3).

[0030] The RHPBB-R includes:

[0031] RHPBB-R1: AGATGATACTCCTGCTATGTGAAGTCTA (SEQ ID NO.4);

[0032] RHPBB-R2: GATAAAATTTATTGCTCCTAAAATAGATGATAC (SEQ ID NO.5);

[0033] RHPBB-R3: TGAGAAGAGAGTAAGGCGATCAGATTTTATTCCA (SEQ ID NO. 6).

[0034] The concentration ratio of RHPBB-F to RHPBB-R can be 1:1.

[0035] The crRNA is crRNA-1, crRNA-2, or crRNA-3;

[0036] The nucleotide sequence of crRNA-1 is: UAUUUCUACUAAGUGUAGAUGCUUCUAAUAUUUCUCAUGA (SEQ ID NO.7).

[0037] The nucleotide sequence of crRNA-2 is: UAUUUCUACUAAGUGUAGAUUCAUGAGGGGGCAUCAGUUG (SEQ ID NO.8).

[0038] The nucleotide sequence of crRNA-3 is: UAUUUCUACUAAGUGUAGAUGACUUCACAUAGCAGGAGUA (SEQ ID NO.9).

[0039] The present invention also provides a kit for detecting DNA from *Barkhorax chinensis*, the kit comprising the primer combination described above. Preferably, the kit further comprises the crRNA described above. The kit may also comprise an ssDNA fluorescent probe, the sequence of which is preferably TTATT (SEQ ID NO. 10), with a FAM fluorescent reporter group (FAM) labeled at its 5' end and a fluorescence quencher group (BHQ-1) labeled at its 3' end.

[0040] The detection method of this invention features a simple and rapid reaction system, requires no specialized instruments, and the results can be visually interpreted, making it suitable for rapid on-site detection. The sensitivity of this method is significantly improved compared to existing species-specific PCR methods. Furthermore, this method targets a species-specific region of the mitochondrial COI gene in *Bark beetle*, exhibiting no cross-amplification in closely related species, thus demonstrating extremely high specificity. This invention provides a highly efficient and convenient detection method for port quarantine, epidemic area surveys, and grassroots forestry personnel, offering strong technical support for early warning and precise control of *Bark beetle*. Attached Figure Description

[0041] Figure 1 Gel electrophoresis bands obtained from RPA primer screening. A shows RPA primers screened by PCR amplification of target DNA, where NTC is a template-free negative control; B shows RPA primers screened by RPA amplification of target DNA.

[0042] Figure 2 The results are from screening crRNA using the RPA-CRISPR / Cas12a system; where A is the real-time fluorescence signal change curve from 0 to 60 min; B is the result of one-way ANOVA of the endpoint fluorescence signal; and C is the result of detection by the lateral flow test strip.

[0043] Figure 3 This section compares the fluorescence detection of the RPA-CRISPR / Cas12a system under different conditions. A shows the fluorescence detection of the RPA-CRISPR / Cas12a system at different temperatures; B shows the fluorescence detection of the RPA-CRISPR / Cas12a system at different PRA reaction times; C shows the fluorescence detection of the RPA-CRISPR / Cas12a system at different crRNA concentrations; and D shows the fluorescence detection of the RPA-CRISPR / Cas12a system at different Cas12a concentrations. NTC represents the template-free negative control, and ns indicates no significant difference.

[0044] Figure 4The results of specific detection of *Bartholinium longifolium* DNA using the RPA-CRISPR / Cas12a system are shown. A represents the real-time fluorescence signal change curve from 0 to 60 min; B represents the one-way ANOVA results of the endpoint fluorescence signal; C represents the detection results using lateral flow test strips; HL represents *Bartholinium longifolium*; TP represents *Bartholinium spp.*; TY represents *Bartholinium yunnanense*; TM represents *Bartholinium spp.*; TB represents *Bartholinium spp.*; DM represents *Bartholinium spruceum*; NTC represents the template-free negative control; and ns indicates no significant difference.

[0045] Figure 5 The results of sensitivity detection of *Bartholin's Root Beetle* DNA using the RPA-CRISPR / Cas12a system are shown in Figure A, where A represents the real-time fluorescence signal change curve from 0 to 60 min; B represents the one-way ANOVA results of the endpoint fluorescence signal; C represents the gel electrophoresis results of PCR amplification products after 10-fold dilution of genomic DNA, with one lane corresponding to a sample concentration of 100 ng / μL; NTC represents the template-free negative control.

[0046] Figure 6 The results of simulated field validation of *Bark Borer chinensis* DNA using the RPA-CRISPR / Cas12a system are shown. A represents the real-time fluorescence signal changes from 0 to 60 min for different geographical populations; B represents the real-time fluorescence signal changes from 0 to 60 min for samples at different developmental stages and from different collection years; C represents the fluorescence color development results of the reaction products after 30 min of incubation under different incubation conditions, excited by 365 nm blue light; NTC represents the template-free negative control. Detailed Implementation

[0047] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, specific experimental methods or conditions in the examples are conventional methods or methods or conditions described in the literature in this field, or according to the product instructions. Reagents and instruments used, unless otherwise specified, are all conventional products that can be purchased from legitimate channels.

[0048] Example 1. Construction of a specific detection system based on RPA-CRISPR / Cas12a

[0049] The experimental reagents and instruments used include:

[0050] FlaPure Animal Tissue DNA Extraction Kit (Beijing Jinsha Biotechnology Co., Ltd.), RPA Kit (Guangzhou Aidi Gene Technology Co., Ltd.), T7 High Yield In Vitro RNA Transcription Kit (Nanjing Novizan Biotechnology Co., Ltd.), EnGen® Lba Cas12a (Cpf1) (New England Biolabs); Axio Zoom V16 Stereo Zoom Microscope (Zeiss, Germany), NanoDrop Micro Spectrophotometer (Thermo Fisher Scientific Inc., USA), Real-Time PCR Instrument (Bio-Rad, USA), PCR Instrument (Bio-Rad, USA), CHB-100 Thermostatic Metal Bath.

[0051] 1. Obtaining Samples

[0052] Information on the *Bark Beetle* used as samples in this embodiment is shown in Table 1. Each collected sample was preserved in 95%–100% ethanol and stored at -20°C for later use. Eggs, larvae, pupae, and adults were observed and identified using an Axio Zoom V16 stereomicroscope.

[0053] Table 1. Sample Information

[0054]

[0055] 2. DNA extraction and PCR amplification

[0056] The head of *Bartholin's stolonifer* was removed using sterile forceps and placed in a 1.5 mL sterile centrifuge tube. Three 2 mm diameter stainless steel beads were added, and the tissue was homogenized in a low-temperature tissue homogenizer with the following parameters: runtime 600 s, runtime -20 °C, and runtime 50 Hz. Genomic DNA was extracted from each geographic population using the FlaPure Animal Tissue DNA Extraction Kit. DNA concentration and purity were assessed using a NanoDrop micro-spectrophotometer. PCR amplification was performed using the universal primers LCO1490 / HCO2198 for Scolytinae. The amplified products were sequenced by Beijing Ruiboxingke Biotechnology Co., Ltd., and the relevant sequences were obtained. The obtained sequences were assembled using Geneious Primes 2024 software and subjected to BLAST alignment to ensure a consistency of over 99%.

[0057] Sequences of all the above-mentioned *Bark Borer* and closely related species were constructed using a Neighbor-Joining (NJ) phylogenetic tree for comparison, and suitable target sequence fragments were selected. Specific primers RHPBB-F / RHPBB-R and crRNA were designed and synthesized by Beijing Ruiboxingke Biotechnology Co., Ltd. ssDNA fluorescent probes were purchased from Tulugang Biotechnology Co., Ltd.

[0058] Different primer combinations (F1 and R1 (F1R1), F1 and R2 (F1R2), F1 and R3 (F1R3), F2 and R1 (F2R1), F2 and R2 (F2R2), F2 and R3 (F2R3), F3 and R1 (F3R1), F3 and R2 (F3R2), F3 and R3 (F3R3)) were used to amplify the target DNA by PCR to screen for RPA primers. The results are as follows: Figure 1 As shown in A. Primer efficiency was quantified using ImageJ grayscale values ​​(Table 3), and F1R1, F1R3, F3R1, F3R2, and F3R3 were finally selected as candidate primer combinations for RPA amplification.

[0059] Table 2. RPA primer sequences, crRNA sequences, and ssDNA sequences

[0060]

[0061] 3. RPA amplification system and screening specific primers

[0062] The RPA amplification kit purchased from Guangzhou Aidi Gene Technology Co., Ltd. was used. The amplification system was as follows: 50 μL of sample; 29.4 μL of A buffer; 2 μL each of forward and reverse primers (10 μmol / L); 5 μL of DNA template; 9.1 μL of double-distilled water (ddH2O) was added to the dry powder reaction tube, and 2.5 μL of B buffer was added to the tube cap. After mixing well, the reaction tube was placed at 37°C for 30 minutes.

[0063] Gray-scale analysis of the bands from agarose gel electrophoresis was performed to compare amplification efficiencies. The results are shown in Table 3. Figure 1 As shown in Figure B, based on the amplification efficiency quantified by grayscale values, F1R1, F3R1, and F3R2 exhibit high amplification efficiencies. However, F1R1 and F3R2 show multiple bands, indicating that their specificity is lower than that of primer combinations with single bands. F3R1 shows a single, bright band; therefore, this primer combination (F3R1) demonstrates superior amplification efficiency and specificity compared to other primer combinations (F1R1, F1R3, F3R2, F3R3). Therefore, the F3R1 primer combination is the optimal primer combination.

[0064] Table 3. Comparison of primer combination amplification efficiency based on agarose gel electrophoresis (quantified by ImageJ gray value (RawIntDen)).

[0065]

[0066] 4. Establishment of CRISPR / Cas12a detection system

[0067] The CRISPR / Cas12a detection system consists of: a 20 μL CRISPR / Cas12a identification system containing 2.5 μL of RPA amplification product, 2 μL of 10×NEBuffer 2.1 (New EngLand BioLabs Inc., USA), 0.5 μL of ssDNA fluorescent probe (ssDNA-FQ reporter gene), 0.5 μL of EnGen Lba Cas12a (Cpf1) (New EngLand BioLabs Inc., USA), 0.5 μL of crRNA, and double-distilled water without RNase (to a final volume of 20 μL).

[0068] All fluorescence detection reactions were performed at 37°C for 60 minutes on the CFX Connect real-time PCR system (Bio-Rad, USA), with fluorescence signals recorded once per minute (FAM channel). The reaction products were observed with the naked eye under a 365 nm UV lamp or after treatment with a lateral flow test strip (Tulu Harbour Biotechnology Co., Ltd.).

[0069] 5. crRNA screening

[0070] Three crRNAs were added to the CRISPR / Cas12a system, and the cleavage efficiency of different crRNAs in the system was compared by fluorescence detection. The optimal crRNA sequence was selected, with water as a blank control. Each treatment was performed in triplicate.

[0071] The results are as follows Figure 2 As shown, the cleavage efficiency of crRNA-1 in the CRISPR / Cas12a system is significantly higher than that of crRNA-2 and crRNA-3 (P<0.001), therefore crRNA-1 is the optimal crRNA.

[0072] Example 2. Optimization of the RPA-CRISPR / Cas12a detection system

[0073] The RPA-CRISPR / Cas12a detection system was further optimized using the primer combination for F3R1 selected in Example 1 and crRNA-1.

[0074] 1. Optimization of temperature in the RPA-CRISPR / Cas12a detection system

[0075] To optimize the reaction temperature of the CRISPR / Cas12a system, four reaction temperatures (20°C, 30°C, 37°C, and 45°C) were set, with water as a blank control. Each treatment was performed in triplicate. The fluorescence detection method used was the same as described in Example 1. All fluorescence detection reactions were performed on a CFX Connect real-time PCR system (Bio-Rad, USA) at 37°C for 60 minutes, with fluorescence signals (FAM channel) recorded every minute. The reaction products were visible to the naked eye under a 365 nm UV lamp or after treatment with a lateral flow test strip. The optimal reaction temperature was determined by comparing the intensity of the endpoint fluorescence signal.

[0076] The results show that ( Figure 3 (A) Effective amplification was achieved under all temperature conditions, with significantly higher fluorescence signal intensities at 30℃, 37℃, and 45℃ compared to other groups (P < 0.001). Among these, 37℃ showed the highest fluorescence value and was closest to room temperature, thus 37℃ was determined to be the optimal reaction temperature for the CRISPR / Cas12a system.

[0077] 2. Optimization of RPA reaction time

[0078] To optimize the RPA reaction time, five RPA reaction time gradients of 5, 10, 15, 20, and 30 minutes were set, with water as a blank control. Each treatment was performed in triplicate. After the reaction, 50 μL of Tris-saturated phenol / chloroform / isoamyl alcohol (25:24:1) was added to the system to purify the amplified products. The purified products were immediately added to a CRISPR / Cas12a system for detection. The optimal RPA reaction time was determined by comparing the fluorescence signal intensity at each time point.

[0079] Experimental results ( Figure 3 B) indicates that there were significant differences between the 10, 15, 20, and 30-minute treatment groups and the blank control. Specifically, a significant enhancement of the fluorescence signal was observed at 10 minutes (P = 0.0301), while the signal tended to saturate after 20 minutes (P < 0.0001). Considering both reaction efficiency and reaction time, the optimal time for the RPA reaction was ultimately determined to be 20 minutes.

[0080] 3. Optimization of crRNA concentration

[0081] To optimize crRNA concentration, crRNA concentrations of 50, 25, 5, 2.5, 1, and 0.1 nM were set, with no crRNA serving as a blank control. Each treatment was performed in triplicate. The optimal and minimum detection concentrations of crRNA were determined based on the intensity of the endpoint fluorescence signal. Results ( Figure 3C) indicates that the minimum effective concentration of crRNA is 2.5 nM (P = 0.0427).

[0082] 4. Optimization of Cas12a protein concentration

[0083] To optimize the Cas12a concentration, Cas12a concentrations of 1000 (stock solution concentration), 500, 100, 50, and 10 nM were set, with a Cas12a-free protein control as a blank control. Each treatment was performed in triplicate. The optimal Cas12a protein concentration was determined based on the intensity of the endpoint fluorescence signal. Results ( Figure 3 D) indicates that the minimum effective concentration of Cas12a protein is 50 nM (P < 0.0001).

[0084] Therefore, the optimal reaction conditions for the RPA-CRISPR / Cas12a detection system were determined to be: reaction temperature of 37℃, reaction time of 20 min, crRNA concentration of ≥2.5 nM, and Cas12a protein concentration of ≥50 nM. This optimization scheme significantly improved the performance of the detection system.

[0085] Example 3. Validation of the specificity of the RPA-CRISPR / Cas12a detection system

[0086] DNA extracted from *Barkhorstroemia indica* was used as a positive control, while DNA from other closely related species (*Barkhorstroemia longitudinalis*, *Barkhorstroemia transverseis*, *Barkhorstroemia yunnanensis*, *Barkhorstroemia shorthair*, and *Barkhorstroemia spruceensis*) served as negative controls. Water was used as a blank control, and each treatment was performed in triplicate. The fluorescence detection method was the same as described in Example 1. All fluorescence detection reactions were performed on a CFXConnect real-time PCR system (Bio-Rad, USA) at 37°C for 60 minutes, with fluorescence signals recorded every minute (FAM channel). The reaction products were visible to the naked eye under a 365 nm UV lamp or after treatment with lateral flow test strips. The fluorescence intensity of the positive and negative controls was determined based on the endpoint fluorescence signal intensity, thereby determining the specificity of the RPA-CRISPR / Cas12a detection system.

[0087] Research results ( Figure 4 The results showed that only the DNA of *Bartholin's bark beetle* produced fluorescence, while the DNA bands of other closely related species did not show fluorescence signals and were negative. This indicates that the invented RPA-CRISPR / Cas12a detection system can specifically detect *Bartholin's bark beetle* DNA.

[0088] Example 4. Validation of the sensitivity of the RPA-CRISPR / Cas12a detection system

[0089] The genomic DNA template was serially diluted 10-fold, from 10...2 Dilute to 10 -3 PCR amplification was performed using ng / μL, and the amplification products were detected by agarose gel electrophoresis. The RPA amplification products were serially diluted 100-fold, starting from 10 ng / μL. 8 Add the diluent from 1 copy / μL to 1 copy / μL to the CRISPR / Cas12a system for reaction. Determine the minimum reaction concentration of the RPA-CRISPR / Cas12a detection system based on the endpoint fluorescence signal intensity.

[0090] Research results ( Figure 5 The results show that the lowest detection concentration of conventional PCR amplification detection methods can only reach 10 ng / μL, while the lowest detection concentration of the target DNA obtained by amplification using RPA primers can reach 1 copy / μL when added to the CRISPR / Cas12a system, indicating that the DNA detection system of *Barkhorstrom chinensis* of the present invention has extremely high sensitivity.

[0091] Example 5. Field validation of the RPA-CRISPR / Cas12a detection system

[0092] Using samples of *Bark Borer* collected from forests or intercepted at ports of entry from different countries and regions, the study simulated on-site detection scenarios at forest and customs checkpoints. Genomic DNA of *Bark Borer* was extracted from samples at different developmental stages (eggs, larvae, pupae, and adults) and from samples collected in different years (2021, 2022, 2023, and 2024) to simulate various life stages and historical specimens. The genomic DNA was amplified using RPA, and the RPA amplification products were then added to a CRISPR / Cas12a system for reaction. The fluorescence intensity of the RPA-CRISPR / Cas12a detection system under different genomic DNA conditions was determined based on the endpoint fluorescence signal intensity. The effectiveness of five incubation methods was compared based on the optimal RPA-CRISPR / Cas12a system, which included incubation using a PCR thermal cycler, a constant-temperature metal bath, and hand-held incubation (i.e., holding the insect tightly in the hand to heat it). After 30 minutes of incubation, the endpoint fluorescence signal was observed under 365nm ultraviolet light and recorded using a smartphone camera to compare the fluorescence intensity of the RPA-CRISPR / Cas12a detection system.

[0093] Figure 6 The results show that the RPA-CRISPR / Cas12a detection system of the present invention can stably output visualized fluorescence signals for samples from different collection sites, different developmental stages, and different collection years. Bright fluorescence signals are generated under all detection conditions, demonstrating good potential for field application.

[0094] The RPA-CRISPR / Cas12a detection system of this invention can produce bright fluorescence signals under different incubation methods. In particular, the detection effect of hand-held heating is no less than that of PCR thermal cycler and constant temperature metal bath incubation. This shows that even without any heating instrument, on-site detection can be performed by hand-held heating, which is suitable for rapid field detection scenarios.

[0095] The specific embodiments described above further illustrate the purpose, technical solution, and beneficial effects of the present invention. It should be understood that the above descriptions are merely specific embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

[0096] References

[0097] 1. Li, C., Wang, B., Ji, Y., Huang, L., Wang,

[0098] 2. Wang Jiaying, Duan Weijun, Cui Junxia, ​​Liu Li, Yan Shuyi. A composition specifically amplifying *Bark Borer chinensis* and a method for detecting or identifying *Bark Borer chinensis* using the same. CN 118621021 A.

[0099] 3. Ren Lili, Tao Jing, Wu Haiwei, Zong Shixiang, Wang Chuanzhen, Hua De, Shi Juan, Liu Yizhou, Luo Youqing. First discovery and infection characteristics of the major pest *Bark beetle* invading my country. *Scientia Forestica Sinica*, 2021, 57(05): 140-150.

Claims

1. A method for detecting Bark Borer DNA in a sample, the method comprising the following steps: (1) Obtain DNA from the sample; (2) Using a combination of recombinase polymerase amplification primers, the DNA is subjected to a recombinase polymerase amplification reaction to obtain a recombinase polymerase amplification product; wherein the combination of recombinase polymerase amplification primers includes a first primer and a second primer, the sequence of the first primer is SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3, and the sequence of the second primer is SEQ ID NO.4, SEQ ID NO.5 or SEQ ID NO.6; (3) In the presence of crRNA, the amplification product is reacted with Cas12a protein to generate a single-stranded DNA product; The sequence of the crRNA is SEQ ID NO.7, SEQ ID NO.8, or SEQ ID NO.9; (4) Detect the single-stranded DNA product.

2. The method of claim 1, wherein the sequence of the first primer is SEQ ID NO.3 and the sequence of the second primer is SEQ ID NO.

4.

3. The method of claim 1 or 2, wherein the sequence of the crRNA is SEQ ID NO.

7.

4. The method according to any one of claims 1-3, wherein, The reaction time of step (2) is 5-30 minutes, preferably 20 minutes; the reaction temperature of steps (2) and (3) is 20-45℃, preferably 37℃; the concentration of crRNA in step (3) is greater than or equal to 2.5 nM, and the concentration of Cas12a protein is greater than or equal to 50 nM.

5. The method of any one of claims 1-4, wherein the ssDNA fluorescent probe is added and a fluorescent signal is released during or after step (3).

6. The method of claims 1-5, wherein the fluorescence signal is detected in step (4) by means of: a) Observe the fluorescence signal with the naked eye under ultraviolet light, or b) Interpret the fluorescence signal using a lateral flow test strip.

7. A primer combination comprising a first primer and a second primer, wherein the sequence of the first primer is SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3, and the sequence of the second primer is SEQ ID NO.4, SEQ ID NO.5 or SEQ ID NO.6; Preferably, the sequence of the first primer is SEQ ID NO.3, and the sequence of the second primer is SEQ ID NO.

4.

8. A kit comprising the primer combination of claim 7; Preferably, the kit further comprises crRNA, the sequence of which is SEQ ID NO.7, SEQ ID NO.8 or SEQ ID NO.9; Preferably, the sequence of the crRNA is SEQ ID NO.

7.

9. The kit of claim 8, further comprising an ssDNA fluorescent probe, wherein the sequence of the ssDNA fluorescent probe is SEQ ID NO. 10; Preferably, the ssDNA fluorescent probe is labeled with a fluorescent reporter group FAM at its 5' end and a fluorescent quencher group BHQ-1 at its 3' end.

10. crRNA, wherein the sequence of the crRNA is SEQ ID NO.7, SEQ ID NO.8 or SEQ ID NO.9; Preferably, the sequence of the crRNA is SEQ ID NO.7.

Images