ABCB4 gene mutation-carrying induced pluripotent stem cell strain and application thereof

Abstract

The invention belongs to the technical field of biological medicines, and particularly discloses an induced pluripotent stem cell (iPSC) strain carrying ABCB4 gene mutation and application thereof. The stem cell strain is preserved in the China Center for Type Culture Collection (the preservation number is CCTCC NO: C2025125), and carries ABCB4 gene composite heterozygous mutation c.992Ggt; a is (p.G331E), and c is 3152Tgt; the invention relates to the field of biomarkers (p.V1051A, C (p.V1051A), which can stably express pluripotent markers (OCT4, SOX2, NANOG and SSEA4), and has the capability of differentiating towards trigerm layers. The stem cell strain can be used for constructing a research model of progressive familial intrahepatic cholestasis type 3 (PFIC3), simulates disease phenotypes by differentiating hepatic cells or bile duct cells, is suitable for drug screening and gene therapy research, and provides a precise humanized tool for mechanism analysis and treatment development of ABCB4 mutation related diseases.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, and specifically discloses an induced pluripotent stem cell (iPSC) line carrying the ABCB4 gene mutation and its application. Background Technology

[0002] Progressive familial intrahepatic cholestasis type 3 (PFIC3) is a severe hereditary liver disease caused by mutations in the ABCB4 gene. Its main clinical features are chronic cholestasis, progressive liver fibrosis, and often lead to liver failure in childhood. The pathogenesis of this disease is closely related to the functional deficiency of the MDR3 protein encoded by the ABCB4 gene. MDR3, as a liver-specific phosphatidylcholine transporter, plays a crucial role in bile formation, responsible for transporting phosphatidylcholine into the bile, where it binds to bile acids to form protective mixed microparticles. When mutations in the ABCB4 gene lead to abnormal MDR3 protein function, the phospholipid content in bile decreases significantly, causing bile duct epithelial cells to lose their protective barrier and become exposed to a toxic environment of high concentrations of bile acids, ultimately leading to hepatocellular damage, bile duct inflammation, and irreversible liver fibrosis.

[0003] From an epidemiological perspective, the incidence of PFIC3 is approximately 1 in 50,000 to 1 in 100,000. Although classified as a rare disease, it plays a significant role among childhood cholestatic liver diseases. As an autosomal recessive genetic disorder, siblings of patients with PFIC3 have a 25% risk of developing the disease. The disease typically manifests in children aged 1-10 years, progresses rapidly, and about half of patients develop end-stage liver disease before the age of 10, requiring liver transplantation for survival. This places a heavy financial burden on patients' families and puts immense pressure on social medical resources.

[0004] The clinical treatment of PFIC3 currently faces severe challenges. In terms of drug therapy, while ursodeoxycholic acid (UDCA) can improve cholestasis symptoms in approximately 30% of patients, it has no reversible effect on the progression of liver fibrosis; drugs such as rifampin are mainly used to relieve itching symptoms and have no substantial impact on disease progression. For end-stage patients, liver transplantation is the only effective radical cure, but it faces multiple difficulties including donor shortages, postoperative rejection, and long-term complications. More importantly, some patients may still exhibit abnormal ABCB4 protein expression after transplantation, leading to a risk of disease relapse.

[0005] In terms of disease research models, existing technologies have significant limitations. While animal models such as Abcb4 knockout mice can partially mimic disease phenotypes, they cannot fully reproduce the complexity of human bile acid metabolism. Primary hepatocytes, due to limited availability and difficulty in long-term culture, cannot meet the needs of large-scale research. In contrast, induced pluripotent stem cell (iPSC) technology exhibits unique advantages. By reprogramming patient somatic cells, iPSCs with a complete genetic background can be obtained, which can then differentiate into hepatocytes or bile duct cells, providing an ideal platform for disease mechanism research and drug development. However, there are currently no reports of iPSC lines carrying the ABCB4 compound heterozygous mutation, a gap that severely restricts the in-depth development of PFIC3 research. Summary of the Invention

[0006] To address the aforementioned issues, this invention discloses an induced pluripotent stem cell line carrying the ABCB4 gene mutation and, for the first time, successfully established a patient-derived iPSC model that retains the ABCB4 gene mutation. This innovation not only fills a technological gap in this field but also provides an indispensable research tool for precision medicine research on PFIC3, including gene therapy strategy evaluation and targeted drug screening, demonstrating significant scientific value and clinical translational potential.

[0007] To achieve the above objectives, the present invention adopts the following technical solution:

[0008] An induced pluripotent stem cell line carrying the ABCB4 gene mutation has been deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO: C2025125.

[0009] Furthermore, the aforementioned induced pluripotent stem cell line carries a complex heterozygous mutation of c.992G>A (p.G331E) and c.3152T>C (p.V1051A), expresses pluripotency markers OCT4, SOX2, NANOG and SSEA4, and has the ability to differentiate into the three germ layers.

[0010] Furthermore, the aforementioned induced pluripotent stem cell lines also include any one or more of the following characteristics:

[0011] (a) The karyotype of the stem cell line is a normal male karyotype (46,XY);

[0012] (b) STR analysis confirmed that the stem cell line was a complete match with donor peripheral blood mononuclear cells at 28 genomic loci.

[0013] (c) After differentiation, it can express the ectoderm marker PAX6, the mesodermal marker Brachyury, and the endoderm marker SOX17.

[0014] This invention discloses a method for preparing the above-mentioned induced pluripotent stem cell line, comprising the following steps:

[0015] (1) Mononuclear cells (PBMCs) were isolated from peripheral blood of patients with progressive familial intrahepatic cholestasis type 3.

[0016] (2) Use The -iPS2.0Sendai viral vector reprograms PBMCs, and the vector contains genes encoding SOX2, KLF4 and c-MYC;

[0017] (3) In Essential 8 TM Pluripotent clones were screened and amplified in the culture medium and maintained in the culture medium coated with Geltrex.

[0018] Furthermore, in the above-mentioned method for preparing induced pluripotent stem cell lines, in step (1), PBMCs are separated by Ficoll density gradient centrifugation and initially cultured in RPMI 1640 medium containing 10% fetal bovine serum; in step (3), the culture conditions are 37℃ and 5% CO2 environment, and 0.5mM EDTA is used to dissociate the cells during passage.

[0019] This invention discloses the application of the above-mentioned induced pluripotent stem cell line in constructing an in vitro model of progressive familial intrahepatic cholestasis of disease type 3, wherein the stem cell line is differentiated into hepatocytes or bile duct cells to simulate the pathological phenotype of abnormal bile acid metabolism and liver fibrosis.

[0020] Furthermore, in the above applications, the model is used to screen candidate drugs that can alleviate cholestasis, inhibit hepatocellular damage, or slow the progression of liver fibrosis.

[0021] This invention discloses the application of the above-mentioned induced pluripotent stem cell line in gene drug research, using CRISPR / Cas9 technology to repair the ABCB4 gene mutation of the stem cell line, and evaluating the phenotypic reversal effect and therapeutic potential.

[0022] Furthermore, in the above application, the function of MDR3 protein is restored in the repaired differentiated hepatocytes, and the bile phospholipid transport capacity is significantly improved.

[0023] This invention discloses the application of the above-mentioned induced pluripotent stem cell line in toxicity testing, using its differentiated cells to evaluate the damage mechanism of bile acid toxicity to hepatocytes and the effects of protective compounds.

[0024] Compared with the prior art, the present invention has the following outstanding advantages:

[0025] This invention addresses the research and treatment needs of progressive familial intrahepatic cholestasis of disease type 3 (PFIC3) by screening for an induced pluripotent stem cell (iPSC) line carrying the ABCB4 gene mutation. Its beneficial effects can be summarized in the following five aspects:

[0026] 1. Fill technological gaps and establish precise disease models.

[0027] Overcoming the limitations of existing models: Traditional animal models (such as Abcb4 knockout mice) cannot fully simulate the complexity of human bile acid metabolism, while the source of primary hepatocytes is limited and difficult to culture for long periods. This invention successfully establishes for the first time an iPSC strain that retains the ABCB4 compound heterozygous mutation (c.992G>A and c.3152T>C), providing an in vitro model with a genetic background highly consistent with patients for PFIC3 research.

[0028] Comprehensive functional validation: The iPSC strain expresses pluripotency markers (OCT4, SOX2, NANOG, SSEA4), has the ability to differentiate into three germ layers, and its genetic stability was verified by chromosome karyotype analysis (46, XY) and STR analysis (28 genomic loci were completely matched), ensuring the reliability of the model.

[0029] 2. Accelerate drug screening and mechanism analysis

[0030] Pathological phenotype simulation: Differentiated hepatocytes / cholecysts can simulate the pathological process of abnormal bile acid metabolism and liver fibrosis, which can be used to screen candidate drugs to alleviate cholestasis, inhibit hepatocyte damage or delay liver fibrosis, thereby improving the efficiency of drug development.

[0031] Toxicity testing platform: Supports the assessment of the damage mechanism of bile acid toxicity to hepatocytes and the effects of protective compounds, providing experimental evidence for the development of targeted therapies.

[0032] 3. Promote the development of gene therapy strategies

[0033] Feasibility of gene editing: After repairing the ABCB4 gene mutation using CRISPR / Cas9 technology, the function of MDR3 protein in differentiated hepatocytes was restored, and the bile phospholipid transport capacity was significantly improved, verifying the phenotypic reversal effect of gene therapy and providing key data for clinical translation.

[0034] 4. Optimize medical resources and reduce the social burden.

[0035] Alternative animal experiments: Reduce reliance on traditional animal models, lower experimental costs and timeframes, and avoid data bias caused by species differences.

[0036] Potential for precision medicine: Providing a pre-assessment platform for individualized treatment plans for PFIC3 patients, reducing ineffective treatment attempts and improving the efficiency of medical resource utilization.

[0037] 5. Clinical translation and application expansion

[0038] Liver transplant support tools: These tools can predict a patient's response to liver transplantation and the risk of postoperative recurrence (such as abnormal expression of ABCB4 protein), and assist in developing personalized surgical plans.

[0039] Multisystem disease research: The trilaminar differentiation capacity of iPSCs supports their expanded application in other genetic diseases such as metabolic syndrome and cystic fibrosis.

[0040] The preservation information for the strain is as follows:

[0041] Name of depositary institution: China Center for Type Culture Collection (CCTCC);

[0042] Address of the depository: No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province;

[0043] Deposit date: May 13, 2025;

[0044] Accession number CCTCC NO:C2025125;

[0045] Taxonomic nomenclature: DPNJMUi002-AiPSC Homo sapiens. Attached Figure Description

[0046] Figure 1 Image of .DPNJMUi002-A iPSCs cultured to the 15th generation (P15) cloning results; under phase contrast microscopy, they show typical clonal growth with clear boundaries, tightly packed cells within the cell clusters, and a high nucleus-to-cytoplasm ratio (objective 10X).

[0047] Figure 2 First-generation Sanger sequencing verification showed that the cells carried compound heterozygous variants of the ABCB4 gene, c.992G>A (p.G331E) and c.3152T>C (p.V1051A), indicating that the DPNJMUi002-A iPSCs carried mutations consistent with those of the patients.

[0048] Figure 3 Immunofluorescence staining results of Oct3 / 4, a marker of undifferentiated cell lines; Oct3 / 4 (red); cell nuclei stained with Hoechst (blue);

[0049] Figure 4Flow cytometry analysis results of cell lines, showing the simultaneous expression of SSEA4, Nang, and Oct3 / 4 in DPNJMUi002-A iPSCs; Figure 4 A showed that 96.76% of the cells were Nang positive. Figure 4 B showed that 99.73% of the cells were Oct3 / 4 positive. Figure 4 C showed that 94.6% of iPSCs were SSEA4 positive, indicating

[0050] DPNJMUi002-A iPSCs have high expression levels of undifferentiated markers and are a highly pure induced pluripotent stem cell line.

[0051] Figure 5 Immunofluorescence staining results of lineage-specific markers of the three germ layers of the cell line. The lineage-specific markers of the three germ layers (red) (ectoderm: PAX6; mesoderm: SOX17; endoderm: Brachyury), and the cell nuclei stained with DAPI (blue), indicate that DPNJMUi002-A iPSCs have the ability to differentiate into the three germ layers.

[0052] Figure 6 The cell line chromosome karyotype analysis results showed a normal male karyotype (46,XY);

[0053] Figure 7 Analysis of 28 STR loci in cell lines and peripheral blood of patients; A represents the STR analysis of the cell lines, and B represents the STR analysis of peripheral blood of patients; all 28 STR loci showed high concordance, indicating that DPNJMUi002-A iPSCs and peripheral blood of patients are of the same biological origin;

[0054] Figure 8 Mycoplasma contamination detection results for cell lines: Lane 1: DNA marker: DL2000; Lane 2: Positive control, showing two bands of 150bp and 250bp; Lane 3: The cell line showed only a 150bp band, indicating no mycoplasma contamination; Lane 4: Negative control; The cell line showed only one band, indicating no mycoplasma infection. Detailed Implementation

[0055] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0056] Example 1

[0057] Patient recruitment and ethical approval

[0058] The donor was a 10-year-old Chinese boy suffering from progressive familial intrahepatic cholestasis of disease (ICD) caused by a complex heterozygous variant of the ABCB4 gene. In April 2020, he was admitted to our hospital due to cirrhosis, ascites, splenomegaly, and gastrointestinal bleeding. After a detailed medical history, physical examination, laboratory tests, and genetic testing, he was diagnosed with ICD type 3. The patient carried a complex heterozygous variant of the ABCB4 gene: c.992G>A (p.G331E) and c.3152T>C (p.V1051A). The Clinical Ethics Committee of Nanjing Medical University Affiliated Children's Hospital approved the genetic analysis and clinical characterization study (Approval No.: 202008052-1).

[0059] Example 2

[0060] PBMCs Decoupling and Reprogramming

[0061] 2.1 Extraction of PBMCs from Human Peripheral Blood

[0062] (1) Take two 15ml centrifuge tubes and add 7ml of Ficoll solution. Transfer 5ml of whole blood into the centrifuge tubes containing Ficoll, being careful to avoid mixing the two solutions.

[0063] (2) Set the centrifuge speed to 3, the deceleration speed to 0, the centrifugal force to 1200g, and the temperature to 20℃. After centrifugation for 15 minutes, the cells will separate into layers. The cell layer containing PBMCs is white. Transfer this cell layer to another clean 15ml centrifuge tube. Add 10ml of RPMI 1640 medium, set the centrifuge speed to 5, the deceleration speed to 5, and the centrifugal force to 750g. After centrifugation for 5 minutes, remove the supernatant.

[0064] (3) Prepare cell culture medium in advance: RPMI 1640 + 10% FBS + 1% P / S; add 10ml of culture medium to resuspend cells for subsequent counting culture or plate plating.

[0065] 2.2 Reprogramming PBMCs to iPSCs

[0066] Using Cytotune TM The iPS 2.0 Sendai Reprogramming Kit (Thermo Fisher Scientific) reprograms PBMCs using a Sendai virus-based vector encoding Yamanaka reprogramming factors (SOX2, KLF4, and CMYC).

[0067] (1) Inoculation and culture of PBMCs: Transfer the PBMCs from step 2.1 to a 15 ml centrifuge tube. Slowly add 5–10 mL of pre-warmed whole PBMC culture medium and perform viable cell counting (PBMC culture medium consists of whole PBMCs). The cell suspension was centrifuged at 200g for 10 min in a medium containing suitable cytokines (composition of -34). The supernatant was discarded, and the cells were resuspended in PBMC complete medium. The cells were cultured in a 37°C incubator for 4 days, with the medium changed daily.

[0068] (2) Cell counting and virus transfection: The volume of each virus required to reach the target was calculated using the MOI (Mean Intent of Immunity) based on viable cell count and titer information on the CoA. 2.5 × 10⁶ cells were inoculated. 5 –5×10 5 Cells are transferred to round-bottom centrifuge tubes for transfection. 2.0 Sendai reagent was thawed from -80°C and immediately placed on ice. The three viruses were added to 1 mL of PBMC medium according to the calculated volume, preheated to 37°C, and gently shaken to mix thoroughly. The prepared reprogrammed virus mixture was added to a round-bottom centrifuge tube containing PBMC, with a total volume between 1 and 1.5 mL. The centrifuge tube was tightly capped and sealed with a sealing film. The cells and virus were centrifuged at 1000g for 30 minutes, then 1 mL of PBMC medium was added to the tube to resuspend the cells. The cells were then transferred to a 12-well plate and incubated overnight at 37°C in a 5% CO2 incubator.

[0069] (3) Change the culture medium and maintain the culture: The next day, transfer the cells and culture medium to 15 mL centrifuge tubes. Wash the wells with 1 mL of culture medium. Centrifuge at 200 g for 10 min, discard the supernatant, resuspend the cells in 0.5 mL of PBMCs culture, and seed them into each well of a 24-well plate. Incubate at 37 °C and 5% CO2 for 2 days.

[0070] (4) Seeding iPSCs: Coat 6-well plates with Geltrex for 1 hour, count cells, and seed 1 x 10⁴–1 x 10⁵ live PBMCs per well with 2 mL of StemPro-34 medium. Use 1 mL of fresh... -34°C cytokine-free medium, change half the medium every other day for two days. Afterwards, change the medium halfway through with Essential 8. TM After 24 hours, replace all the culture medium with E8 medium and continue culturing for the specified number of days.

[0071] (5) Clones are selected: on days 15-21 after transfection, clones are selected and cultured continuously.

[0072] 2.3 Cultivation and Maintenance of iPSCs

[0073] iPSCs were cultured in Geltrex-coated petri dishes at 37°C and 5% CO2 using Essential 8. TM Culture medium maintenance. When cell confluence reaches 70%-80%, discard the old culture medium, wash once with DPBS, add an appropriate amount of 0.5 mM EDTA to cover the cell surface, and observe under a microscope until the cells are fully dissociated. Discard the EDTA, add DPBS to wash away any remaining EDTA, and then add an appropriate amount of Essential 8. TM The culture medium was passaged at a ratio of 1:8 to 1:10. For example... Figure 1 The image shows the cloning results of the cell line after passage to the 15th generation. Under a phase-contrast microscope, the cells exhibit typical clonal growth with clear boundaries (10X objective). The cells within the cell clusters are tightly packed and have a high nucleus-to-cytoplasm ratio.

[0074] Validation using 2.4iPSCs first-generation Sanger sequencing

[0075] DNA was extracted from DPNJMUi002-A iPSCs P10 generation and normal control iPSCs using the Tiangen DNA Extraction Kit (DP304). Primers were designed targeting the ABCB4 gene mutation sites c.992G>A (p.G331E) and c.3152T>C (p.V1051A). The primer sequences are as follows:

[0076] 992-F:CCATGGGTATTGCCTTCCTG=SEQ ID NO.1

[0077] 992-R:ATGGCTCCCATCCATATTTG=SEQ ID NO.2

[0078] 3152-F:GGCAGCTCTGGATAAGGTCA=SEQ ID NO.3

[0079] 3152-R:TTATAAAGACCTGGATCTGGGC=SEQ ID NO.4

[0080] Using the iPSC genomic DNA as a template, PCR amplification was performed using 2×Phanta Max Master Mix (Dye Plus). The program was as follows: pre-denaturation 95℃, 5 min; denaturation 95℃, 30 s; annealing 60℃, extension 72℃, 30 s, 34 cycles; extension 72℃, 5 min; 4℃, 10 min. The PCR products were sent to Nanjing Qingke Biotechnology Co., Ltd. for first-generation sequencing verification. The sequencing sequence was read using Chromas software and compared with the ABCB4 gene mutation sites. The results showed that iPSCs carried ABCB4 gene mutations c.992G>A (p.G331E) and c.3152T>C (p.V1051A). Figure 2 This indicates that DPNJMUi002-A iPSCs are consistent with the mutations carried by the patients.

[0081] Example 3

[0082] iPSC dry verification

[0083] 3.1 Immunofluorescence detection of undifferentiated markers in iPSCs

[0084] (1) iPSCs were seeded onto cell slides coated with Geltrex in advance, and the cells were harvested after the confluence was above 50%.

[0085] (2) Wash with PBS 3 times, 5 min each time, and fix with 4% paraformaldehyde for 15 min.

[0086] (3) Wash with PBS 3 times, 5 min each time, and permeate with PBS containing 0.3% Triton X-100 for 10 min.

[0087] (4) Wash with PBS 3 times, 5 min each time, and block with PBS containing 3% fetal bovine serum at 37°C for 1 hour.

[0088] (5) Dilute the iPSC undifferentiated marker (Oct3 / 4) primary antibody with PBS containing 1% BSA. The dilution ratio is shown in Table 1. Incubate the primary antibody overnight at 4°C.

[0089] (6) Half an hour after warming up the next day, the primary antibody was recovered and washed with PBS three times for 5 minutes each time. The secondary antibody was diluted with PBS containing 1% BSA. The dilution ratio is shown in Table 1. The secondary antibody was incubated at room temperature for 1 hour.

[0090] (7) The cell nuclei were stained with DAPI for 10 min, washed with PBS 3 times for 5 min each time, discarded the PBS and air-dried, and then mounted with anti-quenching glycerol.

[0091] (8) Images were taken using an OLYMPUS IX73 microscope. For example... Figure 3As shown, DPNJMUi002-AiPSCs show high expression of Oct3 / 4. Oct3 / 4 cells are shown in red, and the nuclei are stained with Hoechst (blue).

[0092] 3.2 Flow cytometry detection of undifferentiated markers in iPSCs

[0093] (1) Preparation of single-cell suspension: Wash each well with 1 mL DPBS, remove the washing solution, add 1 mL of cell dissociation reagent TyPLE to each well, incubate at 37°C for 3-5 minutes, then use a pipette with a 1 mL tip to blow up and down 1-3 times to ensure that all remaining cell clusters are broken into single cells, add 6-8 times the volume of DPBS to stop digestion, centrifuge at 300g for 5 minutes, discard the supernatant, and resuspend the cells in DPBS.

[0094] (2) Cell fixation and permeabilization: Fix with 4% PFA at room temperature for 10-15 minutes, and wash 3 times with DPBS. Permeabilization is required when staining Oct3 / 4, treat with 0.1% Triton X-100 for 10-15 minutes, and wash 3 times with DPBS.

[0095] (3) Blocking: Block with PBS containing 1% BSA at room temperature for 15-30 minutes.

[0096] (4) Primary antibody incubation: Add fluorescently labeled primary antibodies Oct3 / 4, SSEA4, Nanog and isotype control (see Table 1 for antibody details), incubate in the dark for 30 min, wash 3 times with DPBS by centrifugation, and resuspend in DPBS containing 1% fetal bovine serum.

[0097] (5) Instrumentation and Data Analysis: Calibrate the DxFLEX flow cytometer (Beckman Coulter), set thresholds to exclude debris, and collect 10,000-50,000 cell events. Select the target cell population, exclude debris and cell clumps, set an isotype control gate, and determine the positive signal threshold. Analyze the data using the flow cytometry software FlowJo.

[0098] (6) Figure 4 The results showed that 94.6% of the iPSCs were SSEA4 positive, 96.76% were Nang positive, and 99.73% were Oct3 / 4 positive. These results indicate that the DPNJMUi002-A iPSCs have high expression levels of undifferentiated markers and are a highly pure induced pluripotent stem cell line. Therefore, it was deposited at the China Center for Type Culture Collection, with accession number CCTCCNO: C2025125.

[0099] Example 4

[0100] iPSC Trilayer Differentiation Validation

[0101] In the 20th generation, STEMdiff was used. TM Trigerm layer differentiation kit (STEMCELL Technologies, 05230) was used for trigerm layer differentiation experiments.

[0102] (1) Coat 24-well plates with Matrigel and incubate at 37°C for 1 hour. Preheat mTeSR containing 10 μM Y-27632. TM 1. DMEM / F-12 and cell dissociation reagent TyPLE were heated to room temperature for passage.

[0103] (2) Wash the wells to be passaged with 1 mL DPBS, remove the washing solution, add 1 mL of cell dissociation reagent TyPLE to each well, incubate at 37°C for 3-5 minutes, and then use a pipette with a 1 mL tip to blow up and down 1-3 times to ensure that all remaining cell clusters are broken into single cells.

[0104] (3) Transfer the cells to a test tube containing 1 mL of DMEM / F-12. Wash each well once with 1 mL of DMEM / F-12, collect the remaining cells, and transfer them to a test tube. Centrifuge at 300 g for 5 minutes.

[0105] (4) Remove the supernatant. Resuspend the cells in mTeSR. TM In culture medium. Live cells were counted using trypan blue and a hemocytometer.

[0106] (5) Add 0.5 mL of mTeSR to each well first. TM 1. Culture medium. Use mTeSR according to the cell number requirements of different germ layers. TM 1. Resuspend cells in culture medium and seed them into 24-well plates. (Ectodermal: 400,000 cells / well, Mesodermal: 100,000 cells / well, Endoderm: 400,000 cells / well)

[0107] (7) Place the 24-well plate in a 37°C incubator. Move the culture dish quickly and briefly back and forth and left and right several times to ensure even distribution of cells. Do not disturb the culture dish for 24 hours.

[0108] (8) Differentiate the monolayer culture into three germ layer lineages: The culture medium was removed from the cell culture the following day. Add 1 ml of the corresponding STEMdiff solution to each well. TM Trilayer culture medium. Incubate at 37°C for 24 hours. Repeat this step until day 5 (mesoderm and endoderm lineage) or day 7 (ectoderm lineage).

[0109] (9) Perform immunofluorescence experiments on cells differentiated from the three germ layers using specific markers for ectoderm (PAX6), mesoderm (SOX17), and endoderm (Brachyury). See Table 1 for details of the immunofluorescence antibody information. The immunofluorescence procedure is the same as in 3.1. Figure 5 As shown, the lineage-specific markers (red) (PAX6, SOX17, Brachyury) of the three germ layers of the cells, and the cell nuclei stained with DAPI (blue), indicate that DPNJMUi002-AiPSCs have the ability to differentiate into the three germ layers.

[0110] Table 1 Antibody information obtained from immunofluorescence and flow cytometry analysis.

[0111] Example 5

[0112] Genetic stability and quality control

[0113] 5.1 Chromosome karyotype analysis and STR analysis

[0114] In the 20th generation, such as Figure 6 As shown, chromosome karyotype analysis of hiPSCs was performed using the G-banding method, analyzing at least 20 metaphase cells at a resolution of 300-400 bands. The Nonaplex IPCR amplification kit (Biotype) performs individual STR analysis at 28 independent genomic loci using 2 ng of DNA. Figure 7 As shown, all 28 STR loci are highly congruent, indicating that the cell line and the peripheral blood of the child are of the same biological origin.

[0115] 5.2 Mycoplasma Detection

[0116] The test was performed using a mycoplasma detection kit (ExCell Bio, MB000-1591).

[0117] (1) A few days before the experiment, allow iPSCs to grow to more than 80% in a 24-well culture plate. Discard the culture medium, wash twice with PBS, add 100 μL of lysis buffer, and incubate at room temperature for 5 minutes.

[0118] (2) Collect the cell lysate and place it in a centrifuge tube. Incubate at 95°C for 5 minutes. Centrifuge at 13,000 rpm for 5 minutes and transfer the supernatant to a new centrifuge tube. Use 2 μL of the supernatant as a template for PCR reaction.

[0119] (3) After briefly centrifuging the 8-tube pack containing the pre-added reaction primers and Loading Dyed components provided in the kit, carefully open the pack and add the following reagents in sequence: first, add ddH2O to hydrate the dry powder in the tube, then add the sample, namely the supernatant, positive and negative samples, and finally add the enzyme-containing Mix. Mix the PCR tube thoroughly and centrifuge briefly. Start the reaction under the following conditions: 50℃ for 2 min, 95℃ for 10 min, then 95℃ for 30 sec, 56℃ for 30 sec, 72℃ for 30 sec, for a final cycle of 72℃ for 5 min; take 5 μL of the amplification product and perform direct electrophoresis on a 2% agarose gel. Figure 8 As shown, the cell line is free of mycoplasma contamination.

[0120] The above are merely a few preferred embodiments of the present invention, described in a relatively specific and detailed manner, but they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention.

Claims

1. An induced pluripotent stem cell line carrying an ABCB4 gene mutation, characterized in that, It is deposited at the China Center for Type Culture Collection, accession number CCTCC NO: C2025125.

2. The induced pluripotent stem cell line according to claim 1, characterized in that, The stem cells carry a complex heterozygous mutation of c.992G>A (p.G331E) and c.3152T>C (p.V1051A), express pluripotency markers OCT4, SOX2, NANOG and SSEA4, and have the ability to differentiate into the three germ layers.

3. The induced pluripotent stem cell line according to claim 1, characterized in that, It also includes one or more of the following features: (a) The karyotype of the stem cell line is a normal male karyotype (46,XY); (b) STR analysis confirmed that the stem cell line was a complete match with donor peripheral blood mononuclear cells at 28 genomic loci. (c) After differentiation, it can express the ectoderm marker PAX6, the mesodermal marker Brachyury, and the endoderm marker SOX17.

4. The method for preparing the induced pluripotent stem cell line according to any one of claims 1-3, characterized in that, Includes the following steps: (1) Mononuclear cells (PBMCs) were isolated from peripheral blood of patients with progressive familial intrahepatic cholestasis type 3. (2) Use The -iPS2.0Sendai viral vector reprograms PBMCs, and the vector contains genes encoding SOX2, KLF4 and c-MYC; (3) In Essential 8 TM Pluripotent clones were screened and amplified in the culture medium and maintained in the culture medium coated with Geltrex.

5. The preparation method according to claim 4, characterized in that: In step (1), PBMCs were separated by Ficoll density gradient centrifugation and initially cultured in RPMI 1640 medium containing 10% fetal bovine serum. In step (3), the culture conditions were 37°C and 5% CO2 environment, and 0.5mM EDTA was used to dissociate the cells during passage.

6. The application of the induced pluripotent stem cell line as described in any one of claims 1-3 in constructing an in vitro model of progressive familial intrahepatic cholestasis of disease type 3, characterized in that: The stem cell line was differentiated into hepatocytes or bile duct cells to simulate the pathological phenotypes of abnormal bile acid metabolism and liver fibrosis.

7. The application according to claim 6, characterized in that: The model is used to screen candidate drugs that can alleviate cholestasis, inhibit hepatocellular damage, or slow the progression of liver fibrosis.

8. The application of the induced pluripotent stem cell line as described in any one of claims 1-3 in gene drug research, characterized in that: The ABCB4 gene mutation in the stem cell line was repaired using CRISPR / Cas9 technology to evaluate the phenotypic reversal effect and therapeutic potential.

9. The application according to claim 8, characterized in that: The MDR3 protein function was restored in the hepatocytes that were differentiated after the repair, and the bile phospholipid transport capacity was significantly improved.

10. The application of the induced pluripotent stem cell line according to any one of claims 1-3 in toxicity testing, characterized in that: The mechanism of bile acid toxicity in hepatocytes and the effects of protective compounds were assessed using differentiated cells.

Images