Preparation method of therapeutic RNA platelet carrier

Abstract

The invention relates to a method for preparing a therapeutic RNA platelet carrier. The method comprises at least the following steps: transducing at least one therapeutic RNA sequence together with at least one therapeutic RNA packaging sequence comprising an RNA binding protein sequence to a megakaryocyte progenitor cell and / or a hematopoietic stem and progenitor cell expressing CD34, using a DNA-based vehicle; the present invention relates to a therapeutic RNA sequence and / or packaging sequence encoding at least one therapeutic RNA product in a megakaryocyte (e.g., HSPC), an immature megakaryocyte, and / or a megakaryocyte; activating expression of the therapeutic RNA sequence and / or the therapeutic RNA packaging sequence; and generating platelets from a mature megakaryocyte derived from a transduced progenitor cell of the megakaryocyte and / or a transduced hematopoietic stem and progenitor cell (HSPC) expressing CD34 and / or a transduced immature megakaryocyte and / or a transduced megakaryocyte, wherein the expression activation step is regulated to occur during megakaryocyte maturation and / or platelet formation wherein the generated platelet carrier is functionally reactive to activation with a specific agonist wherein the generated platelet carrier is activated by an extracellular signal, and wherein the expression activation step is regulated to occur during megakaryocyte maturation and / or platelet formation. And wherein the platelet carrier produced contains the at least one therapeutic RNA product. The invention also relates to a therapeutic RNA platelet carrier engineered by the above method and its therapeutic use. In addition, the present invention relates to a pharmaceutical composition comprising an RNA platelet carrier engineered by the above method and therapeutic uses thereof.

Description

TECHNICAL FIELD

[0001] The present invention belongs to the biotechnological field of preparing RNA platelet carriers, in particular for therapeutic purposes.

[0002] The present invention provides a method for preparing a therapeutic RNA platelet carrier, which is capable of safe delivery of a therapeutic RNA sequence to a specific target tissue and / or cell of a patient in need thereof, in particular for the treatment of a disease, such as cancer, acute inflammation, chronic inflammation, liver disease, bleeding disorders and / or coagulation disorders.

[0003] The present invention also provides a therapeutic RNA platelet carrier engineered by the above-mentioned method and its therapeutic use.

[0004] In addition, the present invention provides a pharmaceutical composition comprising a therapeutic RNA platelet carrier engineered by the above-mentioned method and its therapeutic use. BACKGROUND

[0005] The delivery of pharmaceutical compounds, also referred to as therapeutic compounds or therapeutic products, to specific cells, tissues or organs in a patient’s body has been a challenge until now.

[0006] Plasmids, antisense oligonucleotides (ASOs) and novel drug modalities, such as small interfering RNAs (siRNAs) and microRNAs (miRNAs), gene editing guide RNAs (gRNAs), long non-coding RNAs (lncRNAs) and small activating RNAs (saRNAs), have promising potential for use in the treatment of many pathological conditions, but still face the challenge of delivery to the target human tissue and / or cell.

[0007] In addition to the challenges of administration, plasma half-life and proper distribution to the pharmacological target, these compounds have biological activity, so that the therapeutic dose has to be limited to avoid toxicity and off-target effects.

[0008] New drug delivery systems, such as lipid nanoparticles or exosomes, suffer from the same problems in terms of intrinsic toxicity, systemic distribution and manufacturing challenges.

[0009] Therefore, safe targeted drug delivery remains a challenge.

[0010] With the emergence of new drug modalities and new target classes, safe tissue-specific delivery becomes of utmost importance.

[0011] Platelets are small anucleate cells that circulate in the blood and participate in hemostasis.

[0012] Platelets have been proposed as carriers for the delivery of therapeutic agents to target sites of interest in a patient’s body for disease treatment.

[0013] Platelets are only able to release their cargo upon activation, which is protected by their intracellular granules, such as alpha-granules, dense granules and lysosomes. Each granule contains a corresponding different cargo with different biogenesis. Moreover, platelets produce microparticles upon strong activation (Burnier et al., 2009). These microparticles include exosomes and ectosomes and their cargo and formation mechanism are different. Circulating platelets are recruited in inflamed blood vessels, where they are activated and release granular and / or microparticulate content. In summary, platelets have a complete machinery to deliver their cargo at a very specific target site, such as an inflamed or bleeding site.

[0014] Therefore, the use of functional platelets for the delivery of therapeutic agents is ingenious and allows a controlled target-specific release of therapeutic agents at the site of interest.

[0015] Passive loading of therapeutic agents inside or on the surface of platelets requires specific cell culture media and processes to induce or force loading, which often compromises the quality of the loaded therapeutic agents and the platelets themselves.

[0016] Low quality platelets result in lower platelet activation, which in turn results in lower granular and microvesicular release. Therefore, the cargo loaded into the intracellular compartments will not be successfully released.

[0017] WO2020 / 006539A1 discloses a method for preparing drug-loaded platelets, wherein platelets are treated with a drug and a loading buffer. This means that platelets are passively loaded, with the risk of compromising their functionality.

[0018] WO2021231990A1 discloses a method for preparing engineered megakaryocytes or progenitor cells with reduced thrombogenic potential and / or preparing platelets with reduced thrombogenic potential by deleting at least one gene involved in the recognition of the primary stimulus of thrombus formation and the secondary mediator of thrombus formation and the release of the secondary mediator of thrombus formation. In this context, the manipulation of membrane proteins can cause unpredictable changes in the behavior and physics of the cell membrane due to changes in the lipid composition (Meyer, Venturoli and Smit, 2008; van Uitert, Le Gac and van den Berg, 2010; Parton, Klingelhoefer and Sansom, 2011; Dunton et al., 2014; Fowler et al., 2016). Moreover, the inhibition of the thrombotic potential of platelets can result in a decrease in the physiological activation of platelets at the site of inflammation.

[0019] An important aspect that remains unsolved is how to implement an efficient loading of therapeutic RNA into platelet vesicles.

[0020] To date, several RNA binding proteins have been described to localize within the vesicle (Table 1).

[0021] Thus, the RNA binding protein will recognize a specific sequence within the RNA and will anchor the RNA to the vesicle.

[0022] While platelets can be activated in the presence of specific agonists, this response can be improved using wild-type activating receptors and modulated to improve activation in situ.

[0023] The Triggering Receptor Expressed on Myeloid Cells (TREM) family is a family of immune receptors widely expressed on myeloid cells and encoded in a cluster of genes at chromosome 6p21.1, including NCR2 (encoding NKp44), TREM1, TREML4 (encoding TREM-like 4), TREML2, TREM2 and TREML1.

[0024] TREML1, also known as TLT-1, is expressed exclusively in platelets and megakaryocytes (Coxon, Geer and Senis, 2017) and localizes to alpha-granules (Washington et al., 2004; Smith et al., 2018).

[0025] Upon platelet activation, TREML1 surface expression rapidly increases (Smith et al., 2018).

[0026] TREML1 binds to fibrinogen and thus is involved in platelet aggregation (Washington et al., 2009). TREML1 does not associate with DAP12, but has an extended cytoplasmic domain containing two tyrosine-based motifs similar to immunoreceptor-based inhibitory motifs (Washington, Quigley and McVicar, 2002).

[0027] One motif recruits the protein tyrosine phosphatase SHP2 (Barrow et al., 2004), which can mediate activation or inhibition depending on the context. In the case of TREML1, recruitment of SHP2 is associated with intracellular calcium release.

[0028] The transmembrane protein family Notch mediates both cell-cell interactions and extracellular signaling within the cell.

[0029] There are four NOTCH receptors (NOTCH1-4) that are highly homologous in structure and between species.

[0030] The NOTCH protein consists of an extracellular cell domain (ECD); epidermal growth factor (EGF)-like repeat sequences that bind to ligands; and an intracellular domain (ICD) containing one RBP-Jkappa-associated modular domain (RAM) and seven ankyrin repeats necessary for signal transduction, two nuclear localization signals (NLS), a transactivation domain, and a proline-glutamate-serine-threonine (PEST)-rich domain that regulates NOTCH stability.

[0031] In platelets, NOTCH1 is expressed on the surface and upon thrombin activation, an activation cascade occurs, including extracellular vesicle secretion through the PI3K-AKT pathway (Chaurasia et al., 2022). SUMMARY

[0032] In view of the above, it is an object of the present application to provide a method for preparing a therapeutic RNA platelet carrier which allows to obtain a therapeutic RNA platelet carrier capable of delivering a target-specific therapy to a target site (e.g. a cell and / or tissue) in a patient in need thereof, while protecting the therapeutic RNA sequence from degradation or inhibition, and avoiding passive loading of the therapeutic RNA by platelets.

[0033] The object is solved according to the present application by the method of claim 1.

[0034] The present application provides a method for preparing a therapeutic RNA platelet carrier, the method comprising at least the following steps: - S1 : transducing at least one therapeutic RNA sequence together with at least one therapeutic RNA packaging sequence comprising a sequence of an RNA binding protein into progenitor cells of megakaryocytes and / or hematopoietic stem and progenitor cells (HSPC) expressing CD34, immature megakaryocytes, and / or megakaryocytes using a DNA-based vector, the therapeutic RNA sequence and / or packaging sequence encoding at least one therapeutic RNA product; - S2: activating the expression of the therapeutic RNA sequence and / or the therapeutic RNA packaging sequence, and - S3: producing platelets from mature megakaryocytes derived from the transduced progenitor cells of megakaryocytes and / or transduced hematopoietic stem and progenitor cells (HSPC) expressing CD34, and / or transduced immature megakaryocytes and / or transduced megakaryocytes, wherein the expression activation step is regulated to occur during maturation of megakaryocytes and / or platelet formation; wherein the generated platelet carriers are functionally reactive to activation with a specific agonist; wherein the generated platelet carriers are activated by an extracellular signal, and wherein the generated platelet carriers contain the at least one therapeutic RNA product.

[0035] The present application provides a method for preparing therapeutic RNA platelet carriers.

[0036] In particular, the therapeutic RNA platelet carriers engineered by the method can be used for the treatment, preferably target-specific treatment, of diseases such as cancer, acute inflammation, chronic inflammation, bleeding disorders, coagulation disorders, and / or liver diseases.

[0037] In addition, the therapeutic RNA platelet carriers engineered by the method of the present application can be used for the preparation of a pharmaceutical composition for the treatment, preferably target-specific treatment, of diseases such as cancer, acute inflammation, chronic inflammation, bleeding disorders, coagulation disorders, and / or liver diseases.

[0038] The method comprises a first step of transducing at least one therapeutic RNA sequence together with at least one therapeutic RNA packaging sequence comprising an RNA-binding protein sequence into progenitor cells of megakaryocytes and / or CD34-expressing hematopoietic stem and progenitor cells (HSPC), immature megakaryocytes, and / or megakaryocytes using a DNA-based vector, the therapeutic RNA sequence and / or packaging sequence encoding at least one therapeutic RNA product.

[0039] In addition, the method comprises a second step of activating the expression of the therapeutic RNA sequence and / or the therapeutic RNA packaging sequence.

[0040] Further, the method comprises a third step of generating platelets from mature megakaryocytes derived from the transduced progenitor cells of megakaryocytes and / or the transduced CD34-expressing hematopoietic stem and progenitor cells (HSPC), and / or the transduced immature megakaryocytes and / or the transduced megakaryocytes.

[0041] The generated platelet carriers are functionally reactive to activation with a specific agonist.

[0042] The generated platelet carriers are activated by an extracellular signal.

[0043] The generated platelet carriers contain at least one therapeutic RNA product.

[0044] The present application is based on the basic idea of transducing megakaryocytes (MKs) (e.g., immortalized MKs), progenitor cells of megakaryocytes (e.g., immortalized progenitor cells of megakaryocytes), or CD34-expressing HSPCs (e.g., immortalized CD34-expressing HSPCs) to express at least one therapeutic RNA sequence and / or a therapeutic RNA packaging sequence at the stage of megakaryocytes, thereby avoiding biological alterations of megakaryocyte progenitor cells and / or CD34+ HSPCs by expressing at least one therapeutic RNA sequence and / or a therapeutic RNA packaging sequence. The transduced cells can then differentiate into mature megakaryocytes, thereby expressing at least one therapeutic RNA sequence and / or at least one therapeutic RNA packaging sequence, and being manipulated to produce functional platelets. The resulting platelets express the respective at least one therapeutic product and can further be used in therapeutic approaches, e.g., for producing a pharmaceutical composition.

[0045] Furthermore, because the platelets are functional, they will be activated by extracellular signals. In other words, passive loading of therapeutic compounds into the interior or onto the surface of mature platelets is avoided. Also, extensive membrane modification is avoided. The therapeutic RNA is located within platelet vesicles, and functional platelets can release their therapeutic RNA cargo at targeted sites upon activation.

[0046] The method according to the present application allows specific loading of therapeutic RNA into megakaryocytes and / or platelet vesicles by expressing a therapeutic RNA packaging sequence, thereby allowing microvesicle release at specific target cells and / or tissues upon activation by extracellular signals.

[0047] In addition, the risk of therapeutic RNA expression during megakaryopoiesis can be reduced.

[0048] The therapeutic RNA platelet carriers engineered by the method of the present application can allow gene silencing (e.g., by miRNA, siRNA, shRNA) of interest at target sites, e.g., cells and / or tissues.

[0049] The method is simple and allows production of engineered therapeutic RNA platelet carriers on a clinically relevant scale at relatively low costs.

[0050] Upon infusion into a patient, the therapeutic RNA platelet carriers will circulate in a resting state in the blood, under strict control of the plasma and cellular components of the blood vessels.

[0051] Within the circulating therapeutic RNA platelet carriers, the at least one therapeutic product encoded by the therapeutic RNA sequence is protected from inhibition or degradation.

[0052] The therapeutic RNA platelet carrier is only activated by an extracellular signal after stagnation at a specific platelet activation site, such as a bleeding, injury, cancer or inflammation site, and releases its cargo comprising at least one therapeutic RNA.

[0053] Thus, the therapeutic RNA platelet carrier prepared by the method of the present application can be considered as a therapeutic product delivery carrier targeting pathological processes.

[0054] Preferably, CD34+ HSPC and / or immortalized MK cell lines and / or MK progenitor cells are transduced with an expression cassette using a lentiviral vector.

[0055] The expression cassette can contain constitutive promoters (e.g., Spleen focus-forming virus (SFFV) and / or elongation factor 1a (EF1a)) and / or megakaryocyte promoters (e.g., GPVI, PF4, CD41), and / or inducible promoters (e.g., tetracycline and / or isopropyl beta-D-1 -thiogalactopyranoside (IPTG) and / or Cumate control operon system).

[0056] Advantageously, the RNA-binding protein can be one of the following: HNRNPA2B1, HNRNPC1, RBMX, HNRNPH1, HNRNPK, HNRNPQ, YBOX1, ELAV1, AGO2, IGF2BP1, MEX3C, ANXA2, PDC6I, NUCL, FUS, MVP, LIN28A, SRP14, SRP09, QKI and TERT.

[0057] The RNA-binding motif of each of said RNA-binding proteins is provided in detail in Table 1.

[0058] Advantageously, the extracellular signal can comprise a protein expressed on the cell surface, a paracrine signal and / or an autocrine signal.

[0059] Advantageously, the therapeutic RNA sequence encodes at least one of the following: a messenger RNA (mRNA), a small interfering RNA (siRNA), a short hairpin RNA (shRNA), a long non-coding RNA (lncRNA), a microRNA (miRNA) or a small activating RNA (saRNA).

[0060] The mRNA is a single-stranded RNA molecule corresponding to the genetic sequence of a gene and is read by the ribosome in the process of synthesizing a protein. The mRNA can encode, for example, an antibody, a cytokine, a receptor protein or a chimeric receptor protein, etc.

[0061] Thus, the RNA material delivered by the therapeutic RNA platelet carrier can be translated into antibodies and / or cytokines within the target cells for the desired in situ response.

[0062] siRNA is a class of double-stranded RNA, originally non-coding RNA molecules, usually 20-24 (usually 21) base pairs in length, similar to miRNA, and functions within the RNA interference (RNAi) pathway. It interferes with the expression of specific genes with complementary nucleotide sequences by degrading the mRNA after transcription, thus preventing translation.

[0063] shRNA is an artificial molecule with a tight hairpin bend, which can be used to silence the expression of target genes by RNA interference.

[0064] The lncRNA family engulfs RNAs longer than 200 nucleotides that do not translate into functional proteins. lncRNAs regulate gene expression by directly interacting with DNA, RNA, and / or proteins, and modulate chromatin structure and function as well as gene transcription. They can also affect RNA splicing, stability, and translation.

[0065] miRNA is a small single-stranded non-coding RNA molecule (containing about 22 nucleotides) found in plants, animals, and some viruses, which plays a role in post-transcriptional regulation of gene expression and RNA silencing.

[0066] miRNA exerts its effect by base pairing with complementary sequences within mRNA molecules. As a result, these mRNA molecules are silenced by one or more of the following processes: (1) cleaving the mRNA strand into two pieces, (2) destabilizing the mRNA by shortening its poly(A) tail, and (3) less efficient translation of the mRNA into protein by the ribosome.

[0067] saRNA is a chemically synthesized double-stranded RNA oligonucleotide 21 nucleotides in length. It increases the expression of its target gene beyond endogenous levels by binding near or within the target gene's promoter.

[0068] Particular motifs can be added to the therapeutic RNA sequence to ensure binding to specific therapeutic RNA packaging proteins, such as RNA binding proteins.

[0069] In general, the therapeutic RNA sequence can be single.

[0070] In this case, the sequence of the therapeutic compound contains only one therapeutic RNA.

[0071] Alternatively, therapeutic RNA sequences can be tandem to achieve multiplexing. This means that sequence copies are adjacent to each other either in the same direction (direct tandem repeats) or in opposite directions (anti-tandem repeats).

[0072] Specifically, therapeutic RNA sequences can be used to target at least one of breast cancer and / or ovarian cancer, and / or BRCA2 mutants as siRNA.

[0073] Alternatively, therapeutic RNA sequences may be used to suppress members of the alt-NHEJ pathway.

[0074] Preferably, the member alt-NHEJ path is PARP1.

[0075] Alternatively, therapeutic RNA sequences may be applicable to proteins containing only BH3 that activate apoptosis-promoting family members via saRNA.

[0076] Advantageously, the therapeutic RNA sequence may contain a specific protein-binding motif or EXOmotif according to SEQ. ID NO. 1, wherein: SEQ. ID NO. 1: GAGAG.

[0077] Alternatively, the therapeutic RNA sequence may contain a specific protein-binding motif or EXOmotif according to SEQ. ID NO. 2, wherein: SEQ. ID NO. 2: GGAG.

[0078] Preferably, the specific protein-binding motif or EXOmotif has a high affinity for proteins selected from the RNA-binding protein family in exosomes.

[0079] In this document, the RNA-binding protein is preferably the protein counterpart of SEQ. ID NO. 1 or SEQ. ID NO. 2, respectively.

[0080] Advantageously, the expression of therapeutic RNA and therapeutic RNA packaging sequences can be driven by megakaryocyte-specific promoters.

[0081] For example, the megakaryocyte-specific promoter may include GPVI, CD41, PF4, and / or inducible promoters.

[0082] Optional additional activating receptor proteins can be expressed under a constitutive promoter.

[0083] Adjacent to the promoter, one or more coding sequences for therapeutic RNA can be added; these are also specifically referred to as one or more therapeutic RNA sequences. More specifically, the expression cassette can be called a therapeutic product expression cassette. Furthermore, multiple viruses can be used to express multiple therapeutic products.

[0084] Advantageously, the DNA-based vector may also include at least one coding sequence of a chimeric or wild-type activating receptor protein from the following: a trigger receptor (TREM)-like family expressed on myeloid cells, preferably NCR2, TREM1 encoding NKp44, TREML4, TREML2, TREM2 and TREML encoding TREM-like 4; and / or a Notch family having wild-type or modified extracellular sequences, preferably Notch1, Notch2, Notch3 and Notch4.

[0085] Advantageously, the modified extracellular domain of the chimeric activated receptor protein may consist of or include the following: single-chain variable fragment (scFv) protein, receptor ligand, complete receptor protein or extracellular protein domain of the receptor, nanobody, designed ankyrin repeat sequence protein (DARPin) or adaptor chimeric antigen receptor (adCAR).

[0086] Advantageously, chimeric activated receptor proteins can be constitutively expressed.

[0087] The present invention also provides a therapeutic RNA platelet vector engineered by the above method.

[0088] Specifically, the therapeutic RNA platelet vector obtained thereby can express at least one therapeutic coding sequence and / or a receptor, preferably at least one coding sequence of a cell or tissue or organ-specific receptor protein.

[0089] Advantageously, the therapeutic RNA platelet vector can be used for treatment, preferably for target-specific treatment of diseases.

[0090] For example, the therapeutic RNA platelet vector can be used for treatment, preferably for target-specific treatment of at least one of cancer, acute inflammation, chronic inflammation, bleeding disorders, coagulation disorders, and / or liver diseases.

[0091] For example, the therapeutic RNA platelet vector may express at least one therapeutic RNA sequence and / or at least one therapeutic RNA packaging sequence, and / or at least one coding sequence of a wild-type and / or chimeric activated receptor protein, thereby allowing specific targeting, for example, cell- or tissue- or organ-specific receptor proteins.

[0092] Platelets naturally express C-type lectin domain family 1 member B (CLEC-2), the receptor for PDPN. Therefore, engineered platelets are naturally activated in tissues that overexpress PDPN, such as in PDPN-positive cancers. PDPN overexpression in cancer often leads to increased metastatic and prothrombotic events.

[0093] Therefore, upon activation, engineered platelets may immediately release miRNAs and / or siRNAs targeting PDPN near the tumor via microparticles. The siRNAs or miRNAs will be engulfed or internalized by surrounding cells, and their PDPN expression will be downregulated.

[0094] Local downregulation can reduce tumor progression and metastasis.

[0095] In healthy tissues, although PDPN and CLEC-2 are expressed, PDPN expression does not lead to platelet activation.

[0096] Specifically, this is attributed to the nature of the vascular system, which prevents platelet activation.

[0097] In addition, platelets do not circulate in lymphatic vessels.

[0098] However, in cancers with PDPN overexpression, platelets are activated (supported by the literature).

[0099] In patients receiving the engineered therapeutic RNA platelet vector according to the present invention, platelets will remain quiescent until they are near a tumor, triggering the release of anti-PDPN products from the platelets.

[0100] In addition, the present invention provides a pharmaceutical composition comprising a therapeutic RNA platelet carrier engineered by the above method.

[0101] Specifically, the therapeutic RNA platelet vector is capable of expressing at least one therapeutic coding sequence and / or a receptor, preferably at least one coding sequence of a cell, tissue, or organ-specific receptor protein.

[0102] Advantageously, the pharmaceutical composition can be used for treatment, preferably for target-specific treatment of diseases.

[0103] For example, the pharmaceutical composition can be used for treatment, preferably for target-specific treatment of at least one of cancer, acute inflammation, chronic inflammation, bleeding disorders, coagulation disorders, and / or liver disease.

[0104] The pharmaceutical composition may comprise a therapeutic RNA platelet vector that expresses at least one therapeutic RNA sequence and / or at least one therapeutic RNA packaging sequence, and / or at least one coding sequence of a wild-type and / or chimeric activated receptor protein, thereby allowing specific targeting, for example, cell- or tissue- or organ-specific receptor proteins.

[0105] It is important to ensure that therapeutic RNA is encapsulated in vesicles.

[0106] Therefore, the packaging protein is co-expressed with the therapeutic RNA.

[0107] In addition, therapeutic RNAs express a specific DNA sequence called EXOmotif to specifically bind to therapeutic RNA packaging proteins.

[0108] As a non-limiting example, therapeutic RNA packaging proteins may consist of or include RNA-binding proteins capable of anchoring RNA with specific sequence motifs to vesicles and located within the vesicle lumen (Table 1).

[0109] Therefore, expression cassettes delivered via DNA-based vectors may additionally or alternatively include at least one coding sequence for an activation receptor protein (wild-type or having a modified extracellular domain), wherein platelets express the activation receptor protein.

[0110] In other words, DNA-based vectors may also include at least one coding sequence for an activation receptor protein (wild-type or having a modified extracellular domain), wherein platelets express the activation receptor protein.

[0111] This allows platelets expressing the activated receptor protein to be activated when the ligand for the activated receptor protein is present in the surrounding platelet environment, thereby enabling precise activation of platelets at the site of interest.

[0112] In fact, for some indications, the physiological mechanisms of activation may not be sufficient to: 1) trigger sufficient activation to release the payload, or 2) home to the site of interest.

[0113] Generally, activated receptor proteins can be unmodified receptor proteins (especially unmodified cellular receptor proteins), receptor protein complexes (especially cellular receptor complexes), chimeric receptor proteins (especially cellular chimeric receptor proteins), or chimeric receptor proteins containing gain-of-function mutations.

[0114] Activating receptor proteins (wild-type or with modified extracellular domains) are derived from the trigger receptor-like (TREM) family expressed on myeloid cells and / or from the Notch family with wild-type or modified extracellular sequences.

[0115] The receptor complex consists of at least one core receptor protein and receptor-associated proteins, and it has a profound impact on the overall structure, function and localization of the receptor.

[0116] Chimeric activating receptors can be defined as specialized receptors produced in the laboratory and designed to bind to certain proteins on target cells and / or tissues.

[0117] CD34+ HSPCs, especially immortalized CD34+ HSPCs, or megakaryocyte (MK) progenitors, especially immortalized megakaryocyte (MK) progenitors, or megakaryocytes, especially immortalized megakaryocytes, may be additionally or alternatively engineered to express at least one activating receptor protein (wild-type or having a modified extracellular domain).

[0118] Platelets produced by mature megakaryocytes will express at least one activating receptor protein (wild-type or with a modified extracellular domain), wherein the mature megakaryocytes are derived from CD34+ HSPCs and / or immortalized CD34+ HSPCs, and / or megakaryocyte progenitors, and / or immortalized megakaryocyte progenitors and / or megakaryocytes and / or megakaryocytes expressing at least one activating receptor protein (wild-type or with a modified extracellular domain).

[0119] Platelets will only be activated and release their payload containing, for example, at least one therapeutic compound after they have stopped at a specific recruitment site (e.g., bleeding, injury, cancer, or inflammation) or at a site that expresses a ligand of an activating receptor protein (wild-type with a modified extracellular domain) expressed by a therapeutic RNA platelet vector.

[0120] This invention allows for target-specific delivery of at least one therapeutic compound, such as a multispecific drug.

[0121] Platelets can be activated through multiple redundant pathways; therefore, activation receptor proteins (wild-type or with modified extracellular domains) can increase the specificity of activation as part of the surface activation matrix.

[0122] In general, only net intraplatelet signaling conducive to activation will trigger full activation and particle release, reducing the risk of non-specific release of the carrier.

[0123] In other words, the method allows for the preparation of platelets expressing tissue-specific receptors that promote platelet arrest at sites of interest and trigger or enhance payload release.

[0124] Specifically, the coding sequence of the activating receptor protein (wild type or with a modified extracellular domain) may include mRNA.

[0125] Specifically, the extracellular domain of the activated receptor can be modified and replaced by: single-chain variable fragment (scFv) proteins, receptor ligands, complete receptor proteins or extracellular domains of receptors, nanobodies, designed ankyrin repeat sequence proteins (DARPin), or adaptor chimeric antigen receptors (adCAR).

[0126] This can be achieved by expressing a chimeric activation receptor with an extracellular domain containing tissue-specific portions (e.g., scFv or DARPin) that bind to both transmembrane and intracellular domains of trigger receptor-like (TREM) and / or Notch family receptors expressed on myeloid cells. Upon binding to the receptor's target, endogenous signaling pathways activate the therapeutic RNA platelet carrier, allowing for precise platelet activation at the site of interest. To enhance signaling, gain-of-function mutations can be introduced into the coding sequence of the activation receptor protein (wild-type or with a modified extracellular domain).

[0127] One example of a targeted portion that can be expressed on the surface of engineered platelets is scFv targeting PDPN to increase therapeutic platelet homing to the tumor environment, where CLEC-2 will cause platelet activation and release of therapeutic agents.

[0128] Another example is the use of tumor cells to overexpress transferrin receptors (Gatter et al., 1983).

[0129] Therefore, expressing transferrin, or more cleverly binding scFv to transferrin on engineered platelets, will also improve platelet homing to the tumor environment. The same strategy can be utilized by targeting the folate receptor (FR), which is also expressed in many cancers (Sudimack and Lee, 2000). Finally, all monoclonal antibodies (mAbs) targeting cancer cells, such as EGFR (e.g., panitumumab), can be utilized by generating scFv from the Fab domain of mAbs using current molecular biology methods.

[0130] Another example is the expression of adCAR on platelets. adCAR is a chimeric receptor that specifically binds to another target protein (or target module), such as a monoclonal antibody (mAb).

[0131] Therapeutic mAbs bind to biotin or another epitope tag (to form a linker-labeled epitope (LLE)). Therapeutic mAbs are administered or infused according to their pharmacokinetic and distribution parameters. At different time points during treatment, engineered platelets expressing adCAR are infused. The platelets then exhibit specific homing behavior, heading towards the target tissue expressing the mAb. Upon quiescence and complete activation, the platelets release their therapeutic delivery.

[0132] Alternatively, the coding sequence can encode a radiosensitizer to increase the sensitivity of platelet-targeted tissues to radiotherapy. In fact, some miRNAs targeting SETDB1 in hepatocellular carcinoma, such as miR-621, can act as radiosensitizers (Shao et al., 2019). Similarly, short siRNAs targeting S100A4 have enhanced the radiosensitivity of human adenocarcinoma epithelial cells (Qi, Qiao, and Zhuang, 2016).

[0133] Generally, RNA platelet vectors are prepared for therapeutic purposes.

[0134] For example, RNA platelet vectors can be used to prepare pharmaceutical compositions, as mentioned above.

[0135] If needed, therapeutic RNA platelet vectors can express activated receptors (wild-type or with modified extracellular domains) for more sensitive targets, such as cell, tissue, or organ-specific receptor proteins, for the treatment of diseases.

[0136] For example, a pharmaceutical composition may include a therapeutic RNA platelet vector expressing siRNA and / or miRNA and / or shRNA and / or saRNA and / or lncRNA targeting a defined protein and / or proteome.

[0137] Following administration of the drug composition, the therapeutic RNA platelet carrier is activated in the tissue by extracellular signals within the microenvironment of the therapeutic RNA platelet carrier recruitment site. Upon activation, platelets can release siRNA and / or miRNA and / or shRNA and / or saRNA and / or lncRNA from nearby microparticles (exosomes and extranuclear mitochondria). These microparticles can be engulfed by surrounding cells, and the expression of defined proteins and / or proteomes may be dysregulated. Local dysregulation of defined proteins or proteomes (e.g., siRNAs that multiply BRCA2 mutants in breast or ovarian cancer, and proteins that inhibit alt-NHEJ pathway members, such as PARP1, while simultaneously activating pro-apoptotic family members containing only BH3 via saRNA) can reduce tumor progression and metastasis.

[0138] Alternatively, drug preparation may include a therapeutic RNA platelet vector expressing at least one coding sequence of an activating receptor protein.

[0139] For example, proteins can come from the TREM or Notch family.

[0140] The pharmaceutical composition can be used in a method of treating at least one of cancer, acute inflammation, chronic inflammation, bleeding disorders, coagulation disorders, and / or liver disease.

[0141] It is known that platelets are physiologically activated under these disease conditions. Attached Figure Description

[0142] Further details and advantages of the invention will now be disclosed in conjunction with the accompanying drawings.

[0143] As shown in the following figures: Figure 1 A block diagram illustrating a method for preparing a therapeutic RNA platelet vector according to an embodiment of the present invention; Figure 2 exist Figure 1 A schematic diagram illustrating how gene modification of immortalized megakaryocytes leads to the production of engineered therapeutic RNA platelet vectors; Figure 3 A schematic diagram illustrating the release of microparticles from a therapeutic RNA platelet carrier into target cells; Figure 4 A schematic diagram of an engineered therapeutic RNA platelet vector releasing a therapeutic compound at a target site of interest; Figure 5 Examples of lentiviral transfer plasmids having expression cassettes including therapeutic coding sequences; Figure 6 Examples of protein expression driven by megakaryocyte promoters; Figure 7 An example of introducing a miRNA sequence targeting B2M into megakaryocyte progenitor cells; Figure 8 Examples of chimeric receptors expressed by ab on the surface of megakaryocyte progenitors and mature megakaryocytes; and Figure 9 ac in CD34 + Examples of shRNA expressed in platelets and megakaryocytes after cell transduction. Detailed Implementation

[0144] Figure 1 A block diagram illustrating a method for preparing engineered therapeutic RNA platelet vectors according to an embodiment of the present invention is shown.

[0145] The method comprises at least three steps, referred to as S1 to S3 ( Figure 1 ).

[0146] The first step S1 includes transducing at least one therapeutic RNA sequence together with at least one therapeutic RNA packaging sequence containing an RNA-binding protein sequence into megakaryocyte progenitor cells and / or CD34-expressing hematopoietic stem cells and progenitor cells (HSPCs), immature megakaryocytes, and / or megakaryocytes using a DNA-based vector, wherein the therapeutic RNA sequence and packaging sequence encode at least one therapeutic RNA product.

[0147] The second step, S2, includes activating the expression of therapeutic RNA sequences and / or therapeutic RNA packaging sequences.

[0148] The third step S3 includes the production of platelets from mature megakaryocytes, wherein the mature megakaryocytes are derived from transduced megakaryocyte progenitor cells and / or transduced CD34-expressing hematopoietic stem cells and progenitor cells and / or transduced immature megakaryocytes and / or transduced megakaryocytes.

[0149] The expression activation step is regulated to occur during megakaryocyte maturation and / or platelet formation.

[0150] The resulting platelet carriers are functionally responsive to activation by specific agonists.

[0151] The resulting platelet carriers are activated by extracellular signals.

[0152] The resulting platelet vector contains at least one therapeutic RNA product.

[0153] In this embodiment, the RNA-binding protein is one of the following: HNRNPA2B1, HNRNPC1, RBMX, HNRNPH1, HNRNPK, HNRNPQ, YBOX1, ELAV1, AGO2, IGF2BP1, MEX3C, ANXA2, PDC6I, NUCL, FUS, MVP, LIN28A, SRP14, SRP09, QKI, and TERT (Table 1).

[0154] In this embodiment, extracellular signals include proteins expressed on the cell surface, paracrine signals, and / or autocrine signals.

[0155] In this embodiment, the therapeutic RNA sequence encodes at least one of the following: messenger RNA (mRNA), small interfering RNA (siRNA), short hairpin RNA (shRNA), long non-coding RNA (lncRNA), microRNA (miRNA), or small activating RNA (saRNA).

[0156] Generally, therapeutic RNA sequences can be single.

[0157] In this case, the sequence of the therapeutic compound contains only one therapeutic RNA.

[0158] Alternatively, therapeutic RNA sequences can be tandem to achieve multiplexing.

[0159] This means that sequence copies are adjacent to each other either in the same direction (direct tandem repeat sequence) or in opposite directions (reverse tandem repeat sequence).

[0160] Therapeutic RNA sequences may be applicable as siRNAs targeting at least one of breast and / or ovarian cancers, and / or BRCA2 mutants.

[0161] Alternatively, therapeutic RNA sequences may be used to suppress members of the alt-NHEJ pathway.

[0162] Preferably, the member alt-NHEJ path is PARP1.

[0163] Alternatively, therapeutic RNA sequences may be applicable to proteins containing only BH3 that activate apoptosis-promoting family members via saRNA.

[0164] In this embodiment, the therapeutic RNA sequence contains a specific protein-binding motif or EXOmotif according to SEQ ID No. 1 or SEQ ID No. 2, wherein: SEQ ID NO. 1: GAGAG SEQ ID No. 2: GGAG In this embodiment, the RNA-binding protein is the protein counterpart of SEQ ID NO. 1 or SEQ ID NO. 2.

[0165] In this embodiment, the expression of therapeutic RNA and therapeutic RNA packaging sequences is driven by a megakaryocyte-specific promoter.

[0166] Specifically, in this embodiment, the megakaryocyte-specific promoter preferably includes GPVI, CD41, PF4 and / or an inducible promoter.

[0167] In this embodiment, the DNA-based vector further includes at least one coding sequence of a chimeric or wild-type activating receptor protein from the following: a trigger receptor (TREM)-like family expressed on myeloid cells, preferably NCR2 and TREM1 encoding NKp44, and TREML4, TREML2, TREM2, and TREML1 encoding TREM-like 4; and / or a Notch family having wild-type or modified extracellular sequences, preferably Notch1, Notch2, Notch3, and Notch4.

[0168] In this embodiment, the modified extracellular domain of the chimeric activated receptor protein consists of or includes the following: single-chain variable fragment (scFv) protein, receptor ligand, complete receptor protein or extracellular protein domain of receptor, nanobody, designed ankyrin repeat sequence protein (DARPin) or adaptor chimeric antigen receptor (adCAR).

[0169] In this embodiment, the chimeric activated receptor protein is constitutively expressed.

[0170] Lentivirals can be used to transduce expression cassettes into cells, such as human cells.

[0171] Specifically, the expression box may include a promoter. Immediately adjacent to the promoter, the coding sequence for the therapeutic compound is added.

[0172] Alternatively, the expression cassette can be transduced into immature megakaryocytes.

[0173] Alternatively, mature megakaryocytes or any progenitor cell of megakaryocytes can be transduced.

[0174] For example, the expression cassette may include a therapeutic RNA sequence.

[0175] Alternatively, the expression cassette may include more than one therapeutic RNA sequence.

[0176] Therapeutic RNA platelet vectors express at least one therapeutic product.

[0177] In other words, therapeutic RNA platelet vectors contain at least one therapeutic product.

[0178] As not shown here, DNA-based vectors may also include receptor proteins, such as at least one coding sequence for a cell, tissue, or organ-specific receptor, wherein platelets express the receptor protein.

[0179] Also not shown, the receptor protein can be a receptor complex protein.

[0180] Alternatively, the receptor protein may be an unmodified receptor protein or a chimeric receptor protein, or a chimeric receptor protein containing gain-of-function mutations.

[0181] As not shown here, the coding sequence of the receptor protein may include mRNA.

[0182] Receptors can be specific to cell type, tissue, or organ.

[0183] Also not shown, at least one coding sequence of the receptor protein can encode scFv.

[0184] Also not shown, the coding sequence can also encode scFv together with the signal transduction intracellular structural domain.

[0185] Alternatively, the coding sequence may encode only single-stranded variable fragments (scFv), ligands, receptors, nanobodies, designed ankyrin repeat protein (DARPin), chimeric antigen receptors and / or adaptor chimeric antigen receptors (adCARs), especially in conjunction with transmembrane domains or anchoring regions (e.g., GPI anchors).

[0186] Figure 2 A schematic diagram is provided illustrating how genetic modification of immortalized megakaryocytes in the method of the present invention leads to the production of engineered therapeutic RNA platelet vectors.

[0187] First, megakaryocyte progenitor cells 10 were transduced with lentiviral particles 12 to express therapeutic RNA compounds.

[0188] An example of a lentiviral particle, namely a lentiviral transfer plasmid, is shown in... Figure 4 middle.

[0189] Specifically, in this paper, lentiviral particle 12 transduction includes expression cassettes of therapeutic sequences.

[0190] Cell 14, which had been successfully transduced, was then selected.

[0191] Cell 10 was expanded in a selective culture medium and eventually differentiated into mature megakaryocytes 16.

[0192] Upon maturation, megakaryocytes express therapeutic RNA sequences and / or packaging proteins, referred to in this paper as RNA-binding proteins. RNA-binding proteins allow the therapeutic RNA sequences to localize within vesicles.

[0193] After being transferred into a microfluidic structure to generate adhesive and shear forces, mature megakaryocytes 16 release platelets 18 containing a therapeutic compound encoded by an exogenous RNA encoded by a therapeutic sequence.

[0194] Figure 3 This shows the release of microparticles from platelets.

[0195] Specifically, platelet 18 is shown.

[0196] In diseased tissues, such as cancer, liver disease, or during bleeding, platelets 18 are activated by environmental factors (such as cytokines, thrombin, and / or collagen) and release their particle contents, as well as microparticles 20.

[0197] By the method according to the present invention ( Figures 1-2The platelets 18 produced express at least one therapeutic sequence, and therefore the microparticles 20 released from these platelets 18 include the corresponding therapeutic RNA product.

[0198] Figure 4 This diagram illustrates the release of therapeutic compounds from engineered platelets at target sites of interest.

[0199] Cancer cells 22 in the tumor release metastatic cells 22 in the bloodstream 30. In addition, cancer cells 22 or metastatic cells 22 overexpress specific proteins or proteomes 26.

[0200] In platelet-18 expressing chimeric activating receptors, such as NOTCH1 or TREML1 28, the wild-type or modified extracellular domain is the receptor for tumor protein 26. In this paper, platelet-18 is engineered to express therapeutic RNA products targeting specific oncogenes.

[0201] Platelet 18, specifically wild-type platelet 18, is activated by metastatic cancer cells 22 in the bloodstream 30 via the PDPN-CLEC-2 pathway, releasing microparticles 20. These microparticles 20 include chemokines, cytokines, and factors that increase the permeability of endothelial cells 24, allowing cancer cells 22 to invade and proliferate in tissues. Engineered platelet 18 activated by extracellular signals also release miRNAs (or alternatively, siRNAs) targeting specific proteins or proteomes near the tumor via microparticles 20.

[0202] These particles 20 will be engulfed by surrounding cancer or metastatic cells 22, and specific proteins or proteomes will become disordered.

[0203] Dysregulation of specific proteins or the proteome can reduce tumor progression and / or metastasis.

[0204] In other words, engineered platelet-18 cells activated by extracellular signaling pathways can release exogenous therapeutic agents, interfering with disease progression. This creates a virtuous cycle: reduced platelet-18 activation and decreased tumor growth.

[0205] Figure 5 An example of a lentiviral transfer plasmid having an expression cassette including a therapeutic coding sequence is shown.

[0206] Importantly, the plasmid showed that the GP6 promoter was allowed to be specifically expressed in megakaryocytes.

[0207] The transfer plasmid also includes the following fragments / sequences: cPPT / CTS fragment (short for central polypurine segment / chain termination sequence): This sequence helps increase transduction efficiency.

[0208] In this paper, the cPPT / CTS fragment consists of 118 base pairs.

[0209] RRE (short for Rev Response Elements, specifically HIV-1 Rev Response Elements): This allows for the nuclear export of viral RNA via the viral Rev protein during viral packaging. Specifically, all lentiviruses encode the regulatory protein Rev, which is essential for the post-transcriptional transport of unspliced ​​and incompletely spliced ​​viral mRNA from the nucleus to the cytoplasm. The Rev protein functions by binding to RNA structural elements called Rev Response Elements (RREs).

[0210] HIV-1φ: The HIV-1 packaging signal required to package viral RNA into the virus.

[0211] 3'LTR(ΔU3) (short for the 3' long terminal repeat sequence lacking the U3 region): A truncated version of the HIV-1 3' long terminal repeat sequence lacking the U3 region. This results in the self-inactivation of the 5'LTR promoter activity after the viral vector integrates into the host genome (attributed to the fact that the 3' LTR is copied to the 5'LTR during viral integration). The polyadenylation signal contained in 3' LTR-ΔU3 is used to terminate all upstream transcripts produced during viral packaging and after viral integration into the host genome.

[0212] 5'LTR (short for 5' long terminal repeat): A deleted version of the HIV-1 5' long terminal repeat. In wild-type lentiviruses, the 5' LTR and 3' LTR are essentially identical in sequence. They are located at opposite ends of the viral genome and point in the same direction. After viral integration, the 3' LTR sequence is copied onto the 5' LTR. The LTR carries promoter and polyadenylation functions, so in wild-type virus, the 5' LTR acts as a promoter to drive transcription of the viral genome, while the 3' LTR acts as a polyadenylation signal to terminate upstream transcripts. In this vector, 5'LTR-ΔU3 lacks the region required for LTR's promoter activity, which is normally promoted by the viral transcription factor Tat. This does not affect the production of viral RNA during packaging, as the engineered CMV promoter upstream of the Δ5'LTR complements the promoter function.

[0213] RSV promoter / enhancer (short for Laure's sarcoma virus enhancer / promoter): capable of producing viral RNA during packaging to compensate for the partial loss of the 5' LTR.

[0214] AmpR (short for ampicillin resistance): The nucleotide sequence of the ampicillin resistance gene. It allows the plasmid to be maintained through ampicillin selection in E. coli.

[0215] Ori (short for Origin of Replication): The specific sequence in a carrier that initiates replication.

[0216] SV40 ori (short for Simian Virus 40 Origin of Replication): A specific sequence in the vector that initiates bidirectional replication.

[0217] WPRE (short for post-transcriptional regulatory element of prairie hepatitis virus): It enhances the stability of viral RNA in packaging cells, resulting in higher titers of packaged virus.

[0218] 3' Flanking Region: A DNA region adjacent to the 3' end of the therapeutic coding sequence, allowing the formation of functional pre-miRNAs.

[0219] 5' Flanking Region: A DNA region adjacent to the 5' end of the therapeutic coding sequence, allowing the formation of functional pre-miRNAs.

[0220] Exemplary therapeutic RNA sequences can be miR, representing a sequence used to express miRNA; therapeutic sequences of pre-miRNA (or alternatively, sequences used to express siRNA, for example).

[0221] The human coding sequence for miR-29b (5'-3', stem-loop precursor RNA) is: SEQ ID NO. 3: CUUCAGGAAGCUGGUUUCAUAUGGUGGUUUAGAUUUAAAUAGUGAUUGUCUAGCACCAUUUGAAAUCAGUGUUCUUGGGG (Source: https: / / www.mirbase.org / ).

[0222] The human coding sequence for miR-125a (5'-3', stem-loop precursor RNA) is: SEQ ID NO. 4: UGCCAGUCUCUAGGUCCCUGAGACCCUUUAACCUGAGGGACAUCCAGGGUCACAGGUGAGGUUCUUGGGAGCCUGGCGUCUGGCC (Source: https: / / www.mirbase.org / ).

[0223] Figure 6 This diagram illustrates how protein expression can be controlled and ensured to be expressed only during megakaryocyte maturation.

[0224] CD34+ HSPCs were transduced using lentiviral particles to express DsRED fluorescent protein under the control of the megakaryocyte promoter (GPVI promoter in this paper).

[0225] Then the cells are induced to differentiate into megakaryocytes.

[0226] Figure 6 A shows that DsRED-positive cells increase during differentiation.

[0227] Figure 6 B confirmed that DsRED was expressed only when GPVI protein was expressed in transduced cells.

[0228] Figure 7 In particular, as proof of principle, it demonstrates the expression and biological activity of transgenic miRNA sequences in megakaryocytes.

[0229] Three miRNA sequences targeting human β-2 microglobulin (B2M): miR-B2M-1, SEQ ID NO. 5: GAAUCUUUGGAGUACGCUGGAUGUUUUGGCCACUGACUGACAUCCAGCGCUCCAAAGAUU; miR-B2M-2, SEQ ID NO. 6: GAAACCUGAAUCUGGAGUACGUUUUGGCCACUGACUGACGUACUCCAGAUUCAGGUUU; miR-B2M-3, SEQ ID NO. 7: GAGUAAGUCAACUUCAAUGUCGGUUUUGGCCACUGACUGACCGACAUUGGUUGACUUACU, And a non-targeted control sequence, namely miR-CTL, SEQ ID NO. 8: GAAAUGUACUGCGCGUGGAGACGUUUUGGCCACUGACUGACGUCUCCACGCAGUACAUUU, In a separate experiment, a third-generation lentiviral vector was introduced into megakaryocyte progenitor cells under the control of the spleen lesion-forming virus promoter (pSFFV).

[0230] After maturation into megakaryocytes, B2M expression was assessed by flow cytometry using cell culture medium based on Iscove's Modified Durbecco's Medium (IMDM) supplemented with stem cell factor (SCF), interleukin-3 (IL-3), and thrombopoietin (TPO) receptor agonist peptide (Cwirla et al., 1997). (See [link to relevant documentation]). Figure 7 a).

[0231] All three specific miRNA sequences (i.e., miR-B2M-1, miR-B2M-2, and miR-B2M-3) reduced B2M expression.

[0232] miR-B2M-1 was selected for further analysis.

[0233] In the next step, the megakaryocyte cell line MEG-01 was transduced using a lentiviral vector containing miR-B2M-1. Cell sorting was then performed to select a population expressing low levels of B2M (defined as B2M). low See Figure 7 b. Using the antibody clone 2M2 (officially known as β-2 microglobulin, also called IMD43) (from BioLegend, with a residual expression level of 6% compared to the control, measured by flow cytometry), low levels of B2M expression were confirmed by real-time qPCR using primers and internal probes (B2M: Hs.PT.58v.18759587; HPRT1: Hs.PT.58v.4562157) from Integrated DNA Technologies (see [link to relevant documentation]). Figure 7 c), the residual expression level was 4% compared with the control (normalized relative to hypoxanthine phosphoribosyltransferase 1 (HPRT1) expression).

[0234] In the next step, platelets can be produced from transduced megakaryocytes, which show low expression of B2M.

[0235] Figure 8 An example of chimeric receptors being forcibly expressed on the surface of megakaryocytes is shown.

[0236] Human CD34 was transduced using a lentiviral vector. + Cells expressing chimeric antigen receptor (CAR) protein (CD19-scFv / CD28 / CD3zeta) are shown in the expression plasmid of the lentiviral vector. Figure 8 (a)

[0237] Twelve days after differentiation into megakaryocytes in a cell culture medium containing a TPO receptor agonist peptide, CAR was observed in megakaryocytes (CD42b) by flow cytometry using a fusion protein containing the extracellular domain of human CD19 and the Fc region of mutant human IgG1 (biotinylated CD19-CAR assay kit, Miltenyi Biotec). + The expression of the substance on the surface was then detected using an anti-biotin antibody and labeled with APC-Vio770.

[0238] Figure 8 b shows the expression of CARs that can bind to CD19.

[0239] In the next step, it can be derived from the transduced CD34 + Megakaryocytes produce platelets that show expression of CARs that can bind to CD19, confirming that platelet expression introduces surface chimeric receptors into megakaryocytes.

[0240] Figure 9 Shown on CD34 + Examples of shRNA expression in platelets and megakaryocytes after cell transduction. Transduction of human CD34 using a lentiviral vector. + Cells express shRNA (shRNA-) that targets and enhances green fluorescent protein (EGFP). EGFP ).

[0241] RT-qPCR was performed using stem-loop RT primers (Chen et al., 2005) on CD34. + Cells (starting cells, see) Figure 9 a) In CD34 + The source of megakaryocytes ( Figure 9 b) and in platelets of megakaryocyte origin ( Figure 9 c) Quantify the expression of shRNA-EGFP.

[0242] shRNA-EGFP was clearly detected in all cells and platelets. Statistical data: *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001, one-way ANOVA with Sidak correction.

[0243] This invention also provides a method ( ) Figures 1-2 An engineered therapeutic RNA platelet vector that expresses at least one therapeutic coding sequence and / or a receptor, preferably at least one coding sequence of a cell or tissue or organ-specific receptor protein.

[0244] Specifically, the therapeutic RNA platelet vectors obtained in this way can be used to treat diseases, especially target-specific diseases.

[0245] For example, the resulting therapeutic RNA platelet vector can be used for treatment, particularly for target-specific treatment of at least one of cancer, acute inflammation, chronic inflammation, bleeding disorders, coagulation disorders, and / or liver diseases.

[0246] In addition, the present invention provides a method including the above-described method ( Figures 1-2A pharmaceutical composition of an engineered therapeutic RNA platelet vector, wherein the therapeutic RNA platelet vector expresses at least one therapeutic sequence and / or a receptor, preferably at least one coding sequence of a cell or tissue or organ-specific receptor protein.

[0247] Specifically, the pharmaceutical composition can be used to treat diseases, particularly target-specific diseases.

[0248] For example, the pharmaceutical composition can be used for treatment, particularly for target-specific treatment of at least one of cancer, acute inflammation, chronic inflammation, bleeding disorders, coagulation disorders, and / or liver disease.

[0249] Table 1 RNA-binding proteins and their corresponding RNA-binding motifs identified by extracellular vesicles (reviewed in Fabbiano et al., 2020).

[0250] Bibliography

[0251] Barrow, AD et al., (2004) 'CuttingEdge: TREM-Like Transcript-1, a Platelet Immunoreceptor Tyrosine-Based Inhibition Motif Encoding Costimulatory Immunoreceptor that Enhances, Ratherthan Inhibits, Calcium Signaling via SHP-2 1', Journal of Immunology ( The Journal of Immunology 》, 172(10), pp. 5838-5842. Available at: https: / / doi.org / 10.4049 / jimmunol.172.10.5838.

[0252] Burnier, L. et al., (2009) 'Cell-derived microparticles in haemostasis and vascular medicine', Journal of Thrombosis and Hemostasis ( Thrombosis and Haemostasis )》, 101(3), Pages 439-451.

[0253] Chaurasia, SN et al., (2022) 'Notch signaling functions in noncanonicaljuxtacrine manner in platelets to amplify thrombogenicity', eLife R. Baiocchi and M. Zaidi, ed. 11, p. e79590. Available at: https: / / doi.org / 10.7554 / eLife.79590.

[0254] Chen, C. et al., (2005) 'Real-time quantification of microRNAs by stem-loop RT-PCR', Nucleic Acid Research (… Nucleic Acids Research )》, 33(20), page e179. Available at: https: / / doi.org / 10.1093 / nar / gni178.

[0255] Coxon, CH, Geer, MJ and Senis, YA (2017) 'ITIM receptors: more than just inhibitors of platelet activation', Blood ( Blood )》, 129(26), pp. 3407-3418. Available at: https: / / doi.org / 10.1182 / blood-2016-12-720185.

[0256] Cwirla, SE et al., (1997) 'Peptide agonist of the thrombopoietin receptor as potent as the natural cytokine', Science ( Science ) (New York, N.Y.) , 276(5319), pp. 1696-1699. Available at: https: / / doi.org / 10.1126 / science.276.5319.1696.

[0257] Dunton, TA et al., (2014) 'The Free Energy Landscape of Dimerization of a Membrane Protein, NanC', PLOS Computational Biology Journal of Extracellular Vesicles , 10(1), Page e1003417. Available at: https: / / doi.org / 10.1371 / journal.pcbi.1003417.

[0258] Fabbiano, F. et al., (2020) 'RNA packaging into extracellular vesicles: An orchestra of RNA-binding proteins?', Journal of Extracellular Vesicles (2020) Soft Matter )》, 10(2), page e12043. Available at: https: / / doi.org / 10.1002 / jev2.12043. Fowler, PW et al., (2016) 'Membrane stiffness is modified by integral membrane proteins', Soft Matter Journal of Clinical Pathology )》, 12(37), pp. 7792-7803. Available at: https: / / doi.org / 10.1039 / C6SM01186A.

[0259] Gatter, KC et al., (1983) 'Transferrin receptors in human tissues: their distribution and possible clinical relevance', Journal of Clinical Pathology ( GPP Gateway - Clone Details )》, 36(5), pp. 539-545. Available at: https: / / doi.org / 10.1136 / jcp.36.5.539.

[0260] Biophysical Journal(Undate not specified). Available at: https: / / portals.broadinstitute.org / gpp / public / clone / details?cloneId=TRCN0000231756 (Accessed: March 11, 2024).

[0261] Meyer, FJ-M. de, Venturoli, M. and Smit, B. (2008) 'Molecular Simulations of Lipid-Mediated Protein-Protein Interactions', Journal of Biophysics OncoTargets and Therapy )》, 95(4), pp. 1851-1865. Available at: https: / / doi.org / 10.1529 / biophysj.107.124164.

[0262] Parton, DL, Klingelhoefer, JW, and Sansom, MSP (2011) 'Aggregation of Model Membrane Proteins, Modulated by Hydrophobic Mismatch, Membrane Curvature, and Protein Class', Journal of Biophysics, 101(3), pp. 691-699. Available at: https: / / doi.org / 10.1016 / j.bpj.2011.06.048.

[0263] Qi, R., Qiao, T. and Zhuang, X. (2016) 'Small interfering RNA targeting S100A4 senses non-small-cell lung cancer cells (A549) to radiation treatment', *Tumor Targets and Therapies* Molecular Therapy: The Journal of the American Society of Gene Therapy ( )》, 9, pp. 3753-3762. Available at: https: / / doi.org / 10.2147 / OTT.S106557.

[0264] Shao, Y. et al., (2019) 'MicroRNA-621 Acts as a Tumor Radiosensitizer by Directly Targeting SETDB1 in Hepatocellular Carcinoma', *Molecular Therapy: Journal of the American Association for Gene Therapy* Blood )》, 27(2), pp. 355-364. Available at: https: / / doi.org / 10.1016 / j.ymthe.2018.11.005.

[0265] Smith, CW et al., (2018) 'TREM-like transcript 1: a more sensitive marker of platelet activation than P-selectin in humans and mice', *Progress in Blood* Advances Advanced Drug )》, 2(16), pp. 2072-2078. Available at: https: / / doi.org / 10.1182 / bloodadvances.2018017756.

[0266] Sudimack, J. and Lee, RJ (2000) 'Targeted drug delivery via the folate receptor', Advanced Drug Delivery Review ( Delivery Reviews (BBA)-Biomembranes )》, 41(2), pp. 147-162. Available at: https: / / doi.org / 10.1016 / s0169-409x(99)00062-9.

[0267] van Uitert, I., Le Gac, S. and van den Berg, A. (2010) 'The influence of different membrane components on the electrical stability of bilayer lipid membranes', Acta Biochimica Sinica Blood 》, 1798(1), pp. 21-31. Available at: https: / / doi.org / 10.1016 / j.bbamem.2009.10.003.

[0268] Washington, AV et al., (2004) 'A TREM family member, TLT-1, is found exclusively in the α-granules of megakaryocytes and platelets', Blood ( The Journal of Clinical Investigation )》, 104(4), pp. 1042-1047. Available at: https: / / doi.org / 10.1182 / blood-2004-01-0315.

[0269] Washington, AV et al., (2009) 'TREM-like transcript-1 protects against inflammation-associated hemorrhage by facilitating platelet aggregation in mice and humans', Journal of Clinical Research ( Blood )》, 119(6), pp. 1489-1501. Available at: https: / / doi.org / 10.1172 / JCI36175.

[0270] Washington, AV, Quigley, L. and McVicar, DW (2002) 'Initial characterization of TREM-like transcript (TLT)-1: a putative inhibitory receptor within the TREMcluster', Blood ( Reference Element )》, 100(10), pp. 3822-3824. Available at: https: / / doi.org / 10.1182 / blood-2002-02-0523.

[0271] ​ 10. Megakaryotic progenitor cells (megakaryocyte cell line) 12 lentiviral particles (vector) 14 clones, cells that have been successfully transduced 16 mature megakaryocytes 18 platelets, engineered platelets 20 particles 22 cancer cells, metastatic cells 24 endothelial cells 26 Tumor Protein 28. Chimeric activated receptors (e.g., NOTCH1 or TREML1) 30 blood flow S1 Method Step 1 S2 Method Step 2 S3 Method Step 3

Claims

1. A method for preparing therapeutic RNA platelet carriers, the method comprising at least the steps of: -S1 : transducing at least one therapeutic RNA sequence together with at least one therapeutic RNA packaging sequence comprising a RNA binding protein sequence into progenitor cells of megakaryocytes and / or CD34 expressing hematopoietic stem and progenitor cells (HSPC), immature megakaryocytes, and / or megakaryocytes using a DNA based vector, the therapeutic RNA sequence and / or packaging sequence encoding at least one therapeutic RNA product; -S2: activating the expression of the therapeutic RNA sequence and / or the therapeutic RNA packaging sequence, and -S3: producing platelets from mature megakaryocytes derived from the transduced progenitor cells of megakaryocytes and / or the transduced CD34 expressing hematopoietic stem and progenitor cells (HSPC), and / or the transduced immature megakaryocytes and / or the transduced megakaryocytes, wherein the expression activation step is regulated to occur during maturation of megakaryocytes and / or platelet formation; wherein the produced platelet carriers are functionally responsive to activation with a specific agonist; wherein the produced platelet carriers are activated extracellularly, and wherein the produced platelet carriers contain the at least one therapeutic RNA product.

2. The method of claim 1, wherein The RNA binding protein is one of HNRNPA2B1, HNRNPC1, RBMX, HNRNPH1, HNRNPK, HNRNPQ, YBOX1, ELAV1, AGO2, IGF2BP1, MEX3C, ANXA2, PDC6I, NUCL, FUS, MVP, LIN28A, SRP14, SRP09, QKI, and TERT.

3. The method according to claim 1 or 2, characterized in that The extracellular signal comprises a protein expressed on the surface of a cell, a paracrine signal, and / or an autocrine signal.

4. The method according to any of the preceding claims, characterized in that The therapeutic RNA sequence encodes at least one messenger RNA (mRNA), small interfering RNA (siRNA), short hairpin RNA (shRNA), long non-coding RNA (IncRNA), microRNA (miRNA), or small activating RNA (saRNA).

5. The method according to any of the preceding claims, characterized in that The therapeutic RNA sequence is single or concatenated for multiplexing.

6. The method according to any of the preceding claims, characterized in that The therapeutic RNA sequence is suitable for: targeting at least one of breast cancer and / or ovarian cancer, and / or siRNA of BRCA2 mutants, and / or inhibiting a member of the alt-NHEJ pathway, preferably PARP1, and / or activating a pro-apoptotic family member BH3-only protein by saRNA.

2. The method according to claim 1, wherein the RNA binding protein is HNRNPA2B1.

7. The method according to any of the preceding claims, characterized in that The therapeutic RNA sequence contains a specific protein binding motif or EXOmotif according to SEQ ID NO. 1 or SEQ ID NO. 2, preferably with high affinity for a protein selected from the RNA binding protein family in exosomes.

8. The method of claim 7, wherein The RNA binding protein is the protein counterpart of SEQ ID NO. 1 or SEQ ID NO.

2.

9. The method according to any of the preceding claims, characterized in that The expression of the therapeutic RNA and the therapeutic RNA packaging sequence is driven by a megakaryocyte-specific promoter, Preferably, wherein the megakaryocyte-specific promoter comprises GPVI, CD41, PF4, and / or an inducible promoter.

10. The method according to any of the preceding claims, characterized in that The DNA-based vector further comprises at least one coding sequence for a chimeric or wild-type activating receptor protein from the triggering receptor expressed on myeloid cell (TREM)-like family expressed on myeloid cells, preferably NCR2 encoding NKp44, TREM1, TREML4 encoding TREM-like 4, TREML2, TREM2 and TREML1; and / or the Notch family with wild-type or modified extracellular sequences, preferably Notch1, Notch2, Notch3 and Notch4.

11. The method of claim 10, wherein The modified extracellular domain of the chimeric activating receptor protein consists of or comprises a single-chain variable fragment (scFv) protein, a receptor ligand, an intact receptor protein or extracellular protein domain of a receptor, a nanobody, a designed ankyrin repeat protein (DARPin) or an adaptor chimeric antigen receptor (adCAR).

12. The method according to claim 10 or 11, characterized in that The chimeric activating receptor protein is constitutively expressed.

13. A therapeutic RNA platelet vector engineered by the method of any one of claims 1 to 12 expressing at least one therapeutic coding sequence, and / or at least one coding sequence for a receptor, preferably a cell or tissue or organ specific receptor protein.

14. Use of a therapeutic RNA platelet vector according to claim 13 for the treatment of a disease, in particular a target-specific treatment of a disease.

15. Use of a therapeutic RNA platelet vector according to claim 13 for the treatment, in particular a target-specific treatment of at least one of cancer, acute inflammation, chronic inflammation, a bleeding disorder, a coagulation disorder and / or a liver disease.

16. A pharmaceutical composition comprising a therapeutic RNA platelet vector engineered by the method of any one of claims 1 to 12 expressing at least one therapeutic sequence, and / or at least one coding sequence for a receptor, preferably a cell or tissue or organ specific receptor protein.

17. Use of a pharmaceutical composition according to claim 16 for the treatment of a disease, in particular a target-specific treatment of a disease.

18. Use of a pharmaceutical composition according to claim 16 for the treatment, in particular target- specific treatment, of at least one of cancer, acute inflammation, chronic inflammation, a bleeding disorder, a coagulation disorder, and / or a liver disease.

Images