SNP (Single Nucleotide Polymorphism) molecular marker related to pig body length character and application

By screening for the SNP molecular marker at the 467th base of the BHLHB9 gene coding region on the pig X chromosome and combining it with RFLP detection technology, the problem of low breeding efficiency of pig body length trait was solved, and rapid and low-cost prediction of pig body length trait was achieved, thus improving the efficiency of pig breed improvement.

CN121023033APending Publication Date: 2025-11-28CHINA AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511240020.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2025-01-16
Filing Date
2025-09-02
Publication Date
2025-11-28

AI Technical Summary

Technical Problem

The lack of rapid, simple and effective molecular genetic markers for pig body length traits in existing technologies leads to low breeding efficiency for pig body length traits, making it difficult to meet the needs of large-scale genetic improvement.

Method used

A SNP molecular marker located at the 467th base of the BHLHB9 gene coding region on the pig X chromosome is provided. The genotype can be determined by amplification with specific primer sets and RFLP detection technology, thus distinguishing between individuals with medium-short body length and long body length.

Benefits of technology

It enables early, rapid, and low-cost prediction of pig body length traits, applicable to both domestic and international pig breeds, thus improving the efficiency and economic value of pig breed improvement.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121023033A_ABST
    Figure CN121023033A_ABST
Patent Text Reader

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to a pig body length character and application, and belongs to the technical field of biology. The SNP molecular marker is located on a pig X chromosome, and an SNP site is located at the 467th basic group of a pig BHLHB9 gene coding region (A in ATG in the coding region is 1); the basic group of the SNP site is C / T missense mutation. The SNP molecular marker related to the pig body length character is disclosed for the first time, is used for distinguishing individuals with medium and short body lengths and individuals with long body lengths, is suitable for domestic pig breeds and foreign pig breeds, and is wide in pig breed application range. The method for detecting the genotype of the SNP molecular marker disclosed by the invention can be used for quickly and effectively predicting the body length of a pig in an early stage at low cost, has a wide application prospect in the aspect of improvement of a pig variety strain, and can obtain an excellent economic value.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to a SNP molecular marker related to pig body length traits and application. BACKGROUND

[0002] Body length is one of the most commonly used indicators to measure body size traits, and its heritability is 0.29-0.55, which belongs to a trait with a heritability of more than medium. In livestock, body length is closely related to animal meat production, and it can be used as an important indicator to improve the production performance of livestock, which has important economic value. At the same time, the variation of body length is one of the most important quantitative traits in the process of species evolution, and there is a large difference between species and different breeds within the species. China is one of the main centers of domestic pig domestication, and under the driving of long-term selection and evolution, many local breeds with characteristics have been formed, which have high reproductive efficiency, strong disease resistance, good meat quality and other characteristics, but generally show small body size. The great difference in body size between different pig breeds provides an ideal research model for revealing the molecular mechanism of body size development and genetic improvement of local pig breeds. Under this background, the development of a rapid, simple and effective molecular genetic marker for pig body length traits can be applied to the detection of large populations, early selection and breeding, increase the selection pressure of body length, and speed up the process of genetic improvement.

[0003] BHLHB9 (basic helix-loop-helix domain containing, class B, 9, basic / helix-loop-helix containing domain, class B, 9) is an important transcription factor in the basic / helix-loop-helix transcription factor family B protein, which exists in the cytoplasm and nucleus, and plays an important role in cell proliferation, determination and differentiation. Its functional domain contains a basic region and two alpha-helix regions (helix-loop-helix, HLH) connected by a variable length loop region. Usually, the HLH domain first forms a homodimer or heterodimer or multimer, and then binds to DNA by the basic region. Studies have shown that BHLHB9 may be an important hub gene involved in skeletal development, which is highly expressed in proliferating growth plate chondrocytes, and the expression pattern in vitro is consistent with the early cartilage marker gene collagen III. In humans and mice, the deletion of four gene fragments containing BHLHB9 will cause postnatal growth retardation, weight loss and other human Xq22.1 deletion syndrome, indicating that BHLHB9 may be related to fetal body size. However, there is still a big gap in the research on BHLHB9 gene in pig body length development. In addition, it is not clear whether there is a molecular marker in the pig BHLHB9 gene that can be used for pig body length trait selection. SUMMARY

[0004] The purpose of this invention is to provide a SNP molecular marker related to pig body length traits and its application, so as to solve the problems existing in the prior art.

[0005] To achieve the above objectives, the present invention provides the following solution:

[0006] One of the technical solutions of the present invention is a SNP molecular marker related to pig body length, wherein the SNP molecular marker is located on the pig X chromosome;

[0007] The SNP site is located at the 467th base in the coding region of the porcine BHLHB9 gene (A in the ATG coding region is 1);

[0008] The SNP site contains a C / T missense mutation.

[0009] The second technical solution of the present invention is a primer set for specifically amplifying the SNP molecular marker, including upstream primers as shown in SEQ ID NO.1 or SEQ ID NO.3;

[0010] And downstream primers as shown in SEQ ID NO.2 or SEQ ID NO.4.

[0011] The third technical solution of the present invention is a method for identifying pig body length using the SNP molecular marker, which involves detecting the genotype of the corresponding single nucleotide polymorphism site of the SNP molecular marker in the DNA of the pig sample to be identified, and determining the pig body length-related traits based on the genotype of the SNP molecular marker.

[0012] The fourth technical solution of the present invention is the application of the SNP molecular marker in breeding pig body length-related traits.

[0013] The fifth technical solution of the present invention is the application of the SNP molecular marker in the identification or auxiliary identification of pig body length-related traits.

[0014] The sixth technical solution of the present invention is the application of the SNP molecular marker in the preparation of products for identifying or assisting in the identification of pig body length-related traits.

[0015] Based on the above technical solution, the present invention has the following technical effects:

[0016] This invention discloses for the first time SNP molecular markers associated with pig body length traits, used to distinguish between short- to medium-length and long-length individuals. It is applicable to both domestic and foreign pig breeds, and has a wide range of applicable breeds. The method for detecting SNP molecular marker genotypes in this invention can predict pig body length early, rapidly, at low cost, and effectively, showing broad application prospects in pig breed improvement and potentially yielding excellent economic value. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1 The number of overlapping genes (C) detected by the two methods Fst (A) and RNA-seq (B) in Example 1 of this invention.

[0019] Figure 2 This is the Fst plot of the pig breeds with different body sizes and lengths.

[0020] Figure 3 A heatmap (A) and a linkage disequilibrium analysis diagram (B) of haplotype distribution within approximately 5 kb upstream and downstream of BHLHB9 mRNA in large and small body long pigs.

[0021] Figure 4 This is a Singer sequencing image of the 467th base of the BHLHB9 gene coding region in Large White pigs and Wuzhishan pigs. The top image is of Large White pigs, and the bottom image is of Wuzhishan pigs.

[0022] Figure 5 This is a schematic diagram of ApaI endonuclease analysis.

[0023] Figure 6 The image shows the agarose gel electrophoresis results after ApaI digestion for two different genotypes. Detailed Implementation

[0024] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0025] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Every smaller range between any stated value or intermediate value within a stated range, and any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0026] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0027] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be obvious to those skilled in the art. This application specification and embodiments are merely exemplary.

[0028] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0029] Unless otherwise specified, the technical solutions described in this invention are all conventional solutions in the field, and the reagents or raw materials used are all purchased from commercial channels or are publicly available unless otherwise specified.

[0030] This invention provides a SNP molecular marker related to pig body length, wherein the SNP molecular marker is located on the pig X chromosome;

[0031] The SNP sites are located at the 467th base in the coding region of the porcine BHLHB9 gene (A in the coding region ATG is 1);

[0032] The SNP site contains a C / T missense mutation.

[0033] This invention is the first to discover the correlation between fully linked SNP molecular markers in the porcine BHLHB9 gene and the body length trait in pigs. Therefore, it can be used for marker-assisted selection breeding in pigs, providing a new application for marker-assisted breeding of the porcine BHLHB9 gene in the body length trait. This invention is not only simple to operate, fast in genotyping, accurate in results, and low in cost, but also greatly improves the efficiency of trait selection, helps to shorten the breeding cycle, and meets the practical needs of large-scale molecular marker-assisted selection.

[0034] It should be noted that the reference genome of this invention is the pig reference genome (Sus scrofa) version 11.1.

[0035] In some specific implementations, the SNP includes genotypes TT and CC.

[0036] Embodiments of the present invention also provide primer sets for specifically amplifying the SNP molecular marker combinations, including upstream primers as shown in SEQ ID NO. 1 or SEQ ID NO. 3;

[0037] And downstream primers as shown in SEQ ID NO.2 or SEQ ID NO.4.

[0038] This invention also provides a method for identifying pig body length using the SNP molecular marker, which involves detecting the genotype of the corresponding single nucleotide polymorphism site of the SNP molecular marker in the DNA of the pig sample to be identified, and determining the pig body length-related traits based on the genotype of the SNP molecular marker.

[0039] In some specific implementations, the method for detecting the genotype of the corresponding single nucleotide polymorphism site of the SNP molecular marker in the DNA of the pig sample to be identified is as follows: using the DNA of the pig sample to be identified as a template, amplification is performed using the primer set, and then the amplification product is digested with the RFLP restriction endonuclease ApaI, and the genotype of the SNP molecular marker is determined based on the digestion product.

[0040] In some specific implementations, the method for determining the genotype of the SNP molecular marker based on the enzyme digestion product is as follows: if the enzyme digestion product is 419 bp, the genotype of the SNP site is TT; if the enzyme digestion products are 271 bp and 148 bp, the genotype of the SNP site is CC.

[0041] In some specific implementation schemes, the method for determining the pig body length-related traits is as follows: if the SNP genotype is TT, then the pig to be identified is a medium-short body length individual;

[0042] If the SNP genotype is CC, then the pig to be identified is a long-bodied, long-legged individual.

[0043] This invention also provides the application of the SNP molecular marker in breeding pig body length-related traits.

[0044] This invention also provides the application of the SNP molecular marker in identifying or assisting in the identification of pig body length-related traits.

[0045] This invention also provides the application of the SNP molecular marker in the preparation of products for identifying or assisting in the identification of pig body length-related traits.

[0046] The objective of this invention is achieved through the following technical solution:

[0047] Firstly, by comprehensively analyzing selection signal data and transcriptome data from pig populations of varying body sizes, this invention successfully screened out the BHLHB9 gene, which exhibits the highest differentiation index across different populations, making it a key candidate gene influencing pig body length traits. Furthermore, an analysis of approximately 5kb upstream and downstream regions of the BHLHB9 mRNA revealed 95 SNPs, and the entire region was in complete linkage disequilibrium.

[0048] Next, using the genomes of 10 Wuzhishan pigs and 10 Large White pigs as templates, the partial base sequence of the porcine BHLHB9 gene was sequenced using PCR technology with Singer. The sequence results were analyzed using ChromasPro v1.41 software to identify SNP mutation sites and screen for SNP sites affecting the body length trait in pigs. Among them, a CT missense mutation was found at the 467th base of the coding region of the BHLHB9 gene (where A is 1 in the ATG of the coding region), mainly manifested as a proline mutation to leucine. When the genotype at this site is C, the long body length trait in pigs is more obvious; when the genotype at this site is T, the short body length trait in pigs is more obvious.

[0049] Furthermore, this invention employs large-scale SNP genotyping to validate short-to-medium body length breeds using 20 Wuzhishan pigs (average body length), 10 Bama miniature pigs (average body length), 6 Tibetan pigs (average body length), 10 Yunnan small-eared pigs (average body length), and 30 Ding'an pigs (average body length). Simultaneously, it validates long-body length breeds using 30 Duroc pigs (average body length), 14 Pietrain pigs (average body length), 20 Large White pigs (average body length), and 31 Landrace pigs (average body length) (body length data for the experimental pigs are from *Chinese Journal of Animal Genetic Resources: Swine*, May 2011). The results show that the average body length of the CC genotype population is significantly longer than that of the TT genotype population. Linear model analysis using the GenABLE software package in R further revealed that these SNP loci are significantly associated with individual body length traits. Using local Chinese pig breeds—Wuzhishan pig, Bama fragrant pig, Tibetan pig, Diannan small-eared pig, and Ding'an pig—as medium-short body length pig breeds, and comparing them with long-body, long-type Duroc pigs, Pietrain pigs, Large White pigs, and Landrace pigs, allele frequency analysis of this SNP was performed. The allele C at the SNP locus showed a low gene frequency in the local Chinese pig breeds, all below 0.10, while the gene frequency in the long-body, long-type pig herd was extremely high, all above 0.93. This further confirms the above association analysis findings: the stated SNP locus is significantly associated with the pig body length trait, with C positively correlated with the long body length trait and T positively correlated with the medium-short body length trait.

[0050] Example 1

[0051] Acquisition of SNP molecular markers associated with body length trait

[0052] This study performed selection signal analysis on the resequencing results of the smallest local pig breeds, Wuzhishan pig and Bama miniature pig, and the relatively larger introduced pig breeds, Large White pig and Duroc pig. The results revealed a total of 657 differentially expressed genes in four comparison groups: Wuzhishan pig vs. Large White pig, Wuzhishan pig vs. Duroc pig, Bama miniature pig vs. Large White pig, and Bama miniature pig vs. Duroc pig (see...). Figure 1 (See A). Furthermore, RNA-seq was performed on the thoracic vertebral cartilage tissues of Wuzhishan pigs (1 month old during the rapid growth phase) and Large White pigs (4 months old during the late growth phase). The results showed a total of 22 differentially expressed genes in the four control groups: 1-month-old Wuzhishan pigs vs. Large White pigs, 4-month-old Wuzhishan pigs vs. Large White pigs, 1-month-old Wuzhishan pigs vs. 4-month-old Wuzhishan pigs, and 1-month-old Large White pigs vs. 4-month-old Large White pigs (see A). Figure 1 (B). The results of combined selection signal and RNA-seq analysis showed that there were 3 differentially expressed genes that overlapped between the two methods (see [link]). Figure 1 Among the C-type genes, the BHLHB9 gene exhibited the largest differentiation index across populations and is likely a key candidate gene involved in pig body length development (see [link to C-type gene list]). Figure 2 ).

[0053] According to the porcine BHLHB9 gene sequence (XM_005657883.3) published by NCBI, the BHLHB9 gene is located on the pig X chromosome and is 1677 bp in length. Analysis of approximately 5 kb upstream and downstream of the BHLHB9 mRNA revealed 95 SNPs, and there are significantly different genotypes in different pig breeds (see...). Figure 3 In addition, the entire region is in a state of complete interconnected imbalance (see A). Figure 3 (B)

[0054] Using the genomes of 10 Wuzhishan pigs and 10 Large White pigs as templates, the partial base sequence of the porcine BHLHB9 gene was detected using Singer PCR sequencing. The primer sequences for this embodiment are shown in Table 1. The sequencing peak diagram confirmed the presence of a C / T mutation at base position 467 of the BHLHB9 gene coding region (where A in the ATG region is 1) (see...). Figure 4 This causes a missense mutation in proline to leucine.

[0055] BHLHB9 coding region sequence SEQ ID NO.5: ATGACTGGGGTTAAGAATGCAAGTAAAA AGAATAGAAGTAGGAAAAATGAGAATAAAAAGAAGGCCAAAACTGAAAAAAGGGCTGGTGTAGAAGCTGAAGCAAAGAAGGAGGCTACTGGTGTAGTCAGATCTGTACCCAAGACCCAGGCCAAAGCAGTAGCCAAGGCAGGGTCCCAGGAAGATGCAGTGGCAGAGATGAAGGCAGCATCTAAGAACAAGGTTGTTAGTGAGATGAAGGAAGGAGTCTTGGCAGATATCAGTCCTAAAGCTGAAGATGAAGCAACTAGATCTTCTTGTTCTGTAGTTAAGGCTAGTGCTGAATCCAGGTCTACACGTAAAGATAAGACTGGTATTGATACCCAGCCCCGGGCTGGGGAAGAGGCCAGTGTTGGTTCCTCATCCCAGAATGGAGGAGAAGCTAGTAATGGTTTCAGCGCTAAGGATGAAGGTAAAGCTGATACTGGGC C

[0056] Note: Bold underlined sites are SNP sites.

[0057] Table 1. Specific primers for BHLHB9 gene SNP detection

[0058]

[0059] Example 2

[0060] Establishment of a method for detecting SNP molecular markers associated with pig body length traits

[0061] 1. Detection of SNP population levels using RFLP restriction endonucleases

[0062] Based on the research results of Example 1 and the characteristics of the sequence, restriction fragment length polymorphism (RFLP) was used to detect the SNP molecular markers of Example 1 at the population level. A specific primer was used to introduce a mutation upstream of the mutation site to create an ApaI restriction site (see Table 2). When the base at the SNP site is C, it can be cleaved by ApaI, and when it is T, it cannot be cleaved by ApaI. This is used for genotyping (e.g., Figure 5 PCR amplification was performed using the primers in Table 2.

[0063] Table 2. Primers for C / T mutation-specific detection using Apai enzyme digestion.

[0064]

[0065] Table 3 Apai I enzyme digestion reaction system

[0066]

[0067] The PCR amplification reaction system was as follows: SYBR Green Master Mix: 10 μL, forward and reverse primers: 0.5 μL each, cDNA: 1 μL, RNase-Free ddH2O: 8 μL.

[0068] The PCR amplification reaction program was: 94℃ for 3 min; 94℃ for 30 s, 55℃ for 30 s, 72℃ for 1 min, 72℃ for 5 min, for a total of 30 cycles.

[0069] After amplification, the amplification product was digested with enzymes using the reaction system in Table 3.

[0070] After enzyme digestion, 10 μL of the digestion product was subjected to 2% agarose gel electrophoresis at 110V for 40 min. Typing was then performed based on the position of the electrophoretic bands. Figure 6If the enzyme digestion product is 419bp, the genotype of the SNP site is TT, and the pig being tested is a medium-short body length individual; if the enzyme digestion products are 271bp and 148bp, the genotype of the SNP site is CC, and the pig being tested is a long body length individual.

[0071] Furthermore, using local Chinese pig breeds such as Wuzhishan pig, Bama fragrant pig, Tibetan pig, Diannan small-eared pig, and Ding'an pig as medium-short body, long-legged pig breeds, and comparing them with long-body, long-type Duroc pigs, Pietrain pigs, Large White pigs, and Landrace pigs, allele frequency analysis of this SNP was conducted. The results showed that the allele C at this SNP locus had a low frequency in local Chinese pig breeds, all below 0.10, while the frequency was extremely high in long-body, long-legged pig groups, all above 0.93. Specific frequency distributions are shown in Table 4 below.

[0072] Table 4 Genotype and allele frequencies of SNP loci in different pig breeds

[0073]

[0074] 2. Group-level association analysis

[0075] The SNP typing data and body length phenotypic data of the above 171 pigs (body length data are from "Chinese Animal Genetic Resources: Pigs", May 2011) were compiled and are shown in Table 5.

[0076] Table 5 Phenotypic traits of body length in different pig populations

[0077]

[0078]

[0079] A linear regression model was further constructed between the body length phenotype and the genotype frequency of SNP C. The final linear regression model was Y = 78.51X + 89.50, P < 0.0001, indicating that the gene frequency of the SNP molecular marker in this invention is significantly positively correlated with the pig body length trait. In summary, the C→T locus is associated with the pig body length trait and can be used as a marker for the selection and improvement of long-body populations.

[0080] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively describe all embodiments here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.

Claims

1. A SNP molecular marker associated with pig body length, characterized in that, The SNP molecular marker is located on the pig X chromosome; The SNP site is located at the 467th base in the coding region of the porcine BHLHB9 gene (A in the ATG coding region is 1); The SNP site contains a C / T missense mutation.

2. The SNP molecular marker according to claim 1, characterized in that, The SNP contains genotypes TT and CC.

3. A primer set for specifically amplifying the SNP molecular marker as described in claim 1 or 2, characterized in that, This includes upstream primers as shown in SEQ ID NO. 1 or SEQ ID NO. 3; And downstream primers as shown in SEQ ID NO.2 or SEQ ID NO.

4.

4. A method for identifying pig body length using the SNP molecular marker described in claim 1 or 2, characterized in that, The genotypes of the corresponding single nucleotide polymorphism sites of the SNP molecular markers in the DNA of the pig sample to be identified are detected, and the pig's body length-related traits are determined based on the genotypes of the SNP molecular markers.

5. The method according to claim 4, characterized in that, The method for detecting the genotype of the corresponding single nucleotide polymorphism site of the SNP molecular marker in the DNA of the pig sample to be identified is as follows: using the DNA of the pig sample to be identified as a template, amplification is performed using the primer set described in claim 3, and then the amplification product is digested with the RFLP restriction endonuclease ApaI, and the genotype of the SNP molecular marker is determined based on the digestion product.

6. The method according to claim 5, characterized in that, The method for determining the genotype of the SNP molecular marker based on the enzyme digestion product is as follows: if the enzyme digestion product is 419 bp, the genotype of the SNP site is TT; if the enzyme digestion products are 271 bp and 148 bp, the genotype of the SNP site is CC.

7. The method according to claim 4, characterized in that, The method for determining the pig's body length-related traits is as follows: if the SNP genotype is TT, then the pig to be identified is a medium-short body length individual; If the SNP genotype is CC, then the pig to be identified is a long-bodied, long-legged individual.

8. The application of the SNP molecular marker as described in claim 1 or 2 in breeding pigs for body length-related traits.

9. The application of the SNP molecular marker as described in claim 1 or 2 in the identification or auxiliary identification of porcine body length-related traits.

10. The use of the SNP molecular marker as described in claim 1 or 2 in the preparation of products for identifying or assisting in the identification of porcine body length-related traits.