Application of bleomycin as immunopotentiator

Abstract

The invention belongs to the technical field of biological medicines, and particularly relates to application of bleomycin or bleomycin analogues in preparation of an immunopotentiator. The invention also provides a pharmaceutical composition and application of the pharmaceutical composition in preparation of drugs for treating and / or preventing cancers. The pharmaceutical composition comprises bleomycin, bleomycin analogues or a combination thereof and an anti-tumor immunotherapeutic agent.

Description

[0001] This application claims priority to Chinese Patent Application No. 202410658244.2, filed on May 24, 2024, entitled “Use of bleomycin as an immune enhancer”, the entire contents of which are incorporated herein by reference. Technical Field

[0002] This invention belongs to the field of biomedical technology, specifically relating to the use of bleomycin or bleomycin analogues in the preparation of immune enhancers. This invention also provides a pharmaceutical combination and its use in the preparation of medicaments for treating and / or preventing cancer, said pharmaceutical combination comprising bleomycin, bleomycin analogues, or combinations thereof, and an antitumor immunotherapeutic agent. Background Technology

[0003] Antigen presentation and T cell activation involving major histocompatibility complex class I (MHC-I) and class II (MHC-II) molecules play a key role in antitumor and anti-infective immune responses.

[0004] MHC class I molecules are widely distributed on the surface of almost all cells, and their main function is to present endogenous antigens, especially playing a major role in tumor antigen presentation. MHC class II molecules are mainly distributed on the surface of professional antigen-presenting cells such as B lymphocytes, macrophages, and dendritic cells, and their main function is to present exogenous antigens, such as viral or bacterial antigens. However, MHC class II molecules can also be expressed by cancer cells, and some tumor cells lacking MHC class I expression may retain MHC class II expression. For example, the expression of MHC class II molecules and components of tumor cell-associated pathways has been found in various human tumor cells, including melanoma and classical Hodgkin's lymphoma.

[0005] In the immune response, T cell receptors (TCRs) on CD4+ T cells and CD8+ T cells recognize antigenic peptides presented by MHC-II and MHC-I, respectively, thereby activating T cells into effector T cells. Direct cytotoxicity against target cells is generally considered to depend on the effector function of CD8+ T cells, while the effector function of CD4+ T cells is thought to be centered on cytokine production. However, these functions are plastic. Preclinical and clinical studies have identified cytotoxic CD4+ T cells with cytotoxic programs that can directly kill target cells. These cytotoxic CD4+ T cells not only express key molecules related to cytolytic granulation, such as granzyme (GZM) and perforin (PRF1), but also have direct cytotoxicity, which is the basis of pathogenic and protective immunity, including in cancer (see Oh DY and Fong L. Cytotoxic CD4+ T cells in cancer: Expanding the immune effector toolbox. Immunity. 2021 Dec 14; 54(12):2701-2711).

[0006] Human MHC molecules are commonly referred to as human leukocyte antigens (HLA). HLA molecules have now been shown to play a crucial role in viral and tumor immune evasion. For example, in various cancer types, including head and neck squamous cell carcinoma, breast cancer, colon cancer, ovarian cancer, melanoma, Hodgkin's lymphoma, non-small cell lung cancer, and bladder cancer, downregulation of MHC-I is associated with disease progression and poor prognosis. Furthermore, previous studies have shown that reduced MHC-I expression is closely related to resistance to immune checkpoint therapy (ICT). And the latest research indicates that tumor cells expressing both MHC-I and MHC-II restricted tumor neoantigens respond best to immune checkpoint therapy (ICT).

[0007] Immunotherapy has achieved significant clinical efficacy across various tumor types. However, despite these remarkable advances, response rates to immunotherapy vary considerably among different tumor types. Furthermore, tumor size is not consistently controlled long-term in all responding patients after immunotherapy. Therefore, the need to discover novel therapies and combination therapy strategies to improve the efficacy of cancer immunotherapy remains unmet. Malignant cells possess multiple mechanisms to evade immune surveillance, including inducing immune checkpoint expression, establishing an immunosuppressive microenvironment, low neoantigen load, reduced antigen presentation, and loss of HLA heterozygosity. Insufficient levels of major histocompatibility complex class I (MHC-I) molecules on the tumor cell surface are a major obstacle to the success of T-cell-mediated immunotherapy.

[0008] Therefore, there is a need for drugs that can enhance the immune response and effective strategies for using such drugs to treat cancer or infections. Summary of the Invention

[0009] In one aspect, the present invention provides a pharmaceutical combination comprising bleomycin, bleomycin analogues or combinations thereof, and an immunotherapeutic agent, said immunotherapeutic agent participating in MHC-I and / or MHC-II dependent immune responses.

[0010] In one embodiment, the bleomycin is selected from BLM A2, BLM B2, BLM A5, and combinations thereof. In a preferred embodiment, the bleomycin is a mixture of BLM A2 and BLM B2.

[0011] In one embodiment, the bleomycin analogue is selected from pelemycin, rizuram, liblomycin, zobamycin, buprofen, and combinations thereof.

[0012] In one embodiment, the immunotherapeutic agent targets an antigen peptide-MHC-I complex (pMHC-I) and / or an antigen peptide-MHC-II complex (pMHC-II), wherein the antigen peptide is selected from tumor antigen peptides, viral antigen peptides, bacterial antigen peptides, fungal antigen peptides, and parasitic antigen peptides. In one embodiment, the antigen peptide is a tumor antigen peptide.

[0013] In one embodiment, the immunotherapeutic agent is an antitumor immunotherapeutic agent.

[0014] In one embodiment, the antitumor immunotherapy agent targets an antigen peptide-MHC-I complex (pMHC-I) and / or an antigen peptide-MHC-II complex (pMHC-II), wherein the antigen peptide is a tumor antigen peptide.

[0015] In one embodiment, the tumor antigen peptide comprises an MHC-I restricted epitope selected from the following proteins: KRAS, MAGE1, gp100, hTERT, NY-ESO-1, hCGβ, Her2 / Neu, Melan-A / MART-1, TARP, p53, p68, MIF, Proteinase 3 (PR1), WT1, HA-1, PRAME, CEA, MAGE-A3, and MAGE-A4. In another embodiment, the tumor antigen peptide comprises an MHC-I restricted epitope selected from the following proteins: KRAS, gp100, and p53.

[0016] In one embodiment, the antitumor immunotherapy agent is selected from antibodies, antibody-drug conjugates, immune cells, and combinations thereof.

[0017] In one embodiment, the antitumor immunotherapy agent is selected from cytotoxic T lymphocytes (CTLs), tumor-infiltrating lymphocytes (TILs), T cell receptor-engineered T cells (TCR-T), and combinations thereof.

[0018] In one embodiment, the antitumor immunotherapy agent comprises a T-cell receptor (TCR)-like antibody.

[0019] In one embodiment, the antitumor immunotherapy agent is selected from: TCR-like antibodies, T cell connectors, immunotoxins, chimeric antigen receptor T cells (CAR-T), and combinations thereof.

[0020] In one embodiment, the T-cell conjugate is a T-cell conjugate bispecific antibody. In one embodiment, the T-cell conjugate bispecific antibody is selected from antibody H2-scDb, antibody V2-scDb, and tebentafusp.

[0021] In one embodiment, the immunotherapeutic agent is selected from immune checkpoint inhibitors, vaccines, and combinations thereof. In one embodiment, the immune checkpoint inhibitor is selected from: anti-PD-L1 antibodies, anti-PD-1 antibodies, anti-CTLA-4 antibodies, anti-TIM-3 antibodies, anti-LAG-3 antibodies, anti-TIGIT antibodies, and combinations thereof. In one embodiment, the immune checkpoint inhibitor is an anti-PD-L1 antibody or an anti-PD-1 antibody. In one embodiment, the vaccine is a tumor neoantigen-based vaccine.

[0022] In another aspect, the present invention provides a pharmaceutical composition comprising the pharmaceutical composition of the present invention and a pharmaceutically acceptable carrier.

[0023] The present invention also provides a kit comprising the pharmaceutical combination or pharmaceutical composition of the present invention.

[0024] In another aspect, the present invention also provides the use of the pharmaceutical combinations, pharmaceutical compositions or kits of the present invention in the preparation of medicaments for the treatment or prevention of cancer or infectious diseases.

[0025] In one embodiment, the cancer is a cancer in which cancer cells express low levels of MHC-I and / or MHC-II.

[0026] In one embodiment, the cancer is selected from head and neck squamous cell carcinoma, breast cancer, bone cancer, prostate cancer, lung cancer, adrenal cancer, bile duct cancer, bladder cancer, bronchial cancer, nerve tissue cancer, gallbladder cancer, gastric cancer, salivary gland cancer, esophageal cancer, small intestine cancer, cervical cancer, colon cancer, rectal cancer, liver cancer, ovarian cancer, pancreatic cancer, melanoma, pituitary adenoma, secretory adenoma, synovial sarcoma, multiple myeloma, Hodgkin lymphoma, non-Hodgkin lymphoma, acute lymphoblastic leukemia, acute myeloid leukemia, chronic myeloid leukemia, and chronic lymphocytic leukemia.

[0027] In one embodiment, the infectious disease is selected from viral infections, bacterial infections, fungal infections, and parasitic infections.

[0028] In another aspect, the present invention provides the use of bleomycin or its analogues in the preparation of immunostimulants that enhance MHC-I and / or MHC-II dependent immune responses.

[0029] In one embodiment, the bleomycin is selected from BLM A2, BLM B2, BLM A5, and combinations thereof. In a preferred embodiment, the bleomycin is a mixture of BLM A2 and BLM B2.

[0030] In one embodiment, the bleomycin analogue is selected from pelemycin, rizuram, liblomycin, zobamycin, buprofen, and combinations thereof.

[0031] In one embodiment, the immune enhancer enhances the antitumor effect of the antitumor immunotherapy agent, which participates in MHC-I and / or MHC-II dependent antitumor immune responses.

[0032] In one embodiment, the immune enhancer enhances the anti-infective immune response, wherein the infection is selected from viral infections, bacterial infections, fungal infections, and parasitic infections. Attached Figure Description

[0033] The embodiments of the present invention will be described in detail with reference to the accompanying drawings.

[0034] Figure 1 The expression levels of basal HLA-A in K562, DB, SK-BR-3, SU-DHL-4, T47D, and BT549 cells were determined by immunoblotting. GAPDH expression level was used as an internal control.

[0035] Figure 2AThe expression levels of HLA-A / B / C on the cell membrane surface of SU-DHL-4 cells, as detected by flow cytometry, were shown after 48 h of treatment with different concentrations of bleomycin. The figures show example histograms (top) and statistical graphs (bottom). **p<0.01, ***p<0.001. Con, control.

[0036] Figure 2B The expression levels of HLA-A / B / C on the cell membrane surface of SU-DHL-4 cells, as detected by flow cytometry, were observed after treatment with 10 μM bleomycin for different time periods. The figures show an example histogram (top) and a statistical graph (bottom). ***p<0.001. Con, control.

[0037] Figure 2C The image shows the HLA-A expression levels of SU-DHL-4 cells after treatment with different concentrations of bleomycin for 48 hours (top image) or after treatment with 10 μM bleomycin for different durations (bottom image), as detected by protein immunoblotting. GAPDH expression level was used as an internal control.

[0038] Figure 2D The mRNA expression levels of HLA-A, HLA-B, HLA-C, B2M, TAP1, TAP2, TAPBP, PSMB8, and PSMB9 in SU-DHL-4 cells after treatment with 10 μM bleomycin for 48 h are shown by RT-PCR. *p<0.05, **p<0.01, ***p<0.001.

[0039] Figure 3A The expression levels of HLA-A in K562 cells after treatment with different concentrations of bleomycin for 48 hours are shown by protein immunoblotting. GAPDH expression level was used as an internal control.

[0040] Figure 3B The expression levels of HLA-A / B / C on the cell membrane surface of K562 cells after treatment with different concentrations of bleomycin for 48 h are shown by flow cytometry. The figures show example histograms (top) and statistical graphs (bottom). ***p<0.001. Con, control.

[0041] Figure 4 The expression levels of HLA-DR / DP / DQ on the cell membrane surface of SU-DHL-4 cells, as detected by flow cytometry, were shown after 48 h of treatment with different concentrations of bleomycin. The figures show example histograms (top) and statistical graphs (bottom). ***p<0.001. Con, control.

[0042] Figure 5The results show the co-culture of B16F10 or B16OVA cells with OT-1 T cells after treatment with different concentrations of bleomycin. The figures show crystal violet staining (top) and apoptosis analyzed by flow cytometry (bottom).

[0043] Figure 6 The secretion of IFNγ by ELISA was shown after co-culturing B16F10 or B16OVA cells with OT-I T cells. ***p<0.001.

[0044] Figure 7 illustrates the role of bleomycin in a mouse adoptive cell therapy model. Figure 7A The experimental flowchart is shown. Figure 7B The changes in body weight of mice in different groups during the experiment are shown. Figure 7C The tumor weight of mice in different groups is shown at the end of the experiment. Figure 7D The changes in tumor volume in different groups of mice during the experiment are shown. *p<0.05, ***p<0.001 compared with the control group. ###p<0.001 compared with the corresponding group.

[0045] Figure 8 shows the expression levels of B2m in tumor tissues of different groups of mice as detected by protein immunoblotting. Figure 8A The protein immunoblot map is shown. Figure 8B Showing the Figure 8A Results of quantification of the protein bands. ***p<0.001.

[0046] Figure 9 The mRNA expression levels of Gzmb, Ifng, and Prf1 in mouse tumor tissues, as detected by RT-PCR, are shown. *p<0.05.

[0047] Figure 10 The expression levels of Granzyme B in tumor tissues from different groups of mice, as detected by immunofluorescence, are shown. DAPI staining reveals the cell nuclei.

[0048] Figure 11 Survival curves of mice in different treatment groups are shown.

[0049] Figure 12 This study demonstrates the role of bleomycin in promoting the infiltration of OT-IT T cells into tumor tissue in a mouse adoptive cell therapy model. The content of OT-IT cells in single-cell suspensions of mouse tumor tissue, analyzed by flow cytometry, is shown in mice treated with bleomycin (combination group) or untreated mice (OT-IT cell group) three days after receiving tail vein infusion of OT-IT T cells (D14).

[0050] Figure 13 shows SK-BR-3 cells pretreated with bleomycin or not pretreated with bleomycin and CD8+. + Results of T cell co-culture. Figure 13A The results of crystal violet staining are shown. Figure 13B The secretion of IFNγ as detected by ELISA is shown. Figure 13C Cell viability as measured by the CellTiter Glo Luminescent Cell Viability Assay Kit is shown. **p<0.01, ***p<0.001.

[0051] Figure 14 The changes in tumor volume in different treatment groups during the experiment are shown in the B16F10 mouse xenograft model. ***p<0.001 compared with the control group. ###p<0.001 compared with the corresponding group.

[0052] Figure 15 The tumor weight at the end of the experiment in the B16F10 mouse xenograft model is shown. **p<0.01, ***p<0.001 compared with the control group. #p<0.05, ###p<0.001 compared with the corresponding group.

[0053] Figure 16 The changes in body weight of mice in different treatment groups during the experiment are shown in the B16F10 mouse xenograft model.

[0054] Figure 17 The results show the HLA-A expression levels of primary bladder cancer cell lines after treatment with different concentrations of bleomycin for 48 hours, analyzed by protein immunoblotting. Con, control.

[0055] Figure 18 The cell viability of primary bladder cancer cell lines after treatment with different concentrations of bleomycin for 72 hours is shown by the CellTiter Glo Luminescent cell viability assay kit.

[0056] Figure 19 The results of TILs cells isolated and cultured from tumor samples of two bladder cancer patients, BCC101 and BCC102, are shown by multicolor flow cytometry analysis.

[0057] Figure 20 The results of cell viability assay using the CellTiter Glo Luminescent cell viability assay kit are shown for primary bladder cancer cells derived from BCC101 and BCC102 co-cultured with their corresponding autologous TILs cells for approximately 24 hours. *p<0.05, **p<0.01.

[0058] Figure 21 shows the results of apoptosis analysis by crystal violet staining or flow cytometry after co-culturing primary bladder cancer cells derived from BCC101 with autologous TILs cells for approximately 24 hours. Figure 21A The results of apoptosis analysis using crystal violet staining (top) or flow cytometry (bottom) are shown. Figure 21B Apoptosis rate as analyzed by flow cytometry is shown. ***p<0.001. Detailed Implementation

[0059] General definitions and terms

[0060] In this invention, unless otherwise stated, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Furthermore, the terms and laboratory procedures related to protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, and immunology used herein are all widely used terms and routine procedures in their respective fields. To better understand this invention, definitions and explanations of relevant terms are provided below.

[0061] As used herein, the expressions “comprising,” “including,” “containing,” and “having” are open-ended, meaning they include the listed elements, steps, or components but do not exclude other unlisted elements, steps, or components. The expression “composed of” excludes any unspecified elements, steps, or components. The expression “essentially composed of” means that the scope is limited to the specified elements, steps, or components, plus optional elements, steps, or components that do not significantly affect the essential and novel nature of the claimed subject matter. It should be understood that the expressions “essentially composed of” and “composed of” are encompassed within the meaning of the expression “comprising.”

[0062] As used herein, the terms “optional” or “optionally” indicate that the event described thereafter may or may not occur. This term covers situations in which the event may or may not occur.

[0063] As used herein, the connecting term “and / or” between multiple referred elements should be understood to include both individual and combined options.

[0064] Unless otherwise stated, any numerical value or range, such as concentration or concentration range, shall in any case be understood to be modified by the term “about”. Thus, numerical values ​​typically include ±10% of the stated value. For example, a concentration of 1 mg / mL includes 0.9 mg / mL to 1.1 mg / mL. Similarly, a concentration range of 1% to 10% (w / v) includes 0.9% (w / v) to 11% (w / v). As used herein, the use of numerical ranges explicitly includes all possible subranges, all individual numerical values ​​within that range, including integers and fractions within that range, unless the context clearly indicates otherwise.

[0065] As used herein, “antibody” refers to an immunoglobulin or a fragment thereof that specifically binds to an antigenic epitope through at least one antigen-binding site. In this document, the definition of antibody encompasses antigen-binding fragments. The term “antibody” includes multispecific antibodies (e.g., bispecific antibodies), human antibodies, non-human antibodies, humanized antibodies, chimeric antibodies, single-domain antibodies, and antigen-binding fragments. Antibodies can be synthetic (e.g., produced by chemical or biological conjugation), enzymatically derived, or recombinant. Antibodies include any type of immunoglobulin (e.g., IgG, IgM, IgD, IgE, IgA, and IgY), any class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2), or subclass (e.g., IgG2a and IgG2b). Antibodies can be “monovalent,” “bivalent,” “trivalent,” or “quadrivalent” or more, meaning they contain one, two, three, four, or more antigen-binding sites. Antibodies can be monoclonal or polyclonal, preferably monoclonal.

[0066] As used herein, an "antigen-binding fragment" refers to a portion of a full-length antibody that is less than the full-length but contains at least a portion of the variable region of the full-length antibody (e.g., containing one or more CDRs and / or one or more antigen-binding sites), and thus retains at least a portion of the full-length antibody's ability to specifically bind antigens. Examples of antigen-binding fragments include, but are not limited to, sdAb (e.g., variable domains of heavy chain antibodies), Fv, scFv, dsFv, scdsFv, scDb (single chain diabody), Fab, scFab, Fab', F(ab')2, biantibodies, Fd and Fd' fragments, and other fragments (e.g., fragments containing modifications).

[0067] As used herein, the term "antibody-drug conjugate" refers to a drug containing a cytotoxic drug conjugated with an antibody, which targets the cytotoxic drug to target cells expressing the antigen through the specific binding of the antibody to the antigen.

[0068] As used in this article, “enhancing” or “inducing” an immune response means increasing the size and / or efficiency of the immune response, or prolonging the duration of the immune response.

[0069] An "immune response" or "immune reaction" refers to any response of the vertebrate immune system to an immunogenic substance, such as a polypeptide, polynucleotide, or fragment. Exemplary immune responses include local and systemic cellular immunity as well as humoral immunity, such as cytotoxic T lymphocytes (CTLs) (including CD8+). + CTLs induce antigen-specific immune responses, helper T cell (including T cell proliferation and cytokine release) and B cell-mediated immune responses.

[0070] As used herein, the term "drug combination" refers to a combination of two or more active agents. It should be understood that these agents can be in mixed or integrated forms, such as compositions or mixtures, or in separate forms, such as in separate compartments of a kit or in different kits. For example, the agents in a drug combination can be formulated as a single drug composition for simultaneous administration. Alternatively, each agent can be formulated individually as a separate drug composition, which can be administered simultaneously, sequentially, or separately. The agents in a drug combination can be administered in a simultaneous, sequential, overlapping, alternating, or parallel dosing schedule, or in any other treatment schedule when the various agents are administered as part of a treatment regimen. Examples of active ingredients are bleomycin or its analogues, or one or more additional cancer therapeutic agents (e.g., the antitumor immunotherapeutic agents described herein).

[0071] As used herein, the term "pharmaceutical composition" refers to an active ingredient, optionally combined with one or more pharmaceutically acceptable components (e.g., but not limited to, a carrier). In addition to the active ingredient, a pharmaceutical composition may further comprise one or more pharmaceutically acceptable carriers. Those skilled in the art will understand that bleomycin or its analogues, along with one or more additional cancer therapeutic agents (e.g., the antitumor immunotherapy agents described herein), can be formulated in a single pharmaceutical composition for, for example, simultaneous administration. Alternatively, bleomycin or its analogues, along with one or more additional cancer therapeutic agents (e.g., the antitumor immunotherapy agents described herein), can be formulated in various pharmaceutical compositions for, for example, simultaneous, sequential, or separate administration. Those skilled in the art will also understand that a pharmaceutical composition may independently and optionally comprise one or more pharmaceutically acceptable carriers.

[0072] As used herein, the term "pharmaceutically acceptable carrier" means a carrier that is pharmacologically and / or physiologically compatible with the subject and the active ingredient, which is well known in the art (see, for example, Remington's Pharmaceutical Sciences, edited by Gennaro AR, 19th ed., Pennsylvania: Mack Publishing Company, 1995), and includes, but is not limited to: pH adjusters, surfactants, adjuvants, ionic strength enhancers, diluents, osmotic pressure maintainers, absorption delayers, and preservatives. For example, pH adjusters include, but are not limited to, phosphate buffers. Surfactants include, but are not limited to, cationic, anionic, or nonionic surfactants, such as Tween-80. Ionic strength enhancers include, but are not limited to, sodium chloride. Preservatives include, but are not limited to, various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, sorbic acid, etc. Osmotic pressure maintainers include, but are not limited to, sugars, sodium chloride, and the like. Absorption delayers include, but are not limited to, monostearates and gelatin. Diluents include, but are not limited to, water, aqueous buffer solutions (such as buffered saline), alcohols, and polyols (such as glycerol). Preservatives include, but are not limited to, various antibacterial and antifungal agents, such as thimerosal, 2-phenoxyethanol, parabens, chlorobutanol, phenol, and sorbic acid. Stabilizers have the meaning commonly understood by those skilled in the art, which stabilize the desired activity of the active ingredient in the drug, including, but not limited to, monosodium glutamate, gelatin, SPGA (Sucrose-Phosphate-Glutamate-Albumin), sugars (such as sorbitol, mannitol, starch, sucrose, lactose, dextran, or glucose), amino acids (such as glutamic acid and glycine), proteins (such as dried whey, albumin, or casein) or their degradation products (such as lactalbumin hydrolysate).

[0073] As used herein, the term "effective amount" refers to the amount of a drug or agent or combination thereof sufficient to achieve the desired effect. The effective amount can be determined individually and depends on the recipient's age and general condition, as well as the specific active substance. The effective amount in a particular situation can be determined by those skilled in the art through routine testing. When two or more agents are used in combination, for example, in the form of a claimed drug combination, the effective amount also refers to the effective amount by which each agent exerts a synergistic effect. For example, for the treatment of tumors, an "effective amount" of bleomycin or a drug combination containing it preferably inhibits tumor cell growth or tumor growth in a subject by at least about 10%, preferably at least about 20%, more preferably at least about 30%, more preferably at least about 40%, more preferably at least about 50%, more preferably at least about 60%, more preferably at least about 70%, and more preferably at least about 80%, relative to an untreated subject. The efficacy of inhibiting tumor growth can be assessed using conventional animal models of tumors in the art, such as spontaneous tumors, induced tumors, and transplanted tumor animal models. Alternatively, the ability to inhibit cell growth can also be examined using in vitro detection methods known in the art. Effective amounts of bleomycin or combinations of drugs containing it can reduce tumor size or otherwise alleviate symptoms in subjects (such as prevention and / or treatment of metastasis or recurrence). Effective amounts can be administered in single or multiple doses.

[0074] The terms "active ingredient" or "therapeutic agent" refer to a chemical entity that can be used to treat or prevent a target disease, condition, or disease status. Unless otherwise stated, pharmaceutical agents in a combination of drugs (e.g., antitumor immunotherapeutic agents) are commercially available or can be readily synthesized or obtained using conventional methods in the art.

[0075] As used herein, the definition of “subject” includes both human and non-human subjects, such as laboratory animals (e.g., mice, rabbits, rats and non-human primates), preferably humans.

[0076] As used in this article, "therapeutic effect" refers to the effect of altering the symptoms of a disease or condition resulting from treatment of the subject, usually the effect of improving or eliminating the symptoms of a disease or condition.

[0077] As used herein, a "therapeutic effective amount" means an amount of a drug, compound, or composition containing one or more active agents that, when administered to a subject, is at least sufficient to produce a therapeutic effect. Therefore, it is the amount necessary to prevent, cure, improve, stop, or partially stop the symptoms of a disease or condition.

[0078] Bleomycin and its analogues

[0079] In one aspect, the present invention provides the use of bleomycin or its analogues in the preparation of immunostimulants that enhance MHC-I and / or MHC-II dependent immune responses.

[0080] Unbound by any theoretical constraints, the inventors unexpectedly discovered that bleomycin or its analogues can increase the expression levels of MHC-I and MHC-II molecules on the surface of cells (e.g., tumor cells). According to one specific aspect of the invention, bleomycin or its analogues enhance CD4 expression. + T cells and / or CD8 + T cells specifically recognize antigens from target cells (such as tumor cells), thereby enhancing CD4. + T cell and / or CD8+ T cell-mediated immune responses.

[0081] In some embodiments, the immunostimulant enhances the antitumor immune response. Therefore, in one specific aspect, the present invention provides the use of bleomycin or its analogues in the preparation of antitumor immunostimulants. In some embodiments, bleomycin enhances immune cells (e.g., D8 cells) by increasing the expression levels of MHC-I and / or MHC-II molecules on the surface of tumor cells. + Bleomycin enhances the antitumor immune response mediated by T cells and tumor-infiltrating lymphocytes. In some embodiments, bleomycin enhances the antitumor effect of immune checkpoint inhibitors (e.g., anti-PD-L1 antibodies) by increasing the expression levels of MHC-I and / or MHC-II molecules on the surface of tumor cells.

[0082] In some embodiments, the immune enhancer strengthens the anti-infective immune response. Therefore, in another specific aspect, the present invention also provides the use of bleomycin or its analogues in the preparation of anti-infective immune enhancers. In some embodiments, bleomycin enhances MHC-I and / or MHC-II-dependent anti-infective immune responses by increasing the expression levels of MHC-I and / or MHC-II molecules on the cell surface of pathogen-infected cells. In one embodiment, the infection is selected from viral infections, bacterial infections, fungal infections, and parasitic infections.

[0083] As used in this article, bleomycin (BLM) is a glycopeptide produced by Streptomyces verticillus and belongs to the bleomycin antibiotic family. BLM induces sequence-specific double-stranded DNA cleavage through a metal-dependent mechanism. BLM contains four functional domains: (1) a metal-binding domain containing pyrimidoblamic acid and β-hydroxyhistidine; (2) a DNA-binding domain consisting of a C-terminal amine tail formed by the interaction of a dithiazole moiety and a pyrimidinium ring; (3) a linker region connecting the metal-binding domain and the DNA-binding domain; and (4) a disaccharide moiety responsible for cell selectivity and DNA cleavage activity (Chen, J. and Stubbe, J., Nat Rev Cancer 5, 102–112 (2005); and Coughlin JM et al., Biochemistry. 2014 Nov 11; 53(44):6901-9). As used herein, the definition of “bleomycin” encompasses the addition salts of bleomycin with acids, such as its hydrochloride and sulfate salts. Examples of bleomycin include, but are not limited to, BLM A2 (CAS: 11056-06-7), BLM B2 (CAS: 9060-10-0), BLM A5 (CAS: 11116-32-8), and mixtures thereof.

[0084] In one embodiment, bleomycin is selected from BLM A2, BLM B2, BLM A5 (pingyangmycin), and combinations thereof. In a preferred embodiment, bleomycin is a mixture of BLM A2 and BLM B2 (e.g., bleomycin sulfate). In another preferred embodiment, bleomycin is BLM A5 (e.g., pingyangmycin hydrochloride).

[0085] The bleomycin antibiotic family also includes bleomycin analogues such as peplomycin (CAS: 68247-85-8), tallysomycin (CAS: 65057-90-1), liblomycin (CAS: 88266-67-5), zobamycin (ZBM; CAS: 11056-20-5), and phleomycin (CAS: 11006-33-0). Similar to bleomycin, bleomycin analogues are glycopeptide antibiotics that induce DNA damage and possess antitumor activity through a metal-dependent mechanism. As used herein, the definition of "bleomycin analogue" includes addition salts of bleomycin analogues with acids, such as their hydrochloride and sulfate salts. In one embodiment, the bleomycin analogue is selected from peplomycin (e.g., peplomycin sulfate), tallysomycin, liblomycin, zobamycin, phleomycin, and combinations thereof.

[0086] Drug combinations and kits

[0087] In another aspect, the present invention provides a pharmaceutical combination comprising bleomycin, bleomycin analogues, or combinations thereof, and an immunotherapeutic agent (particularly an antitumor immunotherapeutic agent). The pharmaceutical combination of the present invention may be in the form of a pharmaceutical composition or a kit.

[0088] As used herein, the term "immunotherapy agent" refers to a therapeutic agent that treats diseases (such as cancer and infections) by inducing or enhancing an immune response. Diseases that can be treated with immunotherapy agents include, but are not limited to, cancer, viral infections, bacterial infections, fungal infections, and parasitic infections.

[0089] As used herein, the term "antitumor immunotherapy agent" refers to a therapeutic agent that treats cancer by inducing or enhancing an immune response. In some embodiments, immunotherapy agents (e.g., antitumor immunotherapy agents) may increase the expression and / or activity of immune activators. In some embodiments, immunotherapy agents (e.g., antitumor immunotherapy agents) may decrease the expression and / or activity of immunosuppressants. In some embodiments, immunotherapy agents (e.g., antitumor immunotherapy agents) may recruit and / or enhance the activity of immune cells.

[0090] According to some aspects of the present invention, bleomycin can enhance the antitumor or anti-infective effects of immunotherapeutic agents by increasing the expression of MHC-I and / or MHC-II molecules on the surface of target cells (e.g., tumor cells or pathogen-infected cells). In one embodiment, the immunotherapeutic agent (e.g., an antitumor immunotherapeutic agent) participates in an MHC-I and / or MHC-II-dependent immune response (e.g., an antitumor immune response). The immunotherapeutic agent (e.g., an antitumor therapeutic agent) can participate in the immune response (e.g., an antitumor immune response) directly (e.g., mediate) or indirectly (e.g., induce or enhance). In some embodiments, the immunotherapeutic agent (e.g., an antitumor therapeutic agent) mediates, induces, or enhances an MHC-I and / or MHC-II-dependent immune response (e.g., an antitumor immune response).

[0091] MHC-I-dependent immune responses (e.g., anti-tumor immune responses) can include, for example, but not limited to, those generated by CD8. + Cytotoxic T lymphocytes (CD8) + CTL, also known as cytotoxic CD8 + T cell-mediated immune responses (including, for example, CTL activation, clonal expansion, and enhanced CTL effector function) mediated by T cells (e.g., through the expression of antigen-specific T cell receptors (TCRs)), antibody-mediated effector functions (e.g., antibodies targeting the peptide-MHC-I complex (pMHC-I)) mediated by antibodies (e.g., antibody-dependent cell-mediated cytotoxicity (ADCC), complement-dependent cytotoxicity (CDC), and antibody-dependent phagocytosis (ADCP)) and cytotoxicity (e.g., through immunotoxins targeting pMHC-I).

[0092] MHC-II dependent immune responses (e.g., anti-tumor immune responses) can include, for example, but not limited to: those generated by CD4+. + Cytotoxic T lymphocytes (CD4) + CTL, also known as cytotoxic CD4 + T-cell (e.g., immune responses mediated by expressing antigen-specific T-cell receptors (TCRs)) include, for example, CTL activation, clonal expansion, and enhanced CTL effector function.

[0093] In one particular aspect, immunotherapeutic agents (e.g., antitumor immunotherapeutic agents), such as TCR-like antibodies and immunotoxins containing them, CTLs, TCR-engineered T cells (TCR-T), chimeric antigen receptor T cells (CAR-T), and tumor-infiltrating lymphocytes (TILs), can mediate immune responses (e.g., antitumor immune responses). In another particular aspect, immunotherapeutic agents (e.g., antitumor immunotherapeutic agents), such as immune checkpoint inhibitors and tumor neoantigen-based vaccines, can induce or enhance immune responses (e.g., antitumor immune responses), for example, by activating CD8.+ T cells kill target cells (e.g., tumor cells) by inducing apoptosis, for example, through perforin (Prf1) and granzyme B (Gzmb). Additionally, activated CD8... + T cells can also produce a variety of cytokines (including IFNγ and IL-2). IFNγ can further increase the expression of MHC class I molecules and increase CD8+ expression. + T cells recognize target cells.

[0094] As used herein, the terms “MHC-I” or “MHC-II” refer to any naturally occurring MHC-I (major histocompatibility complex-I) or MHC-II (major histocompatibility complex-II) from any vertebrate (including mammals, such as primates (e.g., humans) and rodents (e.g., mice and rats)). Human MHC-I is also known as human leukocyte antigen I (HLA-I). Human MHC-II is also known as human leukocyte antigen II (HLA-II).

[0095] The expression levels of MHC-I or HLA-I can be assessed by measuring the expression levels of any HLA-I gene or pseudogene (e.g., HLA-A, HLA-B, HLA-C, HLA-E, HLA-F, HLA-G, HLA-K, or HLA-L), or their haplotypes. The expression levels of MHC-I molecules can be assessed by detecting the expression levels of, for example, HLA heavy chains (e.g., HLA-A, HLA-B, and HLA-C) and B2M. Furthermore, TAP1, TAP2, TAPBP, PSMB8, and PSMB9 are all closely associated with MHC-I expression levels and their mediated antigen presentation. In some embodiments, bleomycin and one or more of its analogues may increase or at least increase the expression of MHC-I molecules (e.g., HLA-A, HLA-B, HLA-C, and / or B2M) and optionally the expression of TAP1, TAP2, TAPBP, PSMB8, and / or PSMB9 by about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 300%, 400%, 500%, 600%, 70%, 80%, 90%, 100%, 150%, 200%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, or 1000% in about 10%, 20%, 30%, 4 ... or 1000% in about 10%, 20%, 30%, 40%, 500%, 600%, 700%, 800%, 900%, or 1000% in about 10%, 20%, 300%, 400%, 500%, 600%, 700%, 800%, or 1000% in about 10%, 20%, 300%, 400%, 500%, 600%, 700%, 800%, or 1000% in about 10%, 20%, 300%, 400%, 500%, 600%, 700%, 800%, or 1

[0096] HLA class II genes include the HLA-D family, mainly HLA-DR, HLA-DP, and HLA-DQ. The expression levels of MHC-II or HLA-II can be assessed by detecting the expression levels of HLA-DR, HLA-DP, and HLA-DQ. In some embodiments, bleomycin and one or more of its analogues can increase or at least increase the surface expression of MHC-II molecules (e.g., HLA-DR, HLA-DP, and HLA-DQ) in about or at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% of tumor cells, relative to control cells or a control cell population, by about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, or 1000%.

[0097] Immunotherapy agents (e.g., antitumor immunotherapy agents) that can be used in the present invention can be, for example, antibodies, antibody-drug conjugates, and immune cells that participate in immune responses (e.g., antitumor immune responses) in an MHC-I-dependent or MHC-II-dependent manner.

[0098] In some embodiments, the immunotherapeutic agent targets an antigen peptide-MHC-I complex (pMHC-I) and / or an antigen peptide-MHC-II complex (pMHC-II), wherein the antigen peptide is selected from tumor antigen peptides, viral antigen peptides, bacterial antigen peptides, fungal antigen peptides, and parasitic antigen peptides.

[0099] In some embodiments, the antigenic peptide is a tumor antigenic peptide. In some embodiments, the tumor antigenic peptide comprises an MHC-I restricted epitope selected from the following proteins: KRAS, MAGE1, gp100, hTERT, NY-ESO-1, hCGβ, Her2 / Neu, Melan-A / MART-1, TARP, p53, p68, MIF, Proteinase 3 (PR1), WT1, HA-1, PRAME, CEA, MAGE-A3, and MAGE-A4. In some embodiments, the tumor antigenic peptide comprises an MHC-I restricted epitope selected from the following proteins: KRAS, gp100, and p53.

[0100] In some embodiments, the immunotherapeutic agent is an antitumor immunotherapeutic agent. In some embodiments, the antitumor immunotherapeutic agent targets (e.g., through specific binding between an antibody (or TCR) and an antigen) an antigen peptide-MHC-I complex (pMHC-I) on the surface of tumor cells, said antigen peptide-MHC-I complex containing an MHC-I-restricted epitope from a tumor-specific antigen. As used herein, an "MHC-I-restricted epitope" refers to a peptide sequence recognized by a CTL in conjunction with MHC-I. MHC-I-restricted epitopes from tumor-specific antigens include, but are not limited to, those listed in Tables 1 and 2. In one embodiment, the MHC-I restricted epitope in the tumor-specific antigen is selected from the MHC-I restricted antigenic epitopes of the following proteins: KRAS, MAGE1, gp100, hTERT, NY-ESO-1, hCGβ, Her2 / Neu, Melan-A / MART-1, TARP, p53, p68, MIF, Proteinase3 (PR1), WT1, HA-1, PRAME, CEA, MAGE-A3, and MAGE-A4.

[0101] In some embodiments, the antitumor immunotherapy agent targets an antigen peptide-MHC-II complex (pMHC-II) on the surface of tumor cells, said antigen peptide-MHC-II complex containing an MHC-II-restricted epitope from a tumor-specific antigen. As used herein, "MHC-II-restricted epitope" refers to a peptide sequence recognized by CTLs in conjunction with MHC-II.

[0102] In some embodiments, the antitumor immunotherapy agent is selected from antibodies, antibody-drug conjugates, immune cells, and combinations thereof. In some embodiments, the antitumor immunotherapy agent may be or comprises immune cells, for example, immune cells that are or comprise T cell receptors. In some embodiments, the antitumor immunotherapy agent is selected from cytotoxic T lymphocytes (CTLs), tumor-infiltrating lymphocytes (TILs), T cell receptor-engineered T cells (TCR-T), and combinations thereof. Antitumor immunotherapy agents that can be used in the pharmaceutical combinations of the present invention may include those based on tumor-specific antigens (particularly tumor neoantigens) (see, for example, Xie, N., Shen, G., Gao, W. et al. Sig Transduct Target Ther 8, 9 (2023)). The term "tumor neoantigen" is a neoantigen present in tumor cells or tissues but not in the corresponding normal cells or tissues. Methods for identifying neoantigens are well known in the art, see, for example, CN108601731A. For descriptions of tumor neoantigens, see, for example, CN115968299A (multiple myeloma), CN113573729A (prostate cancer) and CN115515623A (ovarian cancer), which are cited in their entirety in this article.

[0103] To generate the desired antitumor immune response, antitumor immunotherapeutic agents may advantageously comprise tumor antigen-specific TCRs or TCR-like antibodies. The term "tumor antigen specificity" as used with respect to TCRs, TCR-like antibodies, or antitumor immunotherapeutic agents containing them (e.g., tumor antigen-specific antibody-drug conjugates and immune cells) refers to the specific recognition ("targeting") by the TCR or TCR-like antibody of ("targeting") an antigen peptide-MHC-I complex or an antigen peptide-MHC-II complex on the surface of tumor cells, wherein the antigen peptide-MHC-I complex contains an MHC-I-restricted epitope of a tumor-specific antigen (particularly a tumor neoantigen), and the antigen peptide-MHC-II complex contains an MHC-II-restricted epitope of a tumor-specific antigen (particularly a tumor neoantigen). In one embodiment, the antitumor immunotherapeutic agent comprises a T-cell receptor (TCR) or a TCR-like antibody.

[0104] In some implementations, immunotherapeutic agents (e.g., antitumor immunotherapeutic agents) comprise T-cell receptors (TCRs). As used herein, the term “T-cell receptor” or “TCR” refers to a membrane protein complex that participates in T-cell activation in response to antigen presentation. TCRs are responsible for recognizing antigens that bind to major histocompatibility complex molecules. TCRs consist of heterodimers of α and β chains, although in some cells they consist of γ and δ chains. Each chain consists of two extracellular domains: a variable domain (antigen-binding) and a constant domain. In this document, the term “T-cell receptor” or “TCR” encompasses both full-length natural TCR peptides and artificially constructed TCRs. Examples of immunotherapeutic agents comprising TCRs (e.g., antitumor immunotherapeutic agents) may include natural or artificially engineered immune cells, such as cytotoxic T lymphocytes (CTLs) and T-cell receptor-engineered T cells (TCR-T). In one specific embodiment, the antitumor immunotherapy agent is selected from cytotoxic T lymphocytes (CTLs), tumor-infiltrating lymphocytes (TILs), T cell receptor-engineered T cells (TCR-T), and combinations thereof. In some embodiments, the TCR targets a peptide-MHC-I complex on the surface of tumor cells, said peptide-MHC-I complex containing MHC-I-restricted epitopes from tumor-specific antigens (particularly tumor neoantigens). MHC-I-restricted epitopes that the TCR (or immune cells containing it) can target include, but are not limited to, those listed in Table 2.

[0105] In one embodiment, the antitumor immunotherapy agent comprises a TCR-like antibody. As used herein, the term "TCR-like antibody" or "TCR mimic antibody" generally refers to an antibody capable of recognizing peptide-MHC complexes (e.g., peptide-MHC-I complex, pMHC-I) on the surface of infected cells or tumor cells. As used herein, "TCR-like antibody" means including an antigen-binding fragment. TCR-like antibodies can be screened or generated by known methods, such as through phage libraries or hybridomas. Non-limiting embodiments of antitumor immunotherapy agents comprising TCR-like antibodies may include: TCR-like antibodies and fusion proteins comprising TCR-like antibodies, antibody-drug conjugates (e.g., immunotoxins), and immune cells. In some embodiments, the antitumor immunotherapy agent comprising TCR-like antibodies is selected from TCR-like antibodies, T-cell conjugates, immunotoxins, chimeric antigen receptor T cells, and combinations thereof. In one embodiment, the antitumor immunotherapy agent is a TCR-like antibody. In one embodiment, the antitumor immunotherapy agent is a T-cell conjugate comprising a TCR-like antibody. In one embodiment, the antitumor immunotherapy agent is an immunotoxin containing a TCR-like antibody. In another embodiment, the antitumor immunotherapy agent is a T cell expressing a chimeric antigen receptor containing a TCR-like antibody. In some embodiments, the TCR-like antibody targets a peptide-MHC-I complex on the surface of tumor cells, said peptide-MHC-I complex containing an MHC-I-restricting epitope from a tumor-specific antigen (particularly a tumor neoantigen). TCR-like antibodies (or antitumor immunotherapy agents containing them) can target pMHC-Is (e.g., tumor antigen peptide / HLA-A complexes) including, but not limited to, p53. R175H / HLA-A*02:01 complex (e.g., antibody H2, which can be combined with anti-CD3 antibody to obtain T cell conjugating bispecific antibody that can be used in this invention, such as H2-scDb in the form of a single-chain diabody), KRAS G12V / HLA-A*03:01 (e.g., antibody V2, which can be combined with anti-CD3 antibody to obtain a T-cell conjugating bispecific antibody that can be used in the present invention, such as V2-scDb in the form of a single-chain bispecific antibody), gp100 peptide-HLA-A*02:01 (e.g., tebentafusp, a T-cell conjugate that specifically recognizes gp100 peptide-HLA-A*02:01 and CD3 for the treatment of, for example, uveal melanoma). Examples of other tumor surface antigen peptide / HLA-A complexes can also be found in Table 1.

[0106] The TCR-like antibodies that can be used include, but are not limited to, those described in He Q et al, J Hematol Oncol. 2019 Sep 14; 12(1):99, which are incorporated herein by reference in their entirety. Examples of particularly preferred TCR-like antibodies or their targeted pMHC-Is can also be found in Table 1.

[0107] Table 1

[0108]

[0109]

[0110] Antitumor immunotherapeutic agents as described herein can be obtained by preparing T-cell conjugates (e.g., BiTEs) from TCR-like antibodies (e.g., antigen-binding fragments of TCR-like antibodies, such as scFv, scFab, Fab, and scDb), CARs, and antibody-drug conjugates (e.g., by fusing TCR-like antibodies with cytotoxins (e.g., immunotoxins) or antibody forms with effector functions such as ADCC / ADCP / CDC (e.g., by fusing with IgG1 Fc or IgG2 Fc). Therefore, non-limiting examples of particularly useful antitumor immunotherapeutic agents according to certain aspects of the invention include: TCR-like antibodies, T-cell conjugates containing TCR-like antibodies, immunotoxins containing TCR-like antibodies, and chimeric antigen receptor T cells (CAR-T).

[0111] As used herein, "immunotoxin" refers to an immunotherapeutic agent containing a targeting portion (e.g., an antigen-binding fragment, such as Fab) fused to a cytotoxic agent (particularly a toxic protein). Toxic proteins that can be used to prepare immunotoxins may include, for example, diphtheria toxin (DT), Pseudomonas aeruginosa exotoxin A (PE), ricin, and granzymes. Immunotoxins that can be used in pharmaceutical combinations of the present invention can be obtained, for example, by fusing a TCR-like antibody as described herein with a cytotoxic agent. Immunotoxins that can be used in the drug combinations of the present invention include, but are not limited to, immunotoxins targeting the following pMHC-Is: gp100 / HLA-A*0201 (for the treatment of, for example, melanoma, see, for example, Denkberg G, et al., J Immunol. 2003; 171(5):2197–207, and Klechevsky E, et al., Cancer Res. 2008; 68(15):6360–7), TARP / HLA-A*0201 (for the treatment of, for example, breast cancer and prostate cancer, see, for example, Klechevsky E, et al., Cancer Res. 2008; 68(15):6360–7), and Melan-A / MART-1 / HLA-A*0201 (for the treatment of, for example, melanoma, see, for example, Epel M, et al., Eur J Immunol. 2008; 38(6):1706–20).

[0112] As used herein, "T-cell binder (TCE)" refers to a polypeptide construct, often a bispecific antibody (also known as a "bispecific T-cell binder (BiTE)" or "T-cell binding bispecific antibody"), that simultaneously binds to tumor-associated antigens (TAAs) or neoantigen / HLA-A complexes on tumor cells and CD3 epitopes on T cells. This leads to T-cell activation and cytotoxic effects against tumor cells. In some embodiments, the T-cell binder comprises a TCR-like antibody. Examples of T-cell conjugates containing TCR-like antibodies include, but are not limited to, antibodies H2-scDb (see Hsiue EH et al., Targeting a neoantigen derived from a common TP53 mutation. Science. 2021 Mar 5; 371(6533):eabc8697), antibodies V2-scDb (see Douglass J et al., Bispecific antibodies targeting mutant RAS neoantigens. Sci Immunol. 2021 Mar 1; 6(57):eabd5515) and tebentafusp.

[0113] In one embodiment, the T-cell conjugate is a T-cell conjugate bispecific antibody. In a preferred embodiment, the T-cell conjugate bispecific antibody comprises a TCR mimic antibody (or "TCR-like antibody") targeting CD3 and the tumor cell surface neoantigen / HLA-A complex. In a preferred embodiment, the T-cell conjugate bispecific antibody is selected from antibody H2-scDb, antibody V2-scDb, and tebentafusp. In one embodiment, the T-cell conjugate bispecific antibody is tebentafusp. In one embodiment, the T-cell conjugate bispecific antibody is antibody H2-scDb. In one embodiment, the T-cell conjugate bispecific antibody is antibody V2-scDb.

[0114] In one embodiment, antibody H2-scDb contains a component that specifically binds to p53. R175H The first portion of the / HLA-A*02:01 complex and the second portion specifically binding to CD3, wherein the first portion comprises a first heavy chain variable region and a first light chain variable region, the first heavy chain variable region comprising the amino acid sequence of SEQ ID NO:1 and the first light chain variable region comprising the amino acid sequence of SEQ ID NO:2, the second portion comprises a second heavy chain variable region and a second light chain variable region, the second heavy chain variable region comprising the amino acid sequence of SEQ ID NO:3 and the second light chain variable region comprising the amino acid sequence of SEQ ID NO:4.

[0115] The immunotherapeutic agents (e.g., antitumor immunotherapeutic agents) in the drug combinations of the present invention can also be immune cells that participate in the immune response through MHC-I and / or MHC-II-mediated antigen presentation. Immune cells may be or contain CD8+. + T cells or CD4 +T cells. Such immune cells may include tumor antigen-specific CTLs and TILs (containing tumor antigen-specific CTLs) isolated from cancer patients. Tumor antigen-specific TCRs or TCR-like antibodies may also be introduced into suitable immune cells to obtain engineered immune cells, such as TCR-T and CAR-T. Immune cells that can be used in the drug combinations of the present invention can generally be used in adoptive cell transfer therapy (ACT). Adoptive cell therapy refers to the process of culturing and / or modifying immune cells (e.g., T cells) in vitro and then reinfusing them into a patient to eliminate tumor cells. Immune cells used in adoptive immunotherapy may be autologous or allogeneic. In a preferred embodiment, the antitumor immunotherapeutic agent is selected from cytotoxic T lymphocytes (CTLs), T cell receptor-engineered T cells (TCR-T), chimeric antigen receptor (CAR) T cells, and tumor-infiltrating lymphocytes (TILs).

[0116] As used herein, the term "T-cell receptor engineered T cell" or "TCR-T" refers to any T cell having a T-cell receptor that is heterologous to that of a T cell. Particularly useful TCR-Ts in this invention include engineered T cells that express TCRs that specifically recognize tumor antigens MART-1 (for the treatment of metastatic melanoma, see, for example, Rohaan MW et al., Immunooncol Technol. 2022 Jun 18; 15:100089), Epstein-Barr virus (EBV) latent membrane protein 2 (LMP2) (for the treatment of, for example, EBV-related cancers, see, for example, CN113166224A), and NY-ESO-1 (for the treatment of solid tumors, see, for example, Gnjatic S et al., Adv Cancer Res. 2006; 95:1-30). TCR-Ts can also target pMHC-I as shown in Table 2. Examples of TCR-T that can be used in this invention include, but are not limited to, those described in Ping Y et al., Protein Cell. 2018 Mar; 9(3):254-266, the entirety of which is incorporated herein by reference.

[0117] Table 2

[0118]

[0119]

[0120] The term "chimeric antigen receptor T cell" or "CAR-T cell" refers to lymphocytes expressing a chimeric antigen receptor. The term "chimeric antigen receptor" or "CAR" has its common meaning in the art, referring to an artificially constructed protein or polypeptide containing an antigen-binding domain (e.g., scFv) of an antibody linked to a T cell signaling domain. CARs can be characterized by the ability to specifically and reactively redirect T cells to selected targets using the antigen-binding properties of monoclonal antibodies. Typically, a CAR can contain an extracellular antigen-binding domain, a transmembrane domain, and an intracellular signaling domain. It has been reported in the art that TCR-like antibodies can be converted into CAR structures to mediate T cell-specific tumor cell lysis. Furthermore, when expressed in T cells, CARs advantageously do not dimerize with the α and β chains of the endogenous T cell receptor (TCR). The strategies for designing and manufacturing such CARs are well known in the art, see, for example, Bonini and Mondino, Eur. J. Immunol. 2015(19), Srivastava and Riddell, Trends Immunol. 2015(20), Jensen and Riddell, Curr. Opin. Immunol. 2015(21), and Gill and June, Immunol. Rev. 2015(22). CAR-T cells that can be used in the drug combinations of the present invention may include, for example, T cells expressing CARs that specifically recognize the following antigen / HLA-A complexes: PR1 / HLA-A2 (for the treatment of, for example, myeloid leukemia, see, for example, Ma Q et al., Cytotherapy. 2016 Aug; 18(8):985-994), MAGE1 / HLA-A*0101 (for the treatment of, for example, melanoma, see, for example, Willemsen RA, et al. Gene Ther. 2001; 8(21):1601–8, and Chames P, et al. J Immunol. 2002; 169(2):1110–8) and gp100 / HLA-A*0201 (for the treatment of, for example, melanoma, see, for example, Zhang G, et al. Sci Rep. 2014; 4:3571.).

[0121] "Tumor-infiltrating lymphocytes" or "TILs" exist in the stroma of tumor tissue and are generated by CD8. + T cells, CD4 + A heterogeneous cell population composed of T cells, B cells, NK cells, macrophages, and neutrophils, among which the direct killing effect on tumor cells is mainly mediated by CD8. +T-cell therapy is achieved through T cells. TILs therapy involves isolating TILs from the patient's own tumor tissue, stimulating and amplifying them in vitro, and then reinfusing the anti-tumor immune cells back into the patient. Methods for obtaining TILs are known in the art, such as preparing a single-cell suspension from the subject's tumor tissue. The desired TIL type can also be further purified from the cell suspension using methods known in the art, such as by selecting appropriate cell surface markers (via FACS or magnetic beads). Descriptions of such methods can be found, for example, in *The Handbook of Experimental Immunology*, Vol. 1-4 (DNWeir, editor) and *Flow Cytometry and Cell Sorting* (A. Radbruch, editor, Springer Verlag, 2000).

[0122] Unbound by any theory, it is believed that immune checkpoint signaling inhibits immune cells (such as CD8). +T-cell-mediated anti-tumor immune responses are a crucial mechanism leading to immune escape by tumor cells. Existing technologies have demonstrated the potential of immune checkpoint inhibitors in treating various types of tumors. According to certain aspects of the invention, bleomycin or its analogues can enhance the anti-tumor effects of immune checkpoint inhibitors by increasing the expression of MHC-I and / or MHC-II molecules on the surface of tumor cells. Immune checkpoint inhibitors are also believed to play an important role in anti-infective immune responses. Therefore, the immunotherapeutic agents (e.g., anti-tumor immunotherapeutic agents) in the pharmaceutical combinations of the present invention can also be immune checkpoint inhibitors. Non-limiting examples of immune checkpoint inhibitors may include antibodies that block the immunosuppressive activity of PD-L1, PD-1, CTLA-4, TIM-3, LAG-3, and TIGIT. In one embodiment, the immune checkpoint inhibitor is selected from: anti-PD-L1 antibodies, anti-PD-1 antibodies, anti-CTLA-4 antibodies, anti-TIM-3 antibodies, anti-LAG-3 antibodies, and anti-TIGIT antibodies. Methods for obtaining these antibodies are well known in the art. In one embodiment, the immune checkpoint inhibitor is an anti-PD-L1 antibody. Non-limiting examples of anti-PD-L1 antibodies include: Atezolizumab, Durvalumab, Avelumab, and BMS-936559. Further descriptions of anti-PD-L1 antibodies can be found in, for example, US US7943743B2, US9580507B2, WO2011066389, and WO2012145493. In another embodiment, the immune checkpoint inhibitor is an anti-PD-1 antibody. Non-limiting examples of anti-PD-1 antibodies include: Pembrolizumab, Nivolumab, Cemiplimab, Retifanlimab, Toripalimab, and Dostarlimab. In yet another embodiment, the immune checkpoint inhibitor is an anti-CTLA-4 antibody. Non-limiting examples of anti-CTLA-4 antibodies include: Ipilimumab, Tremelimuniab, AAGEN-1884, and ATOR-1015. In yet another embodiment, the immune checkpoint inhibitor is an anti-TIM-3 antibody. Non-limiting examples of anti-TIM-3 antibodies include TSR-022 and LY3321367. In another embodiment, the immune checkpoint inhibitor is an anti-LAG-3 antibody. Non-limiting examples of anti-LAG-3 antibodies include Relatlimab, Fianlimab, and Ieramilimab. Non-limiting examples of anti-TIGIT antibodies include BMS-986207, Tiragolumab, Ociperlimab, Vibostolimab, Domvanalimab, COM902 (CGEN-15137), and Etigilimab.

[0123] The immunotherapeutic agent in the pharmaceutical combination of the present invention can also be a vaccine. As used herein, the term "vaccine" refers to a substance capable of being processed in a subject into an antigenic peptide, such as an MHC-I or MHC-II presented antigenic peptide, to induce an immune response in the subject. For example, an antitumor immunotherapeutic agent can be a neoantigen-based cancer vaccine. Tumor neoantigens are present in cancer patients, but are confined to cancer cells. It is believed that administering a neoantigen-based vaccine to a cancer patient can activate the immune system to activate CD8. + and CD4 + T cells thereby destroy cancer cells. Personalized neoantigen vaccines can train the immune system to recognize and kill cancer cells that present neoantigens. However, the success of this process can depend on several factors, including the antigen presentation of MHC molecules. According to certain aspects of the invention, bleomycin or its analogues can promote the MHC-I and / or MHC-II restricted presentation of tumor neoantigens by enhancing the expression of MHC-I and / or MHC-II molecules on the surface of tumor cells. The terms “neoantigen-based cancer vaccine” or “neoantigen vaccine” are used interchangeably and refer to a vaccine construct based on one or more tumor neoantigens, such as multiple tumor neoantigens. Examples of neoantigen vaccines include, but are not limited to, those described in Biswas N et al., Front Immunol. 2023 Feb 9; 14:1105420, which are incorporated herein by reference in their entirety.

[0124] The present invention further provides a pharmaceutical composition comprising the pharmaceutical composition of the present invention and a pharmaceutically acceptable carrier. In one specific embodiment, the pharmaceutical composition of the present invention comprises bleomycin, a bleomycin analogue or a combination thereof, an antitumor immunotherapy agent, and a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutical composition of the present invention comprises a first pharmaceutical composition and a second pharmaceutical composition, wherein the first pharmaceutical composition comprises bleomycin, a bleomycin analogue or a combination thereof, and a pharmaceutically acceptable carrier, and the second pharmaceutical composition comprises an antitumor immunotherapy agent and a pharmaceutically acceptable carrier.

[0125] Pharmaceutically acceptable carriers may include, but are not limited to: diluents, binders and adhesives, lubricants, disintegrants, preservatives, mediators, dispersants, glidants, sweeteners, coatings, excipients, preservatives, antioxidants (such as ascorbic acid, cysteine ​​hydrochloride, sodium bisulfite, sodium metabisulfite, sodium sulfite, ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, α-tocopherol, citric acid, ethylenediaminetetraacetic acid (EDTA), sorbitol, etc. Suitable carriers include sugar alcohols, tartaric acid, phosphoric acid, solubilizers, gelling agents, softeners, solvents (e.g., water, alcohol, acetic acid, and syrup), buffers (e.g., phosphate buffers, histidine buffers, and acetate buffers), surfactants (e.g., nonionic surfactants such as polysorbate 80, polysorbate 20, poloxamer, or polyethylene glycol), antibacterial agents, antifungal agents, isotonic agents (e.g., trehalose, sucrose, mannitol, sorbitol, lactose, glucose), absorption delay agents, chelating agents, and emulsifiers. For compositions containing antibodies or antibody conjugates, suitable carriers may be selected from buffers (e.g., citrate buffers, acetate buffers, phosphate buffers, histidine buffers, histidine buffers), isotonic agents (e.g., trehalose, sucrose, mannitol, sorbitol, lactose, glucose), nonionic surfactants (e.g., polysorbate 80, polysorbate 20, poloxamer), or combinations thereof.

[0126] The pharmaceutical compositions provided herein can be in various dosage forms, including but not limited to solid, semi-solid, liquid, powder, or lyophilized forms. Preferably, the pharmaceutical compositions are suitable for intravenous, intramuscular, subcutaneous, parenteral, spinal, or epidermal administration (e.g., by injection or infusion). For compositions containing antibodies or antibody conjugates, preferred dosage forms are typically, for example, injections and lyophilized powders.

[0127] Bleomycin or the pharmaceutical compositions provided herein may be administered to a subject by any method known in the art, such as systemic or local administration. Routes of administration include, but are not limited to, parenteral (e.g., intravenous, intraperitoneal, intradermal, intramuscular, subcutaneous, or intracavitary), local (e.g., intratumoral), epidural, or mucosal (e.g., intranasal, oral, vaginal, rectal, sublingual, or local). Those skilled in the art will understand that the exact dosage will depend on various factors, such as the pharmacokinetic properties of the pharmaceutical composition, the duration of treatment, the excretion rate of a particular compound, the therapeutic purpose, the route of administration, and the subject's condition, such as the patient's age, health status, weight, sex, diet, medical history, and other factors known in the medical field. Administration may be by, for example, injection or infusion.

[0128] In another aspect, the present invention provides a kit containing the pharmaceutical combination or composition of the present invention. The kit may also contain a suitable container, such as an ampoule. The pharmaceutical combination of the present invention may be provided in different compartments of the kit or in different kits. In some embodiments, the kit also includes a means of administration. The kit may also contain a label indicating the intended use and / or method of use of the kit contents. The term "label" includes any written or recorded material provided on or with the kit or otherwise accompanied by the kit.

[0129] The present invention also provides the use of the pharmaceutical combinations, kits or pharmaceutical compositions of the present invention in the preparation of medicaments for treating and / or preventing cancer or infectious diseases.

[0130] The terms “cancer,” “tumor,” and “cancerous tumor” have the same meaning in this document and include, but are not limited to, solid tumors and hematologic malignancies. Exemplary solid tumors include, but are not limited to, squamous cell carcinoma of the head and neck, breast cancer, bone cancer, prostate cancer, lung cancer (e.g., non-small cell lung cancer), adrenal cancer (e.g., adrenocortical tumor), bile duct cancer, bladder cancer, bronchial cancer, cancer of nerve tissue (including neurons and gliomas), gallbladder cancer, gastric cancer, salivary gland cancer, esophageal cancer, small bowel cancer, cervical cancer, colon cancer, rectal cancer, liver cancer, ovarian cancer, pancreatic cancer, melanoma, pituitary adenoma, and secretory adenoma. Exemplary hematologic malignancies include, but are not limited to, lymphoma and leukemia. Exemplary lymphomas include, but are not limited to, multiple myeloma, Hodgkin lymphoma, and non-Hodgkin lymphoma (e.g., diffuse large cell lymphoma, HTLV-1-related T-cell lymphoma, peripheral T-cell lymphoma of the lymph nodes, extranodal peripheral T-cell lymphoma, central nervous system lymphoma, and AIDS-related lymphoma). Exemplary leukemias include, but are not limited to, acute and chronic types of lymphocytic and myeloid leukemia (e.g., acute lymphoblastic leukemia, acute myeloid leukemia, chronic myeloid leukemia, and chronic lymphocytic leukemia).

[0131] In view of the present invention, those skilled in the art can readily identify cancers that can be treated and / or prevented using the pharmaceutical combinations, kits, or pharmaceutical compositions of the present invention. In one embodiment, the cancer is a cancer in which cancer cells express low levels of MHC-I and / or MHC-II. In some embodiments, the cancer is a cancer in which cancer cells respond to treatment with bleomycin or an analogue thereof, thereby increasing the expression of MHC-I and / or MHC-II. In one embodiment, the cancer is a solid tumor. In one embodiment, the cancer is a hematologic malignancy. In one embodiment, the cancer is a solid tumor in which cancer cells express low levels of MHC-I and / or MHC-II. In one embodiment, the cancer is a hematologic malignancy in which cancer cells express low levels of MHC-I and / or MHC-II. Many cancer cells (e.g., head and neck squamous cell carcinoma cells, breast cancer cells, colon cancer cells, ovarian cancer cells, melanoma cells, Hodgkin lymphoma cells, non-small cell lung cancer cells, and bladder cancer cells) exhibit downregulated MHC-I cell surface expression. In some embodiments, low expression of MHC-I includes reduced expression levels of genes selected from the following: HLA-A, HLA-B, HLA-C, HLA-E, HLA-F, HLA-G, HLA-K, HLA-L, and B2M. In some embodiments, the cancer is a cancer in which cancer cells express low levels of MHC-I-related genes selected from the following: TAP1, TAP2, TAPBP, PSMB8, and PSMB9. In some embodiments, low expression of MHC-II includes reduced expression levels of genes selected from the following: HLA-DR, HLA-DP, and HLA-DQ.

[0132] In one embodiment, the cancer is selected from squamous cell carcinoma of the head and neck, breast cancer, bone cancer, prostate cancer, lung cancer (e.g., non-small cell lung cancer), adrenal cancer (e.g., adrenocortical tumor), bile duct cancer, bladder cancer, bronchial cancer, neurogenic cancer (including neurons and gliomas), gallbladder cancer, gastric cancer, salivary gland cancer, esophageal cancer, small intestine cancer, cervical cancer, colon cancer, rectal cancer, liver cancer, ovarian cancer, pancreatic cancer, melanoma, pituitary adenoma, secretory adenoma, synovial sarcoma, multiple myeloma, Hodgkin lymphoma, non-Hodgkin lymphoma, acute lymphoblastic leukemia, acute myeloid leukemia, chronic myeloid leukemia, and chronic lymphocytic leukemia. In a particularly preferred embodiment, the cancer is selected from squamous cell carcinoma of the head and neck, synovial sarcoma, breast cancer, colon cancer, rectal cancer, ovarian cancer, melanoma, Hodgkin lymphoma, non-small cell lung cancer, and bladder cancer.

[0133] "Infectious disease" refers to a disease caused by infection with a pathogen, including but not limited to viral infections, bacterial infections, fungal infections, and parasitic infections. In some implementations, the infectious disease is selected from viral infections, bacterial infections, fungal infections, and parasitic infections.

[0134] Methods to enhance immune response

[0135] In one aspect, the present invention provides a method for enhancing an immune response in a subject, comprising administering to the subject an effective amount of bleomycin, a bleomycin analogue, or a combination thereof.

[0136] In one specific aspect, the present invention provides a method for enhancing T cell-mediated immune responses in a subject, comprising administering to the subject an effective amount of bleomycin, a bleomycin analogue, or a combination thereof. In a preferred embodiment, the T cells are CD8 cells. + T cells.

[0137] In another aspect, the present invention provides a method for treating or preventing cancer, comprising administering an effective amount of the pharmaceutical combination or pharmaceutical composition of the present invention to a subject in need of such treatment.

[0138] In one specific aspect, the present invention provides a method for treating or preventing cancer, comprising administering to a subject in need an effective amount of bleomycin, a bleomycin analogue or a combination thereof, and an antitumor immunotherapy agent as described herein.

[0139] In one embodiment, the method includes administering an effective amount of bleomycin, a bleomycin analogue, or a combination thereof, followed by administering an effective amount of the antitumor immunotherapy agent. In one embodiment, the method includes simultaneously administering an effective amount of bleomycin, a bleomycin analogue, or a combination thereof, and the antitumor immunotherapy agent. In one embodiment, the method includes administering an effective amount of the antitumor immunotherapy agent, followed by administering an effective amount of bleomycin, a bleomycin analogue, or a combination thereof.

[0140] In some embodiments, an effective amount of bleomycin, bleomycin analogues, or combinations thereof does not cause pulmonary toxicity, such as pulmonary fibrosis. An effective amount of bleomycin, bleomycin analogues, or combinations thereof may be administered in a single or multiple dose. For example, an effective amount of bleomycin, bleomycin analogues, or combinations thereof may be administered once daily, twice daily, three times daily, or more times daily. In one embodiment, an effective amount of bleomycin comprises 15 mg bleomycin / kg body weight or less once daily, such as 15, 14.5, 14, 13.5, 13, 12.5, 12, 11.5, 11, 10.5, 10, 9.5, 9, 8.5, 8, 7.5, 7, 6.5, 6, 5.5, 5, 4.5, 4, 3.5, 3, 2.5, 2, 1.5, 1, or 0.5 mg bleomycin / kg body weight once daily. In a preferred embodiment, an effective amount of bleomycin comprises 1-5 mg bleomycin / kg body weight once daily. In one embodiment, an effective amount of bleomycin comprises 2-4 mg bleomycin / kg body weight once daily. In a specific embodiment, an effective amount of bleomycin comprises 3 mg bleomycin / kg body weight once daily.

[0141] Beneficial effects

[0142] According to some aspects of the present invention, bleomycin or its analogues can increase the expression levels of MHC-I and / or MHC-II on the cell surface. In one specific aspect, bleomycin promotes antitumor immune responses by increasing the expression levels of MHC-I and / or MHC-II on the surface of cancer cells. For example, bleomycin or its analogues can promote CD8+ T cell-mediated immune responses by antigen-dependent activation of CD8+ T cells through increasing the expression levels of MHC-I on the surface of cancer cells. For example, BLM enhances the antigen-specific immune response of CD8+ T cells (OT-I T cells) against tumor cells and increases the sensitivity of tumor cells derived from bladder cancer patients to autologous tumor-infiltrating lymphocytes (TILs)-mediated cytotoxicity. Low-dose bleomycin, when used in combination with immunotherapeutic agents (e.g., TCR-engineered T cells, T cell-conjugating bispecific antibody H2-scDb, tumor-infiltrating lymphocytes, and anti-PD-L1 antibodies), inhibits tumor growth by promoting the killing effect of cytotoxic T cells on tumor cells and increasing the infiltration of tumor lymphocytes, while avoiding potential side effects such as pulmonary toxicity, demonstrating excellent clinical therapeutic potential. In summary, the drug combination of the present invention can exhibit a synergistic antitumor effect and good safety profile.

[0143] Example

[0144] The technical solution of the present invention will be further described below through specific embodiments. It should be noted that these embodiments are merely exemplary and not intended to limit the scope of protection of the present invention. Unless otherwise specified, the materials and instruments used in the following embodiments are commercially available or prepared according to methods known in the art. Experimental methods in the following embodiments that do not specify specific conditions were performed according to conventional methods and conditions, or according to the product instructions.

[0145] Example 1: Materials and Methods

[0146] 1.1 Materials and Equipment

[0147] The following antibodies were used for protein immunoblotting: B2m (abcam:ab75853; 1:50000); GAPDH (Proteintech:60004, Cat No.60004-1-Ig; 1:50000); HLA-A (ABclonal:A11406; 1:10000); goat anti-rabbit secondary antibody (Jackson Immunology 111-035-003).

[0148] The following antibodies were used in flow cytometry: APC-Cy7 Mouse Anti-Human CD45 (2D1) (BD Pharmingen: 561863); FITC Mouse Anti-Human CD3 (HIT3a) (BD Pharmingen: 561802); BV605 Mouse Anti-Human CD4 (RPA-T4) (BD Pharmingen: 562658); Alexa Fluor 700 Mouse Anti-Human CD8 (RPA-T8) (BD Pharmingen: 561453); BV510 Mouse Anti-Human CD56 (NCAM16.2) (BD Pharmingen: 563041); PerCP-Cy5.5 Rat Anti-CD11b (M1 / 70) (BD Pharmingen: 561114); PE-Cy7 Mouse Anti-Human CD16 (3G8 ...63); FITC Mouse Anti-Human CD3 (HIT3 Pharmingen:557744); APC Mouse Anti-human PD-1 (Biolegend:621610); APC anti-human HLA-A / B / C (Biolegend:311410); APC anti-human HLA-DR / DP / DQ (Biolegend:361713).

[0149] Bleomycin (Taoshu Biotechnology: T6116) stock solution was dissolved in PBS at a stock concentration of 10 mmol / L.

[0150] Ovalbumin (OVA) peptide (MCE) storage solution was dissolved in ddH2O, with a storage concentration of 1 mg / mL.

[0151] 1.2 Methods

[0152] animal

[0153] Before the experiment, female C57BL / 6J mice (6-8 weeks old) (Shanghai Jiesijie Laboratory Animal Co., Ltd.) were placed in the animal room for three days to acclimatize. During the tumor experiment, the mice's body weight and tumor volume (tumor volume V = (a × b)) were monitored and recorded every other day. 2 () / 2, where a and b are the long and short diameters of the tumor, respectively).

[0154] cell

[0155] All cells were cultured in a 37°C, 5% CO2 sterile incubator (Thermo Scientific FormaSeries II Water Jacket).

[0156] SU-DHL-4 cells, B16F10 cells (purchased from the Cell Bank of the Chinese Academy of Sciences), and B16OVA cells (based on B16F10) were cultured in the following medium: 1640 medium (Gibco) supplemented with 10% fetal bovine serum (FBS) (Gibco), 100 U / mL penicillin, and 100 U / mL streptomycin (Gibco).

[0157] SK-BR-3 cells (purchased from the Cell Bank of the Chinese Academy of Sciences) were cultured in the following medium: DMEM (Gibco) supplemented with 20% FBS, 100 U / mL penicillin and 100 U / mL streptomycin.

[0158] OT-I T cells and CD8+ T cells were cultured in the following medium: 1640 medium supplemented with 10% medium, 100 U / mL penicillin and 100 U / mL streptomycin, 2 mM L-glutamine (Gibco), 10 mM HEPES (Gibco), non-essential amino acids (1×) (Gibco) and 50 μM β-mercaptoethanol (Sigma).

[0159] Tumor-infiltrating lymphocytes (TILs) were cultured in the following medium: 1640 medium supplemented with 10% inactivated AB serum (GemCell). TMHuman Serum AB: GeminiBio), 100 U / mL penicillin and 100 U / mL streptomycin, 2 mM L-glutamine, 10 mM HEPES (Gibco), non-essential amino acids (1×) (Gibco), 50 μM β-mercaptoethanol and 6000 IU / mL recombinant human IL-2 protein (Peprotech).

[0160] Purification of bispecific antibodies

[0161] The plasmid expressing the bispecific antibody H2-scDb was p8400_IL-2_H2-ScDb_6×HIS tag plasmid, which contained the IL-2 signal peptide sequence. The bispecific antibody H2-scDb sequence was linked to the signal peptide via an enzyme restriction site. The antibody sequence had a 6×HIS tag at its C-terminus for subsequent purification. The bispecific antibody encoding sequence was synthesized by Genscript Biotech Inc. In general, 1L 293-F cells were transfected with 1.2 mg of the plasmid via PEI. Three days after transfection, the cell supernatant was collected. The collected cell supernatant was first centrifuged at 12000 rpm at 4°C for 60 min. The centrifuged cell supernatant was then collected again and filtered through 0.45 μM filter paper. Subsequently, it was purified using Ni-NTA agarose.

[0162] Crystal violet staining

[0163] Cells were fixed with methanol at room temperature for 20 min. They were washed three times with ddH₂O. Crystal violet staining solution was added, and cells were stained at room temperature for 20 min. Cells were washed three times with ddH₂O, 2 min each time. The staining results were observed and photographed under a microscope (Olympus IX711).

[0164] Protein Immunoblotting

[0165] The specific method is as follows: Protein samples extracted with RIPA lysis buffer are subjected to SDS-polyacrylamide gel electrophoresis (SDS-PAGE) (electrophoresis apparatus: BioRad PowerPac HC), and then transferred to an NC membrane (Pall Corporation, catalog number: 66485) or a PVDF membrane (Millipore Immunobilon) (eBlot L1 protein transfer apparatus (GenScript Biotechnology Co., Ltd.)); after transfer, the membrane is placed in an appropriate amount of blocking buffer (1×PBST containing 5% BSA or skim milk powder) and blocked at room temperature for 1 hour; the primary antibody is diluted with blocking buffer and incubated at room temperature for 2-4 hours or overnight at 4°C; after incubation, the membrane is blocked with 1×PBST (1×PBS + 0.1%). Wash the membrane three times with Tween-20 for 5 minutes each time; then incubate with the second antibody dilution solution containing HRP at room temperature for 1 hour; wash the membrane three times with 1×PBST for 5 minutes each time; prepare the required chromogenic substrate (1:1) and place it in a chemiluminescence analyzer for imaging (integrated chemiluminescence imager and chemiluminescence solution (Shanghai Qinxiang Biotechnology Co., Ltd.)).

[0166] RNA extraction, reverse transcription, and real-time quantitative PCR (qPCR)

[0167] According to the manufacturer's instructions, total RNA was extracted from cells using the GeneJET RNA Purification Kit (Thermo Fisher Scientific (China) Co., Ltd.), and the extracted RNA was reverse transcribed into cDNA using the HiScript IIQ RT SuperMix for qPCR (+gDNA wiper) (Nanjing Novizan Biotechnology Co., Ltd., catalog number: R223). Then, according to the manufacturer's instructions, real-time quantitative PCR (using a Roche real-time PCR instrument) was performed using the obtained cDNA as a template with the target gene-specific primers (Shanghai Sangon Biotech Co., Ltd.).

[0168] The PCR primer sequences used in Example 2 are shown in the table below:

[0169]

[0170] The PCR primer sequences used in Example 4 are shown in the table below:

[0171] Gene forward primer (5'-3') Reverse primer (5'-3')

[0172] B2M TGGTGCTTGTCTCACTGACC TTCAGTATGTTCGGCTTCCC

[0173] Actb TTCTTTGCAGCTCCTTCGTT ATGGAGGGGAATACAGCCC

[0174] The relative amount of mRNA was calculated using the ΔΔCT method, with GAPDH or Actb as internal controls. The mRNA level of the control group (samples not treated with bleomycin) was set to 1. Each treatment group was compared with the control group to obtain the relative amount.

[0175] Enzyme-linked immunosorbent assay (ELISA)

[0176] According to the manufacturer's instructions, the secretion of IFN-γ was detected using the Mouse IFN-γ ELISA Set (BD Pharmingen). The specific method is as follows: Dilute the capture antibody with coating buffer (Na2CO3 / NaHCO3 solution, containing 0.3565g sodium bicarbonate and 0.0795g sodium carbonate per 50mL, pH 7.4) at a ratio of 1:250. Add 100μL of the dilution buffer to each well of a 96-well plate for coating. Discard the liquid in the plate and wash the plate 5 times with 1×PBS + 0.05% Tween-20 (washing buffer). Add 200μL of Assay Dilute (PBS + 10% FBS) and incubate at room temperature for 1 hour. Discard the liquid in the plate and wash the plate 5 times with 1×PBST. Add 100μL of sample to each well and incubate at room temperature for 2 hours. Discard the liquid in the plate and wash the plate 5 times with 1×PBST. Add 100μL of Working Detector (detection antibody 1:250 and SAV-HRP 1:250) to the Assay. Dilute), incubate at room temperature for 1 hour; discard the liquid in the plate, wash the plate 10 times with 1×PBST; add 100 μL of substrate solution (tetramethylbenzidine (TMB) and hydrogen peroxide) (EL-TMB colorimetric kit, purchased from Sangon Biotech (Shanghai) Co., Ltd., catalog number: C520026): 5 mL solution A + 250 μL solution B + 1 μL solution C), incubate at room temperature for 20 min; add 50 μL solution D (EL-TMB colorimetric kit) to terminate the reaction, and read the absorbance (OD450) at 450 nm using an EnSpire Multilabel Reader (PerkinElmer) microplate reader.

[0177] Cell viability assay

[0178] Cell viability was assessed using the CellTiter-Glo Luminescent Cell Viability Assay Kit (Promega) according to the manufacturer's instructions. The specific method is as follows: CellTiter-Glo buffer and CellTiter-Glo substrate lyophilized powder were removed from the refrigerator and allowed to equilibrate to room temperature. CellTiter-Glo buffer was then added to the CellTiter-Glo substrate lyophilized powder according to the instructions, and the mixture was shaken to ensure complete dissolution. After cell co-culture, the cells were allowed to equilibrate at room temperature for 30 minutes. The prepared CellTiter-Glo reagent was added to the wells at a ratio of 1:1 (CellTiter-Glo reagent: culture medium supernatant). The cells were shaken for two minutes to allow for complete lysis. After incubation at room temperature for ten minutes, the luminescence signal in the wells was detected using a microplate reader.

[0179] Flow cytometry

[0180] Apoptosis: Apoptosis was detected by flow cytometry using the Annexin V, 633Apoptosis Detection Kit (Dojindo) according to the manufacturer's instructions. The specific method was as follows: Culture medium supernatant was aspirated into a 15mL centrifuge tube. Tumor cells in a 12-well plate were digested with trypsin. After terminating the digestion with the culture medium supernatant previously placed in the 15mL tube, any remaining adherent cells were pipetted away, and all cells were transferred to a 15mL centrifuge tube. After centrifuging at 1000rpm for 5 minutes, the supernatant was discarded, and 1mL of flow cytometry washing buffer (PBS + 2% FBS) was added for gentle resuspending. The cells were then transferred to a 1.5mL ep cytometer tube. After centrifugation at 1000 rpm for 5 minutes, the supernatant was discarded. The cells were resuspended in 50 mL of flow cytometry washing buffer (PBS + 2% FBS), and a certain amount of anti-mouse CD45 fluorescent primary antibody was added according to the antibody instructions. The corresponding isotype control antibody was added to the control tube. The cells were incubated at 4°C in the dark for 30 minutes, and then resuspended in 1 mL of flow cytometry washing buffer (PBS + 2% FBS). After centrifugation at 1000 rpm for 5 minutes, the supernatant was discarded. 100 μL of Annexin binding buffer was added, and anti-Annexin V-FITC and propidium iodide (PI) were added according to the antibody instructions. The cells were incubated at room temperature in the dark for 10 minutes, and then 200 μL of Annexin binding buffer was added. The cells were then analyzed by flow cytometry within one hour.

[0181] HLA-A / B / C cell surface expression: Bleomycin-treated SU-DHL-4 tumor cells were collected in 1.5 mL ep tubes; the cells were centrifuged at 1000 rpm for 5 min, and the supernatant was discarded; 1 mL of flow cytometry washing buffer (PBS + 2% FBS) was added to resuspend the cells, and the cells were centrifuged at 1000 rpm for 5 min, and the supernatant was discarded; the cells were resuspended in 50 μL of flow cytometry washing buffer, and a certain amount of anti-human HLA-A / B / C fluorescent primary antibody (Biolegend) was added according to the antibody instructions, while the corresponding isotype control antibody was added to the control tube; the cells were incubated at 4℃ in the dark for 30 min, and 1 mL of flow cytometry washing buffer was added to resuspend the cells, and the cells were centrifuged at 1000 rpm for 5 min, and the supernatant was discarded; after washing, 200 μL of flow cytometry washing buffer was added to resuspend the cells, and the HLA-A / B / C expression on the surface of the tumor cells was detected by flow cytometry.

[0182] Analysis of immune cell infiltration in mouse tumor tissue: Minced mouse tumor tissue was incubated in 1.5 mL of 1640 solution containing 1 mg / mL collagenase and 10 μg / mL DNase at 37°C for 30-40 min with a shaker. Then, 5 mL of PBS containing 2% FBS was added for neutralization. The cells were filtered through a 200-mesh sieve and centrifuged. The supernatant was discarded, and 1 mL of erythrocyte lysis buffer was added. The cells were lysed at room temperature for 3 min, and then neutralized with 9 mL of PBS containing 2% FBS. The cells were then resuspended in 10 mL of PBS containing 2% FBS, centrifuged at 1000 rpm for 5 min, and the supernatant was discarded. The cells were resuspended in 100 μL of PBS containing 2% FBS, and a certain amount of anti-CD45.1 fluorescent primary antibody was added according to the antibody manufacturer's instructions. The corresponding isotype control antibody was added to the control tube. The cells were incubated at 4°C in the dark for 30 min, and then 1 mL of PBS containing 2% FBS was added. Resuspend the cells in PBS containing FBS, centrifuge at 1000 rpm for 5 min, and discard the supernatant. After washing, resuspend the cells in 250 μL of PBS containing 2% FBS, and then perform flow cytometry analysis.

[0183] Immunofluorescence staining

[0184] Paraffin sections were dewaxed by sequentially soaking and washing them in xylene, anhydrous ethanol, 85% ethanol, 75% ethanol, and ddH2O. The citrate antigen retrieval buffer was heated to boiling in a microwave oven, and the dewaxed sections were gently placed into the buffer, with intermittent heating to maintain the temperature between 95-98°C. After incubation for 10 minutes, the sections were allowed to cool naturally. The samples were blocked by incubating with 5% blank goat serum at 37°C for 30 minutes. The blocking solution was removed, and diluted primary antibody was added, followed by incubation at 4°C overnight. The samples were then warmed to room temperature for 15 minutes. Antibody removal was then performed. Wash the sample once with TBST buffer for 5 minutes; wash three times with TBS buffer for 5 minutes each time; add the diluted secondary antibody and incubate at room temperature in the dark for 1 hour; remove the working solution of the secondary antibody, wash once with TBST buffer for 5 minutes; wash three times with TBS buffer for 5 minutes each time; add DAPI working solution to the sample, incubate at room temperature in the dark for 10 minutes; remove the DAPI working solution, wash once with TBST buffer for 5 minutes; wash three times with TBS buffer for 5 minutes each time; add anti-fluorescence attenuation mounting medium, and observe and acquire images under a fluorescence microscope.

[0185] Separated human PBMC

[0186] Aseptically draw fresh peripheral blood into an ACD / EDTA / heparin anticoagulant tube; add an equal volume of PBS to the anticoagulant tube containing whole blood to dilute the blood, invert the tube several times to mix the blood and buffer; then add Ficoll Paque... Add Plus (GE Healthcare) to the bottom of a 50mL centrifuge tube. Adjust the Ficoll-Paque ratio according to the volume of the diluted blood sample, ensuring a Ficoll-Paque: diluted blood ratio of 3:4. Carefully separate the diluted blood sample onto the Ficoll-Paque solution. Centrifuge at 2400rpm for 20 minutes at room temperature, ensuring the rate of decrease is zero. Discard the top layer of plasma to ensure the mononuclear cell layer remains undisturbed at the interface. Transfer the white membrane layer to a new centrifuge tube, add approximately 3 times the volume of PBS, and pipette to thoroughly wash the cell pellet. Centrifuge at 2400rpm for 10 minutes at room temperature. Discard the supernatant, resuspend the pellet in PBS, and centrifuge at 1200rpm for 5 minutes at room temperature. If red blood cells are present, add 1mL of erythrocyte lysis buffer and repeatedly pipette, timing the lysis for 3-5 minutes. Add a large amount of PBS to stop the lysis, and centrifuge at 1000rpm for 5 minutes at room temperature. Discard the supernatant, resuspend the pellet in culture medium, and you will now have PBMC cells.

[0187] Irradiated human PBMC

[0188] The collected PBMCs were resuspended in culture medium and placed in 50 mL centrifuge tubes. The centrifuge tubes were transported to the Shanghai Institute of Radiation Protection for irradiation at a dose of 50 Gy. After irradiation, the PBMCs were counted. It is generally not recommended to freeze irradiated PBMCs; they should be immediately used for the next experiment.

[0189] Isolation of human CD8+ T cells

[0190] Use EasySep according to the manufacturer's instructions. TM The Human CD8+ T Cell Enrichment Kit (STEMCELL) was used to isolate CD8+ T cells from prepared PBMCs. The isolated CD8+ T cells were then cultured and expanded using CD8+ T cell culture medium.

[0191] Isolation and culture of tumor-infiltrating lymphocytes (TILs)

[0192] The method for isolating and culturing tumor cells (TILs) from surgical samples, puncture samples, or cystoscopy samples (solid samples of tumor tissue) is as follows: After transporting the tumor sample back to the laboratory in an icebox, the tissue is cut into small pieces using sterile scissors and forceps, and the small pieces are placed in 24 wells containing TIL culture medium; the expanded TILs are closely observed, ensuring that the medium is changed at least once a week; after 3-4 weeks of initial expansion, each well is numbered F1, F2, F3...F12, and a small amount of cells is taken from each well for multicolor flow cytometry detection; primary tumor cells are co-cultured with the TILs in each well, leaving only the TILs with cytotoxic effects; at this point, the TILs can be cryopreserved or directly proceeded to the next step of expansion culture; the rapid expansion culture medium for TILs contains 1×10⁻⁶ cells / well. 3 -1×10 4 The TILs were prepared with 100-300 times irradiated PBMC cells, 30 ng / mL anti-CD3 antibody, and 3000 IU / mL recombinant human IL2. Recombinant human IL2 was supplemented on days 5, 9, and 12. On day 7, the amplified TILs were changed. After about two weeks, the amplified TILs were collected for subsequent co-culture experiments.

[0193] TILs co-cultured with primary bladder cancer cells

[0194] The specific method is as follows: 1E5 primary bladder cancer tumor cells were seeded on a cell culture plate; after the cells adhered, the primary bladder cancer tumor cells were pretreated with a certain concentration of bleomycin for 48 hours; the expanded tumor-infiltrating lymphocytes with different numbers were collected, centrifuged to remove the supernatant, resuspended in culture medium, and then counted; the drug-containing culture medium was removed, the cells were washed once with PBS, and a certain ratio of tumor-infiltrating lymphocytes (TILs: tumor cells = 3:1) was added; after co-culturing for about 24-48 hours, tumor cell apoptosis was detected by flow cytometry or crystal violet staining.

[0195] Extraction and preactivation of OT-I T cells

[0196] OT-I T cells were extracted from the livers of 6-8 week old female OT-I mice (C57BL / 6-Tg(TcraTcrb)1100Mjb / J, 003831; see HogquistKA et al., Cell. 1994 Jan 14; 76(1):17-27). The specific method was as follows: Mouse spleen was ground into a single-cell suspension; centrifuged at 1000 rpm for 5 min, and the supernatant was discarded; 1 mL of ice-cold red blood cell lysis buffer was added, inverted and mixed, and lysed for 3 min; 9 mL of PBS was added, inverted and mixed, centrifuged at 1000 rpm for 5 min, and the supernatant was discarded; 10 mL of PBS was added again for resuspending, centrifuged at 1000 rpm for 5 min, and the supernatant was discarded; the cells were resuspended in OT-I T cell growth medium, and the cell density was adjusted to 5 × 10⁶ cells / mL. 6 Add OVA peptide solution to a final concentration of 100 ng / mL; after culturing for 48 hours, add 2-3 times the volume of OT-IT cell growth medium, and add recombinant mouse IL-2 protein (STEMCELL) to the medium to a final concentration of 10 ng / mL; after culturing for 48 hours, the OT-IT cells can be used for co-culture experiments (or further processed by Ficoll density gradient centrifugation to remove dead cells before reinfusion experiments).

[0197] Example 2: Bleomycin increases the expression levels of MHC-I and MHC-II on the surface of tumor cells.

[0198] To verify the ability of bleomycin to increase the expression level of MHC-I on the surface of tumor cells, the expression level of basal HLA-A in K562 (a type of human chronic myeloid leukemia cell), DB (diffuse large B-cell lymphoma cell), SK-BR-3 (a type of human breast cancer cell), SU-DHL-4 (a type of human lymphoma cell), T47D (a type of human breast ductal carcinoma cell), and BT549 (a type of human breast ductal carcinoma cell) cells was first detected. The results are shown in... Figure 1 .like Figure 1As shown, the expression level of basal HLA-A in SK-BR-3, DB, and K562 cells was basically undetectable, the expression level of basal HLA-A in SU-DHL-4 cells was relatively low, and the expression level of basal HLA-A in T47D and BT549 cells was relatively high.

[0199] SU-DHL-4 cells were treated with bleomycin, and the expression level of MHC-I molecules in tumor cells was detected by flow cytometry, protein immunoblotting, and qPCR. The results are shown in... Figure 2A-2D .

[0200] like Figure 2A and 2B As shown, after bleomycin treatment, flow cytometry analysis revealed increased MHC-I expression levels on the surface of SU-DHL-4 tumor cells, exhibiting both concentration- and time-dependent trends. Figure 2C As shown, bleomycin increased HLA-A protein levels in SU-DHL-4 tumor cells, exhibiting a concentration- and time-dependent trend. Figure 2D As shown, the transcriptional levels of MHC-I related genes (including: HLA-A; HLA-B; HLA-C; B2M; TAP1; TAP2; TAPBP; PSMB8; PSMB9) are increased.

[0201] Therefore, the possibility of bleomycin increasing MHC-I expression levels in K562 cells was further investigated, and the results are shown in... Figure 3A and 3B .like Figure 3A and 3B As shown, even in K562 cells with very low HLA-A expression levels, bleomycin can dose-dependently increase MHC-I expression levels.

[0202] Further investigation was conducted to determine whether bleomycin could increase the expression level of MHC-II on the surface of tumor cells. SU-DHL-4 cells were treated with different concentrations of bleomycin, and the expression levels of HLA-DR / DP / DQ in the tumor cells were detected by flow cytometry. The results are shown below. Figure 4 .like Figure 4 As shown, after bleomycin treatment, the expression level of MHC-II on the surface of SU-DHL-4 tumor cells increased, and this increase showed a dose-dependent trend.

[0203] The above results indicate that bleomycin can increase the expression levels of MHC-I and MHC-II on the surface of tumor cells.

[0204] Example 3: Bleomycin promotes the killing of tumor cells by antigen-specific T cells.

[0205] The clinical potential of bleomycin combined with antigen-specific T cells for tumor treatment was investigated in a co-culture experiment of mouse melanoma cells B16OVA and OT-I T cells. B16OVA cells were B16F10 cells expressing ovalbumin (OVA). OT-I transgenic mice expressed OVA-sensitive antigens on CD8+ T cells. 257-264 (SIINFEKL) peptide-specific T cell receptor (TCR). Therefore, OT-I T cells isolated from OT-I transgenic mice can antigen-specifically target and kill B16OVA cells.

[0206] B16F10 or B16OVA cells were treated with bleomycin and then co-cultured with OT-IT cells. Tumor cell apoptosis was detected by crystal violet staining and flow cytometry, and IFNγ secreted by OT-IT cells was detected by ELISA. The specific method is as follows: B16F10 or B16OVA cells in good growth condition were cultured at 3.5 × 10⁻⁶ cells / cells. 4 Cells were seeded per well in 12-well plates; then treated with 0 μM (PBS), 1.25 μM, or 2.5 μM bleomycin for 48 h; subsequently, the culture supernatant was discarded, cells were gently rinsed with PBS, and OT-IT cells were added at a ratio of 1:1 to 5:1. After co-culturing for approximately 24 h, the killing effect on tumor cells was observed under a microscope and photographed. A portion of the cells from the 12-well plates were treated as follows: the culture supernatant was transferred to a clean 15 mL centrifuge tube, and a small amount was transferred from the supernatant to a 1.5 mL ep tube for ELISA detection of IFNγ secretion; then, the tumor cells in the 12-well plates were digested with trypsin (Gibco), and digestion was terminated with the culture supernatant previously placed in the 15 mL tube. The remaining adherent cells in the plate were then pipetted, and all cells were transferred to 15 mL centrifuge tubes. Apoptosis was then detected by flow cytometry. Another portion of the cells in the 12-well plate was treated as follows: the culture supernatant was discarded, and the cells were gently washed with PBS until no OT-IT cells or apoptotic tumor cells remained in the culture plate. The remaining tumor cells were then detected by crystal violet staining. Results are shown in... Figure 5 and 6 .

[0207] like Figure 5As shown, B16F10 cells did not undergo apoptosis when co-cultured with OT-IT cells. B16F10 cells pretreated with bleomycin and then co-cultured with OT-IT cells also did not exhibit significant apoptosis. However, when B16OVA cells were co-cultured with OT-IT cells, B16OVA cells underwent more significant apoptosis, with an apoptosis rate of approximately 20%. After bleomycin pretreatment, B16OVA cells further underwent significant apoptosis when co-cultured with OT-IT cells, with apoptosis rates of approximately 35% and 55% in the 1.25 μM and 2.5 μM bleomycin pretreatment groups, respectively. These results indicate that bleomycin can promote the killing effect of antigen-specific T cells on tumor cells.

[0208] like Figure 6 As shown, when B16F10 cells were co-cultured with OT-IT cells, the OT-IT cells did not secrete IFNγ. After B16F10 cells were pretreated with bleomycin and then co-cultured with OT-IT cells, the OT-IT cells also did not secrete IFNγ. However, when B16OVA cells were co-cultured with OT-IT cells, the OT-IT cells secreted IFNγ. After B16OVA cells were pretreated with bleomycin and then co-cultured with OT-IT cells, the IFNγ secretion level of the OT-IT cells significantly increased. These results indicate that bleomycin can promote the activation of antigen-specific T cells by tumor cells.

[0209] Example 4: BLM enhances the anti-tumor response of T cells

[0210] The clinical potential of bleomycin combined with adoptive T-cell therapy for tumor treatment was evaluated in a B16OVA cell mouse melanoma model. The specific method was as follows: On day 0 (D0), mice were subcutaneously inoculated with B16OVA cells (1×10⁻⁶ cells). 6 (Suspension of 100 μL per mL, diluted in pre-chilled PBS); on day 8 (D8), mouse tumors grew to 50-100 mm. 3 Mice were randomly divided into groups of 8 mice each, based on tumor volume and body weight. Starting from day 8, bleomycin (3 mg / kg) was injected intraperitoneally into the bleomycin group and the combination group (bleomycin + OT-IT), every two days. On day 11 (D11), 2 × 10⁻⁶ cells were reinfused into the OT-IT cell group (OT-IT) and the combination group via tail vein injection. 6 Preactivated OT-IT cells (see also: 1 preactivated OT-IT cells) Figure 7A and table below).

[0211]

[0212] For mice used in the antitumor efficacy analysis, mice were sacrificed on day 18 (D18), tumor weight was measured, and changes in tumor volume and body weight were analyzed. The results are shown in... Figure 7B -D. For example... Figure 7B As shown, no significant decrease in body weight was observed in any group of mice during the treatment process. Figure 7C and 7D As shown, compared with the control group, the tumor volume and weight of mice in the OT-IT cell group were significantly reduced, while the tumor volume and weight of mice in the bleomycin group were slightly reduced but did not show statistical difference. Compared with the two single treatment groups, the tumor volume and weight of mice in the combination treatment group were significantly reduced. The results indicate that bleomycin enhances the anti-tumor response of T cells in vivo.

[0213] For mice used in protein immunoblotting, qPCR, and immunofluorescence staining, mice were sacrificed on day 18 (D18), tumor tissue was extracted, photographed, and then processed for analysis. The results are shown in Figures 8-10. As shown in Figure 8, compared with the untreated group (OT-I T cell group), the B2m content in tumor cells was significantly increased in the bleomycin-treated group (combination group), indicating a significant increase in MHC-I expression level in tumor cells. Figure 9 As shown, compared with the untreated group (OT-I T cell group), the expression levels of antitumor effector molecules GranzymeB (Gzmb), IFNγ (Ifng), and perforin (Prf1) were significantly increased in the bleomycin-treated group (combination therapy group). The results indicate that bleomycin can increase the expression of antitumor effector molecules in tumor tissue. Figure 10 As shown, compared with the mediator control, the Granzyme B level was higher in the OT-I T cell group and also increased in the bleomycin group. Most importantly, the expression level of Granzyme B in the tumors of the combination therapy group was significantly higher than that in the OT-I T cell group. These results indicate that bleomycin can increase the expression level of Granzyme B in tumor tissues, and that it synergistically promotes Granzyme B expression in tumor tissues with the reinfused OT-I T cells.

[0214] For mice used to record survival curves, a mouse is considered dead if any of the following conditions are met: (1) the mouse dies; or (2) the mouse's tumor exceeds 2000 mm. 3 (3) The mouse tumors showed severe ulceration; (4) The mice lost more than 10% of their body weight. Survival analysis was performed at the end of the experiment, and the results are shown in Figure 11 .like Figure 11As shown, the mice in the combination therapy group had a significantly longer survival time than the mice in the OT-IT cell group. The results indicate that bleomycin can enhance the therapeutic effect of OT-IT T cell reinfusion and prolong the survival time of mice.

[0215] For mice used in the analysis of immune cell infiltration, mice were sacrificed on day 14 (D14), and tumor tissue was processed and analyzed by flow cytometry for tumor-infiltrating immune cells. The results are shown in... Figure 12 .like Figure 12 As shown, the mice in the combination therapy group had significantly more immune cell infiltration than the mice in the OT-I T cell group. The results indicate that bleomycin can increase the infiltration of immune cells in tumor tissue.

[0216] Example 5: Antitumor efficacy of bleomycin in promoting T-cell junctions

[0217] The clinical potential of bleomycin combined with T-cell binding agents (BiTE) for tumor treatment was further explored. A study reported a bispecific antibody, H2-scDb, which targets CD3 on the surface of T cells at one end and p53 on the surface of tumor cell membranes at the other end. R175H The HLA-A*02:01 complex. The effect of H2-scDb is closely related to the expression level of HLA-A on the surface of tumor cells. Bleomycin can increase the expression level of MHC-I on the surface of tumor cell membranes; therefore, this study investigated whether bleomycin could promote the effect of H2-scDb on CD8. + Activation of T cells.

[0218] SK-BR-3 cells were treated with bleomycin and then co-cultured with CD8+ T cells in the presence of H2-scDb antibody. Tumor cell apoptosis was detected by crystal violet staining, and IFNγ secreted by CD8+ T cells was detected by ELISA. The specific method is as follows: SK-BR-3 cells were pretreated with 10 μM bleomycin, the bleomycin-containing culture medium was removed, and the cells were washed with PBS. A certain ratio (T cells:SK-BR-3 cells = 5:1) of CD8+ T cells was added, along with 0.3 nM of the bispecific antibody H2-scDb. After co-culturing for approximately 24 hours, tumor cell apoptosis was analyzed by crystal violet staining and the CellTiter Glo Luminescent cell viability assay kit. CD8+ T cell apoptosis was detected by ELISA using the Mouse IFN-γ ELISA Set (BD Pharmaceuticals). + The ability of T cells to secrete IFNγ. The results are shown in Figure 13A -C.

[0219] like Figure 13AAs shown in Figure C, due to the low expression level of MHC-I on the surface of SK-BR-3 cells, the presence of H2-scDb does not promote CD8 expression. + The killing effect of T cells on tumor cells is consistent with the results reported in the literature. In the absence of H2-scDb, SK-BR-3 cells pretreated with bleomycin showed increased activity against CD8+. + Significant apoptosis occurred after T cell co-culture. Figure 13A and 13C ), and CD8 + T cells secrete significantly increased IFNγ. Figure 13B In the presence of H2-scDb, SK-BR-3 cells pretreated with bleomycin interacted with CD8+. + T cell co-culture significantly increased apoptosis. Figure 13A and 13C ), and CD8 + T cells secrete significantly increased IFNγ. Figure 13B The results showed that bleomycin could promote the action of H2-scDb on CD8. + Activation of T cells.

[0220] Example 6: Combination of bleomycin and anti-PD-L1 antibody enhances the anti-tumor effect of anti-PD-L1 antibody.

[0221] The clinical potential of bleomycin combined with immune checkpoint inhibitor therapy for tumor treatment was evaluated in a B16F10 cell mouse melanoma model. The specific method was as follows: On day 0 (D0), mice were subcutaneously inoculated with well-developed B16F10 cells (2 × 10⁻⁶ cells). 5 (Suspension of 100 μL per mL, diluted in pre-chilled PBS); on day 7 (D7), mouse tumors grew to 50-100 mm. 3 Mice were randomly divided into groups of 8 mice each, based on tumor volume and body weight. Starting on day 7, mice in the bleomycin group and the combination group (bleomycin + Anti-PD-L1) received intraperitoneal injections of bleomycin (3 mg / kg) every two days. On days 7 and 12, mice in the anti-PD-L1 antibody group (Anti-PD-L1) and the combination group (bleomycin + Anti-PD-L1) received intraperitoneal injections of 200 μg of anti-PD-L1 antibody (Anti-mouse PD-L1 (B7-H1), purchased from Bio XCell, catalog number: BE0101) (see table below). On day 13 (D13), mice were sacrificed, and tumor weight was measured. Changes in tumor volume and body weight were analyzed. The results are shown in [Table data missing]. Figure 14-16 .

[0222]

[0223] like Figure 16 As shown, no significant decrease in body weight was observed in any group of mice during the treatment process. Figure 14 and 15 As shown, compared with the control group, the tumor volume and tumor weight of mice in both the anti-PD-L1 antibody group and the bleomycin group were reduced. Compared with the two single treatment groups, the tumor volume and tumor weight of mice in the combination treatment group were significantly reduced. The results indicate that bleomycin can enhance the anti-tumor effect of anti-PD-L1 antibody.

[0224] Example 7: Bleomycin enhances the killing effect of autologous tumor-infiltrating lymphocytes on primary bladder cancer cells by increasing MHC-I expression levels.

[0225] This study further explored the clinical potential of combining bleomycin with tumor-infiltrating lymphocyte (TILs) therapy for cancer treatment.

[0226] First, primary bladder cancer cell lines were successfully established from tumor tissue and urine samples from eight bladder cancer patients. Four of these cell lines were derived from the patients' urine samples (BCC3, BCC16, BCC38, and BCC49), and the other four were derived from the patients' tumor samples (BCC1, BCC15, BCC101, and BCC102).

[0227] Primary bladder cancer cell lines were treated with different concentrations of bleomycin, and the expression level of MCH-I molecules was analyzed by protein immunoblotting. The results are shown in... Figure 17 .like Figure 17 As shown, bleomycin treatment significantly increased the expression level of MHC-I in most primary bladder cancer cells. The results indicate that bleomycin can increase the expression level of MHC-I in primary bladder cancer cells.

[0228] Next, the toxic effects of bleomycin on primary bladder cancer cells were investigated. Primary bladder cancer cell lines were pretreated with different concentrations of bleomycin for 72 hours, and cell viability was assessed using the CellTiter-Glo Luminescent cell viability assay kit. The results are shown below. Figure 18 .like Figure 18 As shown, bleomycin exhibited IC50 (half-maximal inhibitory concentration) values ​​exceeding 50 μM against most primary bladder cancer cells (BCC3, BCC38, BCC49, BCC1, BCC101, and BCC102), with an IC50 of 10.44 μM against BCC16 and 24.91 μM against BCC15. These results indicate that bleomycin has low toxicity against primary bladder cancer cells.

[0229] Next, the ability of bleomycin to enhance the killing effect of autologous TILs on tumor cells was investigated in a co-culture experiment of tumor cells and TILs. Figure 17 It can be seen that the primary bladder cancer cell line derived from BCC101 showed a higher response to bleomycin treatment, while the primary bladder cancer cell line derived from BCC102 showed a lower response. Therefore, among the four tumor samples (BCC1, BCC15, BCC101, and BCC102), BCC101 and BCC102 were selected for the isolation and culture of tumor-infiltrating lymphocytes. The cultured tumor-infiltrating lymphocytes were analyzed by multicolor flow cytometry, and the results are shown below. Figure 19 . Figure 19 The results showed that tumor-infiltrating lymphocytes were successfully isolated and cultured from BCC101 and BCC102.

[0230] Primary bladder cancer cell lines derived from BCC101 and BCC102 were pretreated with bleomycin and then co-cultured with corresponding autologous thyroid ILs cells. Cell viability was then assessed using the CellTiter Glo Luminescent Cell Viability Assay Kit. The results are shown in the figure. Figure 20 .like Figure 20 As shown, bleomycin pretreatment significantly enhanced the killing effect of autologous tumor-infiltrating lymphocytes on primary bladder cancer cells derived from BCC101, while its promoting effect on the killing effect of BCC102 autologous tumor-infiltrating lymphocytes was not significant.

[0231] To further verify that bleomycin pretreatment significantly enhances the killing effect of autologous tumor-infiltrating lymphocytes (TILs) on primary bladder cancer cells (BCC101), apoptosis of tumor cells was analyzed by crystal violet staining and flow cytometry after co-culturing. As shown in Figure 21, primary bladder cancer cells derived from BCC101 were co-cultured with autologous TILs F1, F2, and F3, respectively. Significant apoptosis occurred in the primary bladder cancer cells, with an apoptosis rate of approximately 30%. When primary bladder cancer cells derived from BCC101 were pretreated with bleomycin and then co-cultured with autologous TILs F1, F2, and F3, apoptosis in the primary bladder cancer cells significantly increased, reaching an apoptosis rate of approximately 90%. These results indicate that bleomycin can enhance the killing effect of autologous tumor-infiltrating lymphocytes on primary bladder cancer cells.

[0232] sequence list

[0233]

[0234]

[0235]

Claims

1. A pharmaceutical combination comprising bleomycin, a bleomycin analogue, or a combination thereof, and an immunotherapeutic agent, said immunotherapeutic agent participating in an MHC-I and / or MHC-II dependent immune response.

2. The pharmaceutical combination of claim 1, wherein the bleomycin is selected from BLM A2, BLM B2, BLM A5 and combinations thereof; more preferably, the bleomycin is a mixture of BLM A2 and BLM B2.

3. The pharmaceutical combination of claim 1, wherein the bleomycin analogue is selected from pelemycin, rizuram, liblomycin, zobamycin, fosetyl-aluminum, and combinations thereof.

4. The pharmaceutical combination of any one of claims 1-3, wherein the immunotherapeutic agent targets the antigen peptide-MHC-I complex (pMHC-I) and / or the antigen peptide-MHC-II complex (pMHC-II), wherein the antigen peptide is selected from tumor antigen peptides, viral antigen peptides, bacterial antigen peptides, fungal antigen peptides and parasitic antigen peptides.

5. The pharmaceutical combination of claim 5, wherein the antigenic peptide is a tumor antigenic peptide; Preferably, the tumor antigen peptide comprises an MHC-I restricted epitope selected from the following proteins: KRAS, MAGE1, gp100, hTERT, NY-ESO-1, hCGβ, Her2 / Neu, Melan-A / MART-1, TARP, p53, p68, MIF, Proteinase3 (PR1), WT1, HA-1, PRAME, CEA, MAGE-A3, and MAGE-A4; More preferably, the tumor antigen peptide comprises an MHC-I restricted epitope selected from the following proteins: KRAS, gp100, and p53.

6. The pharmaceutical combination of any one of claims 1-5, wherein the immunotherapy agent is an antitumor immunotherapy agent; preferably, the antitumor immunotherapy agent is selected from antibodies, antibody-drug conjugates, immune cells, and combinations thereof.

7. The pharmaceutical combination of claim 6, wherein the antitumor immunotherapy agent is selected from cytotoxic T lymphocytes (CTLs), tumor-infiltrating lymphocytes (TILs), T cell receptor-engineered T cells (TCR-T), and combinations thereof.

8. The pharmaceutical combination of claim 6, wherein the antitumor immunotherapy agent comprises a T-cell receptor (TCR)-like antibody.

9. The pharmaceutical group of claim 8, wherein the antitumor immunotherapy agent is selected from: TCR-like antibodies, T cell connectors, immunotoxins, chimeric antigen receptor T cells (CAR-T), and combinations thereof.

10. The pharmaceutical combination of claim 9, wherein the T-cell conjugate is a T-cell conjugate bispecific antibody; preferably, the T-cell conjugate bispecific antibody is selected from antibody H2-scDb, antibody V2-scDb, and tebentafusp.

11. The pharmaceutical combination of any one of claims 1-3, wherein the immunotherapeutic agent is selected from immune checkpoint inhibitors, vaccines, and combinations thereof.

12. The pharmaceutical combination of claim 11, wherein the immune checkpoint inhibitor is selected from: anti-PD-L1 antibody, anti-PD-1 antibody, anti-CTLA-4 antibody, anti-TIM-3 antibody, anti-LAG-3 antibody, anti-TIGIT antibody, and combinations thereof; preferably, the immune checkpoint inhibitor is an anti-PD-L1 antibody or an anti-PD-1 antibody.

13. The pharmaceutical combination of claim 11, wherein the vaccine is a tumor neoantigen-based vaccine.

14. A pharmaceutical composition comprising the pharmaceutical combination of any one of claims 1-13 and a pharmaceutically acceptable carrier.

15. A kit comprising a pharmaceutical combination of any one of claims 1-13 or a pharmaceutical composition of claim 14.

16. Use of the pharmaceutical combination of any one of claims 1-13, the pharmaceutical composition of claim 14, or the kit of claim 15 in the preparation of a medicament for the treatment or prevention of cancer or infectious diseases.

17. The use of claim 16, wherein the cancer is a cancer in which cancer cells express low levels of MHC-I and / or MHC-II.

18. The use of claim 16 or 17, wherein... The cancers mentioned are selected from squamous cell carcinoma of the head and neck, breast cancer, bone cancer, prostate cancer, lung cancer, adrenal cancer, bile duct cancer, bladder cancer, bronchial cancer, nerve tissue cancer, gallbladder cancer, stomach cancer, salivary gland cancer, esophageal cancer, small intestine cancer, cervical cancer, colon cancer, rectal cancer, liver cancer, ovarian cancer, pancreatic cancer, melanoma, pituitary adenoma, secretory adenoma, synovial sarcoma, multiple myeloma, Hodgkin lymphoma, non-Hodgkin lymphoma, acute lymphoblastic leukemia, acute myeloid leukemia, chronic myeloid leukemia, and chronic lymphocytic leukemia. The infectious diseases mentioned are selected from viral infections, bacterial infections, fungal infections, and parasitic infections.

19. Use of bleomycin or its analogues in the preparation of immunostimulants that enhance MHC-I and / or MHC-II dependent immune responses.

20. The use of claim 19, wherein the bleomycin is selected from BLM A2, BLM B2, BLM A5 and combinations thereof; more preferably, the bleomycin is a mixture of BLM A2 and BLM B2.

21. The use of claim 19, wherein the bleomycin analogue is selected from pelemycin, rizuram, liblomycin, zobamycin, fosetyl-aluminum, and combinations thereof.

22. The use according to any one of claims 19-21, wherein the immune enhancer enhances the antitumor effect of the antitumor immunotherapy agent, and the antitumor immunotherapy agent participates in MHC-I and / or MHC-II dependent antitumor immune responses; preferably, the antitumor immunotherapy agent is an immunotherapy agent as defined in any one of claims 6-13.

23. The use of any one of claims 19-21, wherein the immune enhancer enhances the anti-infective immune response, and the infection is selected from viral infections, bacterial infections, fungal infections, and parasitic infections.

Images