Pgegy3 gene for improving cold resistance and increasing leaf fresh weight of pennisetum and application thereof
By providing the PgEGY3 gene of Napier grass, its recombinant expression vector, and host cells, the problem of insufficient cold resistance of Napier grass was solved, and the effects of improving plant cold resistance and biomass were achieved.
Patent Information
- Application Number
- CN202511589904.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-03
- Publication Date
- 2026-03-27
- Estimated Expiration
- 2045-11-03
AI Technical Summary
The cold resistance of Napier grass is relatively weak, which limits its production, application and efficient utilization. No research has been reported on the role of the EGY3 gene in plant cold resistance.
We provide the PgEGY3 gene of *Pennisetum affine*, its recombinant expression vector, and host cells to enhance the plant's cold resistance and biomass through gene editing technology.
It significantly improved the plant's growth status and leaf fresh weight under cold stress, and enhanced the plant's cold resistance.
Smart Images

Figure CN121046409B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of genetic engineering, and particularly relates to a PgEGY3 gene for improving cold resistance and increasing leaf fresh weight of Pennisetum and application thereof. BACKGROUND
[0002] Low temperature is an important environmental factor affecting plant growth and development, limiting the geographical distribution of many plant species, and is also the main limiting factor of plant productivity in cultivated areas. Therefore, to improve the yield and stability of crops under low temperature conditions, and to enhance the cold resistance of crops have become the focus of current crop genetic improvement and stress physiology research.
[0003] Plants will activate a series of complex response mechanisms under low temperature stress. Previous studies have shown that a large number of differentially expressed genes appear in plants after low temperature stress treatment. These genes are usually enriched in plant hormone signal transduction, oxidation-reduction process, photosynthesis, membrane system protection, and transcription factor regulation pathways. The key pathways and genes are considered to be important candidate regulatory factors involved in plant cold resistance mechanism.
[0004] Pennisetum is one of the most important genera in the Poaceae family. It contains about 140 species and is widely distributed in various ecological environments around the world. Pennisetum has soft grass quality and good palatability, with a dry matter content of up to 21.6%. During the jointing stage, the dry matter contains 14.25% crude protein, 3.51% crude fat, 28.35% crude fiber, 38.21% nitrogen-free extract, and 11.31% ash. Among them, the high crude protein and moderate crude fat and nitrogen-free extract content make it suitable for feeding a variety of animals such as cattle, sheep, pigs, rabbits, and fish. The plant height of this grass species can reach 3-5 meters, with fast growth rate and long vegetative growth period, with an annual growth period of 330 days, allowing for 5-7 times of annual mowing, with a fresh grass yield of more than 205 tons per hectare.
[0005] Pennisetum purpureum is a perennial, clump-forming, large herbaceous plant of the Poaceae family, and is one of the most important forage species and potential energy grasses in the tropics and subtropics of Asia, Africa, and the Americas. As an excellent forage crop, it has an annual yield of up to 150 tons per hectare, and can be harvested at least 4 times a year, and can resist high temperature, drought, low soil fertility, and biological stress.
[0006] Guimin Pennisetum has strong drought resistance and disease resistance, and high sugar content, making it not only an excellent forage resource, but also an ecological pasture for greening barren hills and preventing soil erosion. Currently, this variety has been widely applied in many places in southern China, and has become an important species for returning farmland to grass and developing grass-livestock industry. However, its cold tolerance is generally weak, which is a major factor limiting its production and efficient use. However, to date, there have been few studies on cold-resistant genes of Pennisetum, and its cold resistance mechanism is not clear.
[0007] In recent years, significant progress has been made in the field of plant biology. EGY3, as a metal-dependent endoprotease, belongs to the EGY (ethylene-dependent gravitropism-deficient and yellow-green) family, and plays a key role in regulating plant growth and development and responding to stress.
[0008] Studies have shown that EGY3 gene is closely related to plant response to environmental stress. Real-time PCR results show that within the first few hours of high light and high temperature stress, the expression of EGY3 gene will be sharply up-regulated, and the increase in transcript abundance is related to the protein accumulation level, which indicates that EGY3 is involved in the response of plants to high temperature and high light stress. EGY3 also plays an important role in salt stress, and salt stress and oxidative stress can induce its expression. Loss of EGY3 function makes plants more sensitive to stress, while overexpression of EGY3 enhances the tolerance of plants to salt stress and chloroplast oxidative stress. EGY3 interacts with chloroplast copper / zinc superoxide dismutase 2 (CSD2) and promotes the stability of CSD2 under stress conditions. In egy3-1 mutant plants, stress-induced CSD2 degradation limits the production of hydrogen peroxide in chloroplasts and damages the hydrogen peroxide-mediated retrograde signaling, which is manifested as the decrease in the expression of stress tolerance-related retrograde signaling genes. Exogenous application of hydrogen peroxide (or ascorbate peroxidase inhibitor) and CSD2 overexpression can rescue the hypersensitivity of egy3-1 mutant to salt stress. Therefore, EGY3 enhances the tolerance of plants to salt stress by promoting the stability of CSD2 and chloroplast retrograde signaling mediated by hydrogen peroxide.
[0009] In Arabidopsis, EGY3 was found to affect the formation of thylakoid membranes by participating in the processing of proteins related to chloroplast development and photosynthesis. Its mutants exhibit a yellowing phenotype, suggesting its role in chlorophyll metabolism. In addition, EGY3 may regulate photosystem repair by cleaving specific membrane proteins (such as PSII components), which is crucial for high light stress adaptation. Recent studies have also shown that EGY3 is involved in drought stress response by mediating proteolysis in the abscisic acid (ABA) signaling pathway. Overexpression of the rice homolog OsEGY3 in rice showed enhanced drought tolerance, suggesting its potential value in crop stress tolerance breeding. It was also found that EGY3 has functional redundancy with mitochondrial protease FTSH4, which together maintain cellular redox homeostasis. Proteomic analysis further revealed the substrate preference of EGY3, which tends to cleave target proteins with transmembrane domains. Gene editing techniques such as CRISPR-Cas9 have been used to create wheat egy3 mutants, confirming its impact on grain filling efficiency. In the field of synthetic biology, attempts have been made to couple the EGY3 promoter with a reporter gene for heavy metal pollution biosensing. However, research on EGY3 in plant cold resistance has not been reported. SUMMARY
[0010] To solve the above technical problems, the purpose of the present application is to provide a PgEGY3 gene for improving the cold resistance of Pennisetum and increasing leaf fresh weight and its application.
[0011] The technical solution of the present application to solve the above technical problems is as follows: a Pennisetum PgEGY3 gene is provided, and the nucleotide sequence is shown in SEQ ID NO. 1.
[0012] The present application also provides a protein encoded by the above-mentioned Pennisetum PgEGY3 gene.
[0013] The present application also provides a recombinant expression vector comprising the above-mentioned Pennisetum PgEGY3 gene.
[0014] The present application also provides a recombinant host cell comprising the above-mentioned Pennisetum PgEGY3 gene.
[0015] The present application also provides the application of the above-mentioned Pennisetum PgEGY3 gene, recombinant expression vector or recombinant host cell in improving plant cold resistance and biomass.
[0016] Further, the above-mentioned application is: the Pennisetum PgEGY3 gene, the recombinant expression vector or the recombinant host cell is used in the preparation of the product for improving the plant cold resistance and the biomass.
[0017] Further, the above-mentioned application is: the Pennisetum PgEGY3 gene, the recombinant expression vector or the recombinant host cell is used in the preparation of the plant new variety with high cold resistance.
[0018] Further, the plant is Pennisetum or Arabidopsis.
[0019] The application further provides a reagent for improving cold resistance and biomass of Pennisetum, comprising the Pennisetum PgEGY3 gene, the recombinant expression vector or the recombinant host cell.
[0020] The application has the following beneficial effects:
[0021] The application finds through test verification that the Pennisetum PgEGY3 gene can increase the cold resistance of plants, and overexpression of the PgEGY3 gene significantly improves the growth state of plants under cold stress. BRIEF DESCRIPTION OF DRAWINGS
[0022] Figure 1 is a phylogenetic evolution tree diagram;
[0023] Figure 2 is a PgEGY3 expression change diagram under cold stress induction;
[0024] Figure 3 is a Pennisetum total RNA electrophoresis diagram;
[0025] Figure 4 is a PgEGY3 expression amount comparison diagram in different tissues of Pennisetum;
[0026] Figure 5 is a PgEGY3 gene expression electrophoresis diagram of transgenic Arabidopsis under cold stress;
[0027] Figure 6 is a growth state comparison diagram of Arabidopsis under cold stress;
[0028] Figure 7 is a rosette leaf comparison diagram of Arabidopsis under cold stress;
[0029] Figure 8 is a rosette leaf number statistical result diagram of Arabidopsis under cold stress;
[0030] Figure 9 is a leaf fresh weight statistical result diagram of Arabidopsis under cold stress;
[0031] Figure 10 is a PgEGY3 gene subcellular localization result diagram. DETAILED DESCRIPTION
[0032] The principles and characteristics of the application are described below, and the examples are only used to explain the application and not to limit the scope of the application. If no specific conditions are specified in the examples, conventional conditions or manufacturer's recommended conditions are used. If no manufacturer of the reagent or instrument is specified, it is a conventional product that can be purchased on the market.
[0033] Example 1
[0034] A Pennisetum americanum PgEGY3 gene, the nucleotide sequence of which is shown as SEQ ID NO. 1.
[0035] Test Example 1 Evolutionary analysis Full-length CDS sequences of PgEGY3 homologous genes extracted from the genomes of closely related Miscanthus giganteus were used as templates to design specific primers:
[0036] PgEGY3-f: ACTCCCGCCTTCGCTCCAT (SEQ ID NO. 2)
[0037] PgEGY3-r: TAGATGCCGCCCCTGAAGA (SEQ ID NO. 3).
[0038] The leaf cDNA of the hybrid Pennisetum americanum "Gui Min Yin" was used as a template to clone the full-length CDS sequence of PgEGY3. The PCR product was gel-recovered and purified, and then the product was ligated to a T vector for sequencing to obtain the full-length CDS sequence of PgEGY3 (SEQ ID NO. 1).
[0039] The homologous gene sequences were downloaded for analysis, and a phylogenetic tree was constructed, the results of which are shown in Figure 1 . These genes were divided into three main groups: Class a, Class b, and Class c. PgEGY3 was located in Class b, together with ZmEGY3 and SbEGY3, indicating that they had a relatively close genetic relationship. In Class b, PgEGY3 had a close genetic relationship with the monocotyledonous plants corn (ZmEGY3), rice (OsEGY3), and wheat (TaEGY3), and a relatively distant genetic relationship with the dicotyledonous plants Arabidopsis thaliana (AtEGY3) and tobacco (NaEGY3). Class a included the genes PtEGY1, AtEGY1, NaEGY1, OsEGY1, TaEGY1, and ZmEGY1, while Class c contained the genes PtEGY2, NaEGY2, AtEGY2, TaEGY2, OsEGY2, and ZmEGY2. In summary, PgEGY3 was most closely related to the EGY3 genes in corn (ZmEGY3) and sorghum (SbEGY3) in the phylogenetic tree, which may reflect their common ancestral relationship in the process of plant evolution.
[0040] Test Example 2 Response of PgEGY3 to cold stress
[0041] (1) Cold stress expression pattern analysis
[0042] PgEGY3 expression changes induced by different time were detected by RT-qPCR after cold stress at 4°C, and the results are shown in Fig. 2. The initial induction resulted in a decrease in expression, and a significant up-regulation occurred at 24 h after induction. The expression at 48 h was 11 times that at 0 h, indicating that PgEGY3 responded to long-term cold stress. Figure 2
[0043] (2) PgEGY3 tissue differential analysis
[0044] 1) Extraction of RNA from different tissues of Pennisetum
[0045] Total RNA was extracted from the root, stem, leaf and leaf sheath tissues of 4-week-old Pennisetum using the TIANGEN Plant Total RNA Extraction Kit.
[0046] S1, Preparation of materials before experiment
[0047] Kit components: lysis solution PRL, deproteinization solution PRW, rinse solution PRW1, RNase-Free DNase I, DNase Buffer, RNase-Free RNA adsorption column (FlaPure RNA Columns), collection tube (2 mL).
[0048] Self-prepared reagents: β-mercaptoethanol, anhydrous ethanol (DEPC treated), RNase-Free ddH2O.
[0049] Consumables: RNase-free centrifuge tubes, mortar, liquid nitrogen, pipette tips (RNase-Free), vortex shaker, centrifuge (4°C).
[0050] S2, Sample processing
[0051] Sample collection: Fresh root, stem, leaf and leaf sheath tissues of 4-week-old Pennisetum were selected, each about 50-100 mg, immediately frozen in liquid nitrogen and transferred to -80°C for storage.
[0052] Grinding: Fresh or frozen tissues were ground into powder in liquid nitrogen (avoid repeated thawing, the whole process should be operated on ice or in a low temperature environment).
[0053] S3, RNA extraction:
[0054] Sample lysis: The ground powder was transferred to a pre-cooled 1.5 mL centrifuge tube, and 600 μL of lysis solution PRL (β-mercaptoethanol was added to a final concentration of 1% before use) was added; vortex for 30 seconds to mix evenly, and stand at room temperature for 5 minutes to allow the nucleic acid-protein complex to dissociate completely; centrifuge at 12000 g for 2 minutes at 4°C, and transfer the supernatant to a new tube.
[0055] Filtering and deproteinization: The supernatant was transferred to a filter column (Shredder Spin Column) and loaded into a 2 mL collection tube, and centrifuged at 12000 g for 2 minutes to collect the filtrate; 0.5 times the volume of anhydrous ethanol (about 300 μL) was added to the filtrate, mixed and transferred to an adsorption column (FlaPure RNA Column), centrifuged at 12000 g for 1 minute, and the filtrate was discarded. Repeat this step to ensure that all the filtrate passes through the adsorption column.
[0056] Genomic DNA removal: Add 500 μL of deproteinization solution PRW to the adsorption column, centrifuge at 10000 g for 10 seconds, and discard the waste liquid; prepare a DNase I working solution (10 μL DNase I + 60 μL DNase Buffer), mix and add to the center of the adsorption column membrane, and incubate at room temperature for 15 minutes; add 500 μL of deproteinization solution PRW, centrifuge at 10000 g for 1 minute, and discard the waste liquid.
[0057] Washing and purification: Add 500 μL of rinse solution PRW1 (with pre-added anhydrous ethanol) to the adsorption column, stand for 2 minutes, then centrifuge at 10000 g for 1 minute, and discard the waste liquid; repeat this step 1 to ensure that the residual rinse solution is completely removed.
[0058] Drying: Centrifuge at 13000 g for 2 minutes, open the cap and stand at room temperature for 5 minutes to remove the residual ethanol in the column.
[0059] RNA elution: Transfer the adsorption column to a new centrifuge tube, add 50-100 μL of RNase-Free ddH2O to the center of the membrane, and stand at room temperature for 5 minutes; then centrifuge at 12,000 x g for 2 minutes to collect the RNA solution (about 50 μL in volume); and perform RNA concentration determination, the results are shown in Table 1.
[0060] Table 1 RNA concentration table
[0061] Tissue RNA concentration ng / μL Root 288 Stem 1840 Leaf 208 Sheath 336
[0062] RNA quality detection by agarose gel electrophoresis: prepare a 1% agarose gel with gloves, heat and melt in a microwave oven, then add 0.5 μg / mL ethidium bromide, mix well, pour the plate, insert the comb, cool at room temperature (about 30 minutes) for standby; take 1 μL of RNA sample and DL2000 nucleic acid ladder for co-running, voltage 180 V, 15 minutes. The results are shown in Figure 3 Figure 1, wherein Marker is a molecular weight standard reference. The results show that no DNA band (high molecular weight is obviously tailing) appears, which can be used for subsequent quantitative analysis.
[0063] 2) RNA reverse transcription to cDNA
[0064] Reverse transcription of total RNA from different tissues to cDNA for subsequent quantitative analysis.
[0065] Experimental materials:
[0066] Kit components: 5× gDNA wiper Mix, 10× RT Mix, HiScript III Enzyme Mix, Oligo(dT)20VN primer, Random hexamers primer, RNase-Free ddH2O.
[0067] Self-prepared reagents: RNase-free centrifuge tube, ice box, micropipette (RNase-free tip), transient centrifuge, PCR instrument.
[0068] Reverse transcription experimental steps:
[0069] S1, RNA template pretreatment
[0070] Add the following ingredients (calculated according to a single sample) to the RNase-free centrifuge tube according to Table 2:
[0071] Table 2 RNA dosage table
[0072] Tissue RNA concentration ng / μL Reverse transcription volume μL Water volume μL Root 288 3.47 4.53 Stem 1840 0.54 7.46 Leaf 208 4.81 3.19 Sheath 336 2.98 5.02
[0073] Denaturation treatment: heat at 65°C for 5 minutes, quickly place on ice for 2 minutes (destroy the secondary structure of RNA, improve the reverse transcription efficiency).
[0074] S2, genomic DNA removal
[0075] Add 2 μL of 5× gDNA wiper Mix to the pretreated RNA, mix gently, and incubate at 42°C for 2 minutes on a PCR instrument, and then perform transient centrifugation (10 seconds).
[0076] S3, reverse transcription reaction system preparation
[0077] Add the ingredients in the following order (total volume 20 μL): 10 μL of the mixture from the previous step; 2 μL of 10x RT Mix; 2 μL of HiScript III Enzyme Mix; 1 μL of Oligo(dT)20VN primer (50 μM); 1 μL of Random hexamers primer (50 μM); RNase-Free ddH2O to 20 μL
[0078] Mix and aliquot: mix by flicking the tube wall to avoid bubbles, and aliquot into ice-precooled centrifuge tubes.
[0079] S4, Reverse transcription reaction
[0080] First stage: transfer the reaction system to the PCR instrument, and incubate at 37°C for 10 minutes (primer annealing and enzyme activation).
[0081] Second stage: adjust the temperature to 50°C, and incubate for 45 minutes (cDNA synthesis).
[0082] Stop the reaction: heat at 95°C for 5 minutes (inactivate reverse transcriptase).
[0083] Dilute the cDNA 10-fold with deionized water, and aliquot to -20°C (for short-term use) or store the stock solution at -80°C (for long-term storage), avoiding repeated freeze-thaw cycles.
[0084] 3) RT-qPCR primer identification
[0085] S1, Primer design 188bp
[0086] qEGY3f: GTCGGTGCTGCTGGGTTTGG Tm 65.8 (SEQ ID NO. 4)
[0087] qEGY3r: CGTTGGGGAAGAGCGTGAGG Tm 65.0 (SEQ ID NO. 5)
[0088] S2, Primer identification
[0089] The PCR system is shown in Table 3.
[0090] Table 3 Primer identification PCR system table
[0091] Reagent Volume PCR mix 10 μL qEGY3f 1 μL qEGY3r 1 μL Leaf cDNA template 2 μL Deionized water 6 μL Total volume 20 μL
[0092] The PCR program is: 95°C for 5 min; 95°C for 30 s, 60°C for 30 s, 40 cycles; 4°C storage.
[0093] S3, Agarose gel electrophoresis
[0094] 1% agarose gel electrophoresis (180V 20min) showed that the PCR amplification products of primers qEGY3f and qEGY3r using leaf cDNA as a template had a clear band at 200bp, with no extraneous bands, and the length was consistent with the primer design of 188bp. Furthermore, no obvious primer dimers were observed in the negative control, indicating that this primer pair can specifically amplify the PgEGY3 gene and can be used for quantitative analysis of this gene.
[0095] 4) Tissue-specific RT-qPCR
[0096] Reagent: Novizan RT-qPCR quantitative reagent (sybrgreen).
[0097] PCR system: Refer to the primers above to identify the PCR system (Table 3, with different templates).
[0098] PCR program: 95℃ for 3 min; 95℃ for 10 s, 60℃ for 30 s, 72℃ for 15 s, 40 cycles; 65-95℃, fluorescence collected every 0.5℃.
[0099] The expression of PgEGY3 in different tissues is as follows: Figure 4 As shown.
[0100] The results showed that the expression level of the PgEGY3 gene was significantly higher in leaves than in other tissues. This suggests that the gene has an important function in leaves and is speculated to play a key role in photosynthesis or other leaf-specific physiological processes.
[0101] Experimental Example 3: Genetic Transformation
[0102] 1) Promoter cloning
[0103] S1, Primer Design
[0104] Using the genome sequence of Giant Napier Pgi02B00009620 (SEQ ID NO.6) as a reference template, promoter amplification primers for the PgEGY3 gene were designed:
[0105] proEGY3f1:GTTCTTGGGTAAAAGTTGGTA (SEQ ID NO.7)
[0106] proEGY3r1: TGCAGCGATCGCCTAGCTACCG (SEQ ID NO.8)
[0107] S2, crude extraction of genomic DNA
[0108] Reagents and consumables:
[0109] Tris Tris(hydroxymethyl)aminomethane; (HOCH2)3CNH2 Molecular weight 121.14; LiCl Lithium chloride Molecular weight 42.39; EDTA Ethylenediaminetetraacetic acid C 10 H 16 N2O8 Molecular weight 292.24; SDS (Sodium dodecyl sulfate), Molecular weight 288.379; Isopropanol; 1.5 mL centrifuge tube; Grinding rod.
[0110] Extract preparation: as shown in Table 4.
[0111] Table 4 Extract preparation table
[0112] Reagent Volume 1 M Tris, pH 9.0 20 mL 2 M LiCl 20 mL 0.5 M EDTA, pH 8.0 5 mL 20% SDS 5 mL Deionized water 50 mL Total volume 100 mL
[0113] Genomic DNA extraction:
[0114] Grind the leaf tissue in an eppendorf tube with 200 μL DNA extraction buffer, green juice appears; centrifuge in a microfuge at 12000 rpm for 5 minutes; carefully transfer 150 μL supernatant to a new tube and add 150 μL isopropanol and mix well; centrifuge at 12000 rpm for 10 minutes; carefully discard the supernatant and invert the tube to dry on a paper towel in a fume hood for 30 minutes; add 30 μL ddH2O to resuspend the DNA pellet.
[0115] S3, Promoter PCR amplification
[0116] PCR amplification using proEGY3f1 + proEGY3r1 primers with Pennisetum alopecuroides genomic DNA as template
[0117] PCR system: as shown in Table 5.
[0118] Table 5 Promoter PCR amplification system table
[0119] Reagent Volume HiFi PCR mix 15 μL proEGY3fl 1 μL proEGY3rl 1 μL Genomic DNA template 1 μL Deionized water 12 μL Total volume 30 μL
[0120] Program: 95℃ 5 min; 95℃ 30 s, 55℃ 30 s, 72℃ 2 min, 27 cycles; 4℃ storage.
[0121] Electrophoresis: 1% agarose gel electrophoresis for 15 min.
[0122] 2) T-vector ligation
[0123] The band at 2200 bp was cut in a 1.5 mL centrifuge tube; 200 μL of GSB sol solution (full gold) was added to the centrifuge tube; the centrifuge tube was placed in a 55°C water bath for sol 15 min; after cooling to room temperature, the melted gel solution was added to the centrifugal column and left for 2 min; centrifugation was performed at 12000 rpm for 1 min, and the liquid was discarded; 25 μL of deionized water was added to the centrifugal column, left for 2 min, and centrifuged at 12000 rpm for 2 min to obtain the washing liquid; the ligation system was prepared according to Table 6, and ligation was performed using a PCR instrument at 25°C for 10 min.
[0124] Table 6 Ligation system table
[0125] Reagent Volume 2x T vector buffer 5 μL PCR reaction 2 μL T vector 1 μL Deionized water 2 μL Total volume 10 μL
[0126] 3) Transformation of E. coli competent cells
[0127] 50 μL of competent cells were thawed on an ice box; the ligation product was added to the competent cells, and the mixture was mixed by flicking; the competent cells were incubated in the ice box for 30 min; then heat shock was performed in a 42°C water bath for 30 s, and ice bath was performed for 2 min; 500 μL of LB liquid medium was added, and the competent cells were cultured at 37°C on a shaker for 1 h; the competent cells were taken out, centrifuged at 12000 rpm for 1 min to collect the bacterial cells; the supernatant was discarded, and the remaining LB culture medium was discarded; the bottom bacterial cells were mixed by blowing and sucking, and then LB solid medium (containing Amp, 100 mg / L) was coated; the plate was incubated at 37°C for overnight culture (about 15 h), and single colony colonies were grown.
[0128] The primer proEGY3f1+ proEGY3r1 was used for PCR positive identification of the bacterial solution, and the bacterial solution with correct electrophoresis bands was selected; after amplification using the universal primers M13F and M13R, the bacterial solution was sent to Shengong Biotechnology Company for sequencing; the promoter sequence is shown in SEQ ID NO. 9.
[0129] 4) Promoter ligation pCAMBIA1381 expression vector
[0130] S1, primer design
[0131] According to the promoter sequence, a primer with an EcoR I enzyme digestion site was designed:
[0132] 1381EGY-f (SEQ ID NO. 10):
[0133] TTGGGCCCGGCGCGCCGAATTCGTTCTTGGGTAAAAGT
[0134] 1381EGY-r (SEQ ID NO. 11):
[0135] ACGTAAACTAGTCAGATCTACCATTGGAGACGAGCTGTGAAG
[0136] S2, using Tian Gen rapid plasmid extraction kit to extract plasmid:
[0137] Inoculate 100 μL positive bacteria liquid in 10 mL LB liquid medium (containing 100 mg / L Amp); 37℃ shaking table 200 rpm culture 12 h; take 1-4 mL overnight culture bacteria liquid, 12,000 rpm centrifugal 1 min, suck the supernatant; add 150 μL solution P1 (containing RNase A and TIANRed indicator), blow and mix the bacteria; add 150 μL solution P2, gently invert 6-8 times until the solution becomes clear (TIANRed indicates the degree of lysis), lysis at room temperature for 5 min; add 350 μL solution P5, mix quickly and then centrifuge at 12000 rpm for 10 min, collect the supernatant; transfer the supernatant to the adsorption column CP3, centrifuge at 12000 rpm for 2 min to remove impurities; add eluent to the adsorption column CP2, centrifuge at 12000 rpm for 2 min, discard the eluent; wash the CP2 adsorption column with 500 μL rinse PWT (containing anhydrous ethanol) twice, centrifuge at 12000 rpm for 2 min, discard the eluent; add 30 μL elution buffer EB (65℃ preheated), centrifuge after standing at room temperature for 3 min, collect T-PgEGY3 pro plasmid.
[0138] S2, PCR amplification and recovery of promoter
[0139] PCR system: as shown in Table 7.
[0140] Table 7 Amplification and recovery of promoter PCR system
[0141] Reagent Volume M5 PCR mix 15 μL 1381EGY-f 2 μL 1381EGY-r 2 μL T-PgEGY3 plasmid 1 μL Deionized water 3.5 μL Total volume 10 μL
[0142] PCR program: 95℃ 5 min; 95℃ 30 s, 55℃ 30 s, 72℃ 2 min, 30 cycles; 4℃ storage.
[0143] 1% agarose gel electrophoresis, and gel recovery.
[0144] S3, pCAMBIA1381 vector digestion
[0145] The enzyme digestion system is shown in Table 8.
[0146] Table 8 Enzyme digestion system
[0147] Reagent Volume Quick cut buffer 3 μL EcoR I 1 μL pCAMBIA 1381 plasmid 1 μL (500 ng) Deionized water 25 μL Total 30 μL
[0148] Enzymatic digestion procedure: 37℃ for 30 min; 65℃ for 30 min; 4℃ storage.
[0149] The amplified promoter was connected with the linearized vector, and the connection system is shown in Table 9. The PCR instrument was controlled at 50℃ for 30 min, and then stored at 4℃.
[0150] Table 9 Connection system table of promoter and linearized vector
[0151] Reagent Volume Seamless cloning enzyme 3 μL Promoter fragment 2 μL pCAMBIA 1381 linearized plasmid 1 μL Total 6 μL
[0152] S4, transformation of E. coli competent cells with connection products
[0153] Take 50 μL of competent cells and melt on an ice box. Add all the connection products to the competent cells, and mix by flicking. Insert the competent cells into the ice box and incubate for 30 min. Then heat shock in a water bath at 42℃ for 30 s, and then in an ice bath for 2 min. Add 500 μL of LB liquid medium, and shake culture at 37℃ for 1 h. Take out the competent cells, centrifuge at 12000 rpm for 1 min to collect the bacterial bodies. Pick single colonies into sterilized centrifuge tubes, and add LB liquid medium (containing 50 mg / L of kan). Place the centrifuge tubes in a 37℃ shaking bed, and culture at a rotation speed of 200 rpm for 12 h. Discard the supernatant LB culture medium, mix the bacterial bodies at the bottom by blowing and sucking, and then spread on LB solid culture medium (containing kan, 50 mg / L). Place the plate in a 37℃ culture room for overnight culture (about 15 h), until single colonies grow.
[0154] S5, positive clone identification by bacterial liquid PCR
[0155] The bacterial liquid was amplified by using 1381EGY-f and gus-r primers, and the amplification system is shown in Table 10.
[0156] Table 10 PCR system table for positive identification of E. coli
[0157] Reagent Volume M5 PCR mix 5 μL 1381EGY-f 0.25 μL gus-r 0.25 μL Bacterial solution 1 μL Deionized water 3.5 μL Total volume 10 μL
[0158] Program: 95℃ for 5 min; 95℃ for 30 s, 55℃ for 30 s, 72℃ for 2 min, 30 cycles; 4℃ storage.
[0159] The plasmid was extracted from the bacterial liquid with correct bands, and sequenced by using the sequencing primer gus-r. The sequencing result comparison and analysis showed that the connection was successful.
[0160] 5) Expression vector construction and genetic transformation of Arabidopsis thaliana
[0161] The positive bacteria liquid in S5 was cultured using LB liquid medium, and the plasmid was extracted. The plasmid was linearized by using restriction enzyme NcoI. The primer (Homo-f and Homo-r) was used to amplify the full-length CDS sequence of PgEGY3 gene.
[0162] Homo-f: AGCTTCACAGCTCGTCTCCAATGGCGTCTGCTTCGCT (SEQ ID NO. 12)
[0163] Homo-r: TAAACTAGTCAGATCTACCATGATGCCGCCCCTGAAGAA (SEQ ID NO. 13)
[0164] The PgEGY3 gene was connected to the expression vector by using a seamless cloning kit. The plasmid with correct sequencing was transformed into Agrobacterium (GV3101) for subsequent genetic transformation of Arabidopsis. The genetic transformation of Arabidopsis was performed by using the inflorescence dip method, and the steps were as follows:
[0165] Two days before transformation, Agrobacterium containing the binary vector of PgEGY3 gene was inoculated into 3 mL of LB liquid medium containing antibiotics (rifampicin 50 mg / L, kanamycin 50 mg / L) and cultured at 28°C for 12 hours. 2 mL of cultured Agrobacterium was transferred to 100 mL of LB liquid medium containing antibiotics, and the culture was continued at 28°C for about 8 hours. The Agrobacterium was transferred to a 50 mL centrifuge tube, centrifuged at 6000 rpm / min and room temperature for 10 minutes, and then the supernatant was poured out. The precipitate was resuspended with the dipping liquid (5% sucrose solution, adding 0.01% Silwet L-77) to form a uniform Agrobacterium suspension (OD600=0.8), and the Agrobacterium suspension was transferred to a sterile culture dish. Healthy Arabidopsis plants were selected, and the open flowers and pods were cut off. The inflorescence was immersed in the container containing the Agrobacterium suspension for 3 min. After dipping, the Arabidopsis was placed in a dark box and water was sprinkled to maintain humidity. The Arabidopsis was cultured in the dark for 12 hours. The Arabidopsis plants were transferred to a light condition at 22-25°C for normal culture until flowering and seed setting. The mature seeds were collected and sown on 1 / 2MS medium containing 30 mg / L hygromycin for positive transgenic Arabidopsis screening, and transgenic Arabidopsis OE7, OE10 and OE11 were obtained.
[0166] 6) Arabidopsis culture
[0167] S1, Arabidopsis seed disinfection
[0168] Sterilize the centrifuge tube, gun head, culture dish and other consumables; take a certain amount of seeds into a 1.5 mL centrifuge tube, add 1 mL of sterile water, and store in a 4°C refrigerator for 3 days (to promote germination synchronicity); discard the sterile water, add 1 mL of 75% ethanol, shake for 1 minute, and immediately discard the ethanol (to avoid damage to the seeds caused by residual alcohol); add 1 mL of 10% sodium hypochlorite (containing 0.1% Triton X-100 to enhance permeability), shake for 10 minutes, and shake every 2 minutes during the process; discard the sodium hypochlorite and wash with sterile water 8 times, and discard the water after each washing.
[0169] S2, seeding
[0170] Prepare and sterilize the culture medium (0.8% agar + 1 / 2 MS medium, pH 5.7); pour the melted culture medium into a culture dish (about 0.5 cm thick), and cool and solidify; use a sterile gun head to suck the seed suspension and evenly sow it on the surface of the culture medium (about 40 seeds per dish); seal the culture dish with a sealing film and label the experimental information.
[0171] S3, germination and transplantation
[0172] Transfer the culture dish to a light incubator: 22±1°C, 16 h light / 8 h dark, and observe the germination after 7 days of culture. When the seedlings grow 2 true leaves, transplant them into the soil, seal with a plastic wrap to keep them moist, and transfer them to a greenhouse for further culture for one week.
[0173] After one week, the Arabidopsis thaliana without PgEGY3 gene (CK) and the Arabidopsis thaliana overexpressing PgEGY3 gene (OE7, OE10 and OE11) are cultured under 4°C cold stress conditions, and the PgEGY3 gene expression and phenotype changes of the Arabidopsis thaliana are compared, as shown in Figure 5-8 .
[0174] Figure 5 The PgEGY3 gene expression of the transgenic Arabidopsis thaliana under 4°C low temperature conditions is shown, and the results show that it is significantly expressed under cold treatment conditions.
[0175] Figure 6 The growth status of the Arabidopsis thaliana under 4°C low temperature conditions is shown, and the growth status of the transgenic Arabidopsis thaliana is stronger than that of the control group.
[0176] Figure 7 The rosette leaf diagram comparison of the cold stress treated Arabidopsis thaliana is shown.
[0177] Figure 8 The rosette leaf number of the Arabidopsis thaliana under 4°C low temperature treatment conditions is shown, and the results show that the rosette leaf number of the transgenic Arabidopsis thaliana is more than that of the control group.
[0178] Figure 9The fresh weight of Arabidopsis under 4℃ low temperature treatment condition is shown, and the results show that the fresh weight of the transgenic Arabidopsis overexpressing the PgEGY3 gene is significantly increased compared with the control group under cold stress.
[0179] Test Example 4 Subcellular localization
[0180] Tobacco seeds are sowed in flowerpots and grown to 5 leaves (about 4-5 weeks) under the conditions of 14 h light / 10 h darkness, temperature 25 °C, and relative humidity 60%-70%. The PgEGY3 full-length CDS sequence is connected to the pSmRY-YFP vector to obtain a 35S::PgEGY3-YFP fusion expression vector, which is introduced into Agrobacterium (GV3101). The Agrobacterium monoclonal transformed with the expression plasmid is picked and cultured in 2 mL of LB liquid medium containing the corresponding antibiotic at 28 °C and 200 rpm overnight. 1 mL of the overnight cultured Agrobacterium bacterial solution is transferred to 20 mL of LB medium containing the corresponding antibiotic, and cultured at 28 °C and 200 rpm until the Agrobacterium grows to the logarithmic phase (OD600 = 0.6-0.8). The bacteria are collected by centrifugation at room temperature and 5,000 rpm for 10 min, and the Agrobacterium bacteria are suspended in a soaking solution (containing 10 mM MgCl2, 10 mM MES, 150 μM acetyl-syringone, pH = 5.6) to OD600 = 1.0. The solution is left to stand at room temperature for 2 h, and the tobacco leaves are injected. The injected plants are placed in darkness for 12 h, and then normally cultured in the greenhouse for 48 h. The yellow fluorescence signal of the region of the tobacco leaf injected with Agrobacterium is photographed using a laser confocal microscope. The results of the subcellular localization test of the PgEGY3 gene are shown in Figure 10 The results show that the gene may be subcellularly localized to the cell membrane and present in a discontinuous manner.
[0181] The above merely provides the preferred embodiments of the present application and is not intended to limit the present application. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present application shall fall within the scope of the present application.
Claims
1. Use of a Pennisetum giganteum PgEGY3 gene, a recombinant expression vector comprising the Pennisetum giganteum PgEGY3 gene or a recombinant host cell comprising the Pennisetum giganteum PgEGY3 gene in improving cold resistance and biomass of a plant, wherein the nucleotide sequence of the Pennisetum giganteum PgEGY3 gene is shown as SEQ ID NO. 1; the plant is Arabidopsis thaliana or Pennisetum giganteum; and the cold resistance and biomass of the plant are improved by overexpressing the Pennisetum giganteum PgEGY3 gene.
2. Use according to claim 1, wherein the Pennisetum giganteum PgEGY3 gene, the recombinant expression vector or the recombinant host cell is used in the preparation of a product for improving cold resistance and biomass of a plant; the plant is Arabidopsis thaliana or Pennisetum giganteum; and the cold resistance and biomass of the plant are improved by overexpressing the Pennisetum giganteum PgEGY3 gene.