Multiplex fluorescent quantitative PCR (polymerase chain reaction) detection kit for prawn culture pathogenic bacteria

Abstract

The invention discloses a multiplex fluorescent quantitative PCR (polymerase chain reaction) detection kit for prawn culture pathogenic bacteria, which is characterized in that the kit contains primers and probes for detecting the prawn culture pathogenic bacteria, wherein the primers and the probes are respectively used for detecting TDH-related hemolsin genes of vibrio parahaemolyticus, ORF107 genes of white spot syndrome viruses, small subunit ribosomal genes of shrimp enterocytozoon hepatopenaei, 37 kDa coat protein genes of infectious subcutaneous and hematopoietic necrosis viruses, DNA (deoxyribonucleic acid) primer genes of full-eye iridovirus 1 and PirA [pi] genes of pathogens of bacterial prawns acute hepatopancreas necrosis; the method has the advantage that the detection of eight prawn culture pathogens can be realized at the same time. The method comprises the following steps of: obtaining a tcdB gene of a high-pathogenicity vibrio and a hemolsin gene of a vibrio harveyi;

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of aquatic pathogen diagnosis, and particularly relates to a multiplex fluorescent quantitative PCR detection kit for pathogenic bacteria in prawn culture. BACKGROUND

[0002] With the expansion of large-scale prawn culture and high-density culture, diseases occur frequently, which seriously restricts the development of prawn culture industry. Common pathogenic bacteria in prawn culture include white spot syndrome virus (WSSV), Enterocytozoon hepatopenaei (EHP), Infectious hypodermal and hematopoietic necrosis virus (IHHNV), Decapod iridescent virus 1 (DIV1), Vibrio parahaemolyticus causing AHPND (Vp), Vibrio parahaemolyticus (Vp), Vibrio harveyi (Vh) and High pathogenic Vibrio (HLV), which can infect various shrimps and cause huge economic losses to prawn culture. AHPND V. parahaemolyticus Vibrio harveyi

[0003] Currently, commonly used immunological and molecular biological detection methods include colloidal gold, PCR, LAMP and the like. The above methods have different shortcomings, such as the immunological method needs to prepare specific monoclonal antibodies, has low sensitivity, is prone to false positive results and is difficult to realize multiplex detection; the PCR method mainly detects single pathogen and is prone to false positive results; the LAMP technology has low dependence on equipment, but has the risk of aerosol pollution and is prone to false positive results, and the like, and the potential for popularization and application is limited. Therefore, it is necessary to establish a rapid, sensitive, specific and clinically used detection method capable of identifying multiple pathogens. The multiplex fluorescent quantitative PCR detection technology combines the high sensitivity of fluorescence and the high specificity of PCR technology, can identify and differentiate multiple pathogens in one reaction, and can realize batch operation. At present, there is no related research report on the multiplex fluorescent quantitative PCR detection method for the above prawn culture diseases. SUMMARY

[0004] ​​​The technical problem to be solved by the present application is to provide a shrimp breeding pathogenic bacteria multiplex fluorescent quantitative PCR detection kit, which can simultaneously detect eight shrimp breeding pathogens, i.e., Vibrio parahaemolyticus, white spot syndrome virus, hepatopancreatic reed of shrimp, infectious hypodermal and hematopoietic necrosis virus, Decapod iridescent virus 1, bacterial acute hepatopancreatic necrosis disease pathogen of shrimp, Vibrio harveyi and highly pathogenic Vibrio.

[0005] The technical solution adopted by the present application to solve the above technical problem is: a shrimp breeding pathogenic bacteria multiplex fluorescent quantitative PCR detection kit, which contains primers and probes for detecting shrimp breeding pathogenic bacteria, wherein the shrimp breeding pathogenic bacteria include Vibrio parahaemolyticus, white spot syndrome virus, hepatopancreatic reed of shrimp, infectious hypodermal and hematopoietic necrosis virus, Decapod iridescent virus 1, bacterial acute hepatopancreatic necrosis disease pathogen of shrimp, Vibrio harveyi and highly pathogenic Vibrio.

[0006] Further, the primers and probes are respectively for TDH-related hemolysin gene of Vibrio parahaemolyticus, ORF107 gene of white spot syndrome virus, small subunit ribosomal gene of hepatopancreatic reed of shrimp, 37 kDa coat protein gene of infectious hypodermal and hematopoietic necrosis virus, DNA primase gene of Decapod iridescent virus 1, PirA&PirB gene of bacterial acute hepatopancreatic necrosis disease pathogen of shrimp, hemolysin gene of Vibrio harveyi and tcdB gene of highly pathogenic Vibrio.

[0007] Further, the primers and probes for TDH-related hemolysin gene of Vibrio parahaemolyticus are respectively: The nucleotide sequence of the Vp-F forward primer is GACTATTGGACAAACCGAA, The nucleotide sequence of the Vp-R reverse primer is CAGCCATCGTATAGTTGTG, The nucleotide sequence of the Vp-T probe is AACCCGCAGTTGTGAAAACCG; The primers and probes for ORF107 gene of white spot syndrome virus are respectively: The nucleotide sequence of the WSSV-F forward primer is TGTGAATTGGCGAGACCCTT, The nucleotide sequence of the WSSV-R reverse primer is TGCAGTTTCTTCCTCGATGACAAC, The nucleotide sequence of the WSSV-T probe is TCGCGCCCCTACACCCACT; The primers and probes for the small subunit ribosomal gene of the hepatopancreatic cymatocystidium of shrimp are respectively: The nucleotide sequence of the EHP-F forward primer is TAACTCAACGCGGGAAAACTT, The nucleotide sequence of the EHP-R reverse primer is GTTCCAGCACTTAAGCTAAAAG, The nucleotide sequence of the EHP-T probe is GTGCATGGCCGTTGGAAATTG; The primers and probes for the 37 kDa coat protein gene of the infectious hypodermal and hematopoietic necrosis virus are respectively: The nucleotide sequence of the IHHNV-F forward primer is AATACCAACAACCGGACCC, The nucleotide sequence of the IHHNV-R reverse primer is ATGAAGATCTGTTGCCAGTCG, The nucleotide sequence of the IHHNV-T probe is ACCTAGTCTACCCAGCAGACCAC; The primers and probes for the DNA primase gene of the decapod iridovirus 1 are respectively: The nucleotide sequence of the DIV1-F forward primer is AGCTGCAAGTCCCGAAT, The nucleotide sequence of the DIV1-R reverse primer is CGTTTCCCGTGAGACCC, The nucleotide sequence of the DIV1-T probe is CCATGACTGCCCATCTAACACCAT; The primers and probes for the PirA and PirB genes of the bacterial pathogen of acute hepatopancreas necrosis disease of shrimp are respectively: The nucleotide sequence of the VpAHPND-F forward primer is ACCATTTACAACGCCCTGA, The nucleotide sequence of the VpAHPND-R reverse primer is TTCGTTAGTCATGTGAGCACCT, The nucleotide sequence of the VpAHPND-T probe is TAACAATGGCGCTAGTCGTGGTTT; The primers and probes for the hemolysin gene of the Vibrio harveyi are respectively: The nucleotide sequence of the Vh-F forward primer is CTGTCATGCAGCCAGACCAA, The nucleotide sequence of the Vh-R reverse primer is AACCGTTTGAGAAGTGTCCCAA, The nucleotide sequence of the Vh-T probe is CTGTCACCCAACGCTACGACCT; The primers and probe of the tcdB gene of the high pathogenic Vibrio are respectively: The nucleotide sequence of the HLV-F forward primer is ACTCTACCGGCCATCAGT, The nucleotide sequence of the HLV-R reverse primer is ATATCCTGTCGGCACAACCA, The nucleotide sequence of the HLV-T probe is ACGAACCCTCTTGGCTTGCT.

[0008] Further, the fluorescent label of the probe is modified as follows: the 5' end of the TDH-related hemolysin gene probe sequence of Vp is modified as 6-FAM, and the 3' end is modified as BHQ1; the 5' end of the ORF107 gene probe sequence of WSSV is modified as HEX, and the 3' end is modified as BHQ1; the 5' end of the small subunit ribosomal gene probe sequence of EHP is modified as ROX, and the 3' end is modified as BHQ2; the 5' end of the 37 kDa coat protein gene probe sequence of IHHNV is modified as Cy5, and the 3' end is modified as BHQ3; the 5' end of the DNA primase gene probe sequence of DIV1 is modified as 6-FAM, and the 3' end is modified as BHQ1; the 5' end of the PirA&PirB gene probe sequence of VpAHPND is modified as HEX, and the 3' end is modified as BHQ1; the 5' end of the hemolysin gene probe sequence of Vh is modified as Cy5, and the 3' end is modified as BHQ2; the 5' end of the tcdB gene probe sequence of HLV is modified as ROX, and the 3' end is modified as BHQ3.

[0009] Further, the reaction system in the kit comprises: 1-5 μL of NDA template, 0.1-0.5 vt% of Triton X-100, 1.3-1.7 wt% of digitonin, 0.1-1 wt% of sodium dodecyl sulfonate, 0.1-10 mM of EDTA, 0.8-1.2 wt% of Chelex-100, 10-100 mM of Tris-HCl, 50-100 mM of KCl, 0.1-1 M of trehalose, 0.5-2 wt% of polyethylene glycol, 0.1-0.5 mg / mL of bovine serum albumin, 2.0-8.0 wt% of PVP, 2.0-8.0 wt% of α-cyclodextrin, 1-10 mM of dithiothreitol, 1.0-7.0 mM of magnesium ions, 0.1-0.3 mM of dNTPs, 0.8-1.5 U of hot-start Taq DNA polymerase, 0.1-0.2 μL of 8 primers of pathogens each with a concentration of 20 μM, and 0.1-0.3 μL of 8 probes of pathogens each with a concentration of 20 μM.

[0010] Further, the reaction procedure is as follows: 95 ℃ for 60 s; 95 ℃ for 3-5 s, 58-62 ℃ for 7-15 s, and a total of 40 or 45 cycles.

[0011] Compared with the prior art, the present application has the following advantages: 1. The present application is based on TaqMan probe technology, has strong specificity and avoids false positives; and in combination with fluorescence quantitative PCR technology, has high sensitivity.

[0012] 2. The present application can simultaneously realize identification and quantification of eight shrimp breeding pathogens, i.e., Vibrio parahaemolyticus, white spot syndrome virus, hepatopancreatic reed of Litopenaeus vannamei, infectious hypodermal and hematopoietic necrosis virus, Decapoda iridescent virus 1, bacterial acute hepatopancreas necrosis disease pathogen of Litopenaeus vannamei, highly pathogenic Vibrio and Vibrio harveyi.

[0013] 3. The present application is simple in operation, saves detection cost, can meet the demand of large-scale rapid detection of pathogenic bacteria, and has a wide application prospect. BRIEF DESCRIPTION OF DRAWINGS

[0014] Figure 1 Fig. 3 is a multiple fluorescence quantitative PCR sensitivity experiment result of embodiment three; Figure 2 Fig. 4 is a multiple fluorescence quantitative PCR specificity experiment result of embodiment four; Figure 3 Fig. 5 is a result of detection of pathogenic positive nucleic acid mixture by the multiple TaqMan qPCR method of application example 1 in embodiment six; Figure 4The results of detecting pathogen-positive nucleic acid mixtures using the multiplex TaqMan qPCR method in Example 2 are shown in Specific Example 6. Detailed Implementation

[0015] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments.

[0016] Specific Implementation Example 1: Primer and Probe Design for Multiplex Quantitative Real-Time PCR of Shrimp Farming Pathogens Step 1: Target gene selection and sequence analysis Vibrio parahaemolyticus ( V. parahaemolyticus TDH-related hemolysin gene (Vp), vitiligo syndrome virus ( white spot syndrome virus The ORF107 gene of WSSV and the shrimp hepatocellular carcinoma (E Infectious hypodermal and hematopoietic necrosis virus The small subunit ribosomal gene of EHP, infectious subcutaneous and hematopoietic necrosis virus (EHP) Decapod iridescent virus 1 The 37 kDa coat protein gene of IHHNV, Decapoda iridovirus 1 (IHHNV) Vibrio parahaemolyticus DNA primase gene of DIV1, pathogen of bacterial acute hepatopancreatic necrosis in shrimp ( causing AHPND Vibrio harveyi The PirA & PirB genes of VpAHPND, Vibrio harveyi ( High pathogenic Vibrio The hemolysin gene of Vh and highly pathogenic Vibrio ( Figure 1 Using the tcdB gene of HLV as the target gene, intraspecific conserved regions and interspecific regions were identified through NCBI blast analysis and multiple sequence alignment analysis, and primers and probes were designed.

[0017] Step 2: Design and modification of fluorescent probes The different probes were modified by different fluorescent labeling. The 5' end of the probe sequence of the TDH-related hemolysin gene of Vp was modified by 6-FAM, the 3' end was modified by BHQ1; the 5' end of the probe sequence of the ORF107 gene of WSSV was modified by HEX, the 3' end was modified by BHQ1; the 5' end of the probe sequence of the small subunit ribosomal gene of EHP was modified by ROX, the 3' end was modified by BHQ2; the 5' end of the probe sequence of the 37 kDa coat protein gene of IHHNV was modified by Cy5, the 3' end was modified by BHQ3; the 5' end of the probe sequence of the DNA primase gene of DIV1 was modified by 6-FAM, the 3' end was modified by BHQ1; the 5' end of the probe sequence of the PirA&PirB gene of VpAHPND was modified by HEX, the 3' end was modified by BHQ1; the 5' end of the probe sequence of the tcdB gene of HLV was modified by ROX, the 3' end was modified by BHQ3; the 5' end of the probe sequence of the hemolysin gene of Vh was modified by Cy5, the 3' end was modified by BHQ2. The specific sequences are shown in Table 1.

[0018] Table 1. Primer and probe sequences for real-time PCR .

[0019] Step 3. Preparation of primer and probe solutions The above different primers and probes were dissolved and diluted with ultrapure water to adjust the concentration to 20 μM, and stored at -20 °C for standby.

[0020] Specific embodiment two, establishment of a multiplex real-time PCR method for detecting pathogenic bacteria in shrimp culture Step 1. Sample pretreatment: take an appropriate amount (about 30-50 mg) of shrimp hepatopancreas tissue, put it into a sterile tube preloaded with 200 μL PBS, and grind it thoroughly with a grinding rod until the tissue is completely broken and a uniform homogenate is formed; add an equal volume of lysis buffer (Zhejiang Zhenghegu Biotechnology Co., Ltd., X-LXZ-48), shake well for 3-5 min, centrifuge at 12000 rpm for 1 min, and collect 1-5 μL of supernatant for PCR detection; Step 2, amplification reaction: the supernatant obtained in step 1 is used as the NDA template, and PCR amplification reaction is carried out by a portable detection device (Zhejiang Zhenghegu Biological Technology Co., Ltd., S2162). The reaction system is 20 μL, including: 1-5 μL of NDA template, 0.1%-0.5% (v / v) of Triton X-100, 1.3%-1.7% (w / v) of Digitonin, 0.1%-1% (w / v) of sodium dodecyl sulfate (SDS), 0.1-10 mM of EDTA, 0.8%-1.2% (w / v) of Chelex-100, 10-100 mM of Tris-HCl (usually at pH 8.0-9.0), 50-100 mM of KCl, 0.1-1 M of Trehalose, 0.5%-2% (w / v) of polyethylene glycol (PEG8000), 0.1-0.5 mg / mL of bovine serum albumin (BSA), 2.0%-8.0% (w / v) of PVP (polyvinylpyrrolidone), 2.0%-8.0% (w / v) of α-cyclodextrin, 1-10 mM of dithiothreitol (DTT), 1.0-7.0 mM of magnesium ion (Mg²⁺), 0.1-0.3 mM of dNTPs each, 0.8-1.5 U of hot-start Taq DNA polymerase, 0.1-0.2 μL of 8-pathogen primers (20 μM each), and 0.1-0.3 μL of 8-pathogen probes (20 μM each); the reaction program is 95 ℃ for 60 s, (95 ℃ for 3-5 s, 58-62 ℃ for 7-15 s) for 40 or 45 cycles, and the fluorescence signals of FAM, HEX, ROX and Cy5 channels are collected before the end of the extension amplification at 58-62 ℃ in each cycle.

[0021] Step 3, result analysis according to the amplification curve If the amplification result is a good "S" type amplification curve and the Ct value is ≤38, it is determined to be positive (generally 40 cycles, if the Ct value is ≤38, but the S type amplification curve is not fully displayed, the experiment can be performed again for confirmation, and the cycle number of the second experiment is set to 45 cycles); if there is no amplification curve and the Ct value is >40, it is determined to be negative, if the sample to be tested has an S type amplification curve in a certain gene channel, and 38

[0022] Specific embodiment three, establishment of multiplex fluorescent quantitative PCR standard curve for pathogenic bacteria of shrimp culture and sensitivity analysis Step 1: Construction of positive plasmid standards The amplified sequences of the eight pathogens listed in Table 1 above were submitted to Sangon Biotech (Shanghai) Co., Ltd. for sequence synthesis and inserted into the pUC57 plasmid to construct positive plasmid standards, named as follows: pVp, pVh, pVpAHPND, pWSSV, pEHP, pDIV1, pIHHNV, and pHLV. The concentration of positive clones was tested, and the plasmid copy number was calculated using the following formula: DNA copy number (copies / μL) = [6.02 × 10⁻⁶] 23 × plasmid concentration (ng / μL) × 10 -9 [DNA length × 660]. Different positive standards were diluted to a concentration of 10. 9 Copies / μL, store at -20℃ for later use.

[0023] Step 2: Dilution of positive plasmids The positive plasmid standards pVp, pVh, pVpAHPND, pWSSV, pEHP, pDIV1, pIHHNV, and pHLV were serially diluted tenfold to obtain 10 9 -10 3 Copy / μL.

[0024] Step 3: Quantitative Real-Time PCR Reaction and Standard Curve Construction Using the diluted recombinant plasmid standard as a template, the template was reacted according to the reaction system and reaction conditions of Example 2. Perform multiplex quantitative PCR. Plot a standard curve for multiplex quantitative PCR with the logarithm of copy number concentration on the x-axis and the Cq value amplified at each copy concentration on the y-axis. (Standard curve formula and correlation coefficient R are also provided.) 2 The amplification efficiency (E) is shown in Table 2.

[0025] Table 2 Standard curves for multiplex quantitative PCR

[0026] Table 2 shows that the correlation coefficients of the standard curves for the amplification of the eight pathogens were all 0.99 or higher. The amplification efficiency calculated from the slope of the standard curves was within the optimal range (95.64%~105.6%). When the concentration was diluted to 10... 1 At copies / μL (the template volume is 1μL, meaning the detection sensitivity reaches 10 copies), amplification curves were observed for all 8 pathogens, such as... Figure 2 As shown.

[0027] Specific Example 4: Multiplex Quantitative PCR Specificity Experiment for Shrimp Farming Pathogens The positive nucleic acid samples of DIV1, EHP, WSSV, EMS, IHHNV, HLV, Vp, Vh, and the cDNA of Taura syndrome virus (TSV), Yellow head disease (YHV), Infectious myonecrosis virus (IMNV), Covert mortality nodavirus (CMNV), Aeromonas hydrophila, Flavobacterium columnare, Pseudomonas fluorescens, Mycobacterium marinum, Edwardsiella tarda were used as templates for multiplex TaqMan qPCR detection. The results, as shown in Figure 3 The amplification curves of the templates corresponding to the primer and probe were obtained, and the Ct values were less than 35, while no amplification curves of other shrimp pathogenic nucleic acids were obtained, indicating that the method had high specificity.

[0028] Specific embodiment five, multiplex fluorescent quantitative PCR repeatability experiment of shrimp breeding pathogenic bacteria The multiplex TaqMan qPCR method established in embodiment 2 was used for repeatability experiment of plasmid standard pVp, pVh, pVpAHPND, pWSSV, pEHP, pDIV1, pIHHNV and pHLV with three concentrations (10 5 , 10 4 , 10 3 copies / μL), and three repeated intragroup experiments and three repeated intergroup experiments under the same conditions at three different time periods were performed. At the same time, the coefficient of variation (CV) was calculated by the Cq value of each dilution to evaluate the repeatability of the method. The results showed that the multiplex fluorescent quantitative PCR detection method established had good repeatability.

[0029] Table 3 multiplex fluorescent quantitative PCR repeatability experiment .

[0030] Specific embodiment six, application of multiplex fluorescent quantitative PCR kit Application example 1: based on the detection channel of portable detection equipment, eight pathogens were divided into two reaction systems, four pairs of primers and probes of Vp, EHP, WSSV and IHHNV were placed in one tube for detection, and four pairs of primers and probes of DIV1, HLV, Vh and VpAHPND were placed in one tube for detection, and the multiplex fluorescent quantitative qPCR method detection was performed by using the reaction system and procedure of specific embodiment 2, and the template was a mixture of eight pathogenic nucleic acids, and the detection results were as follows Figure 4The results of each reaction system have corresponding positive amplification curves, which shows that the multiplex TaqMan qPCR method is good.

[0031] In application example 2, when the qPCR with 6 color fluorescence channels (Zhejiang Zhenghe Valley Biotechnology Co., Ltd., S6162) is used, 8 kinds of pathogens can be divided into 2 reaction systems, such as Vp, EHP, WSSV, IHHNV, HLV and VpAHPND six pairs of primers and probes in one tube for detection, DIV1, Vh two pairs of primers and probes in one tube for detection, using the system and procedure of specific embodiment two to detect the multiplex fluorescence quantitative qPCR method, the template uses 8 kinds of pathogen positive nucleic acid mixture, and the detection result is as follows ​ The results of each reaction system have corresponding positive amplification curves, which shows that the multiplex TaqMan qPCR method is good.

[0032] The amplification primers and probes designed for eight kinds of shrimp pathogens and the detection system and procedure of the application are also suitable for other qPCR detection devices with 4-8 color fluorescence channels, and only the fluorescence label of the probe needs to be changed.

[0033] The above description is not a limitation of the application, and the application is not limited to the above examples. Changes, modifications, additions or substitutions made by ordinary skilled in the art within the scope of the application should also be within the protection scope of the application.

Claims

1. A multiplex fluorescent quantitative PCR detection kit for pathogenic bacteria of shrimp culture, characterized in that: The kit contains primers and probes for detecting pathogenic bacteria of shrimp culture, wherein the pathogenic bacteria of shrimp culture include Vibrio parahaemolyticus, White Spot Syndrome Virus, Enterocytozoon hepatopenaei, Infectious Hypodermal and Hematopoietic Necrosis Virus, Decapod iridescent virus 1, the pathogen of acute hepatopancreas necrosis disease of shrimp, Vibrio harveyi and Vibrio penaeicida.

2. The multiplex fluorescent quantitative PCR detection kit for pathogenic bacteria in shrimp culture according to claim 1, characterized in that: The primers and probes are respectively for TDH-related hemolysin gene of Vibrio parahaemolyticus, ORF107 gene of White Spot Syndrome Virus, small subunit ribosomal gene of Enterocytozoon hepatopenaei, 37 kDa coat protein gene of Infectious Hypodermal and Hematopoietic Necrosis Virus, DNA primase gene of Decapod iridescent virus 1, PirA&PirB gene of the pathogen of acute hepatopancreas necrosis disease of shrimp, tcdB gene of Vibrio harveyi and hemolysin gene of Vibrio penaeicida.

3. The multiplex fluorescent quantitative PCR detection kit for pathogenic bacteria of shrimp culture according to claim 1, characterized in that: The primers and probes for TDH-related hemolysin gene of Vibrio parahaemolyticus are respectively: The nucleotide sequence of Vp-F forward primer is GACTATTGGACAAACCGAA, The nucleotide sequence of Vp-R reverse primer is CAGCCATCGTATAGTTGTG, The nucleotide sequence of Vp-T probe is AACCCGCAGTTGTGAAAACCG; The primers and probes for ORF107 gene of White Spot Syndrome Virus are respectively: The nucleotide sequence of WSSV-F forward primer is TGTGAATTGGCGAGACCCTT, The nucleotide sequence of WSSV-R reverse primer is TGCAGTTTCTTCCTCGATGACAAC, The nucleotide sequence of WSSV-T probe is TCGCGCCCCTACACCCACT; The primers and probes for small subunit ribosomal gene of Enterocytozoon hepatopenaei are respectively: The nucleotide sequence of EHP-F forward primer is TAACTCAACGCGGGAAAACTT, The nucleotide sequence of EHP-R reverse primer is GTTCCAGCACTTAAGCTAAAAG, The nucleotide sequence of EHP-T probe is GTGCATGGCCGTTGGAAATTG; The primers and probes for 37 kDa coat protein gene of Infectious Hypodermal and Hematopoietic Necrosis Virus are respectively: The nucleotide sequence of IHHNV-F forward primer is AATACCAACAACCGGACCC, The nucleotide sequence of IHHNV-R reverse primer is ATGAAGATCTGTTGCCAGTCG, The nucleotide sequence of IHHNV-T probe is ACCTAGTCTACCCAGCAGACCAC; The primers and probes of the DNA primase gene of the Decapitida iridovirus 1 are respectively: The nucleotide sequence of the DIV1-F forward primer is AGCTGCAAGTCCCGAAT, The nucleotide sequence of the DIV1-R reverse primer is CGTTTCCCGTGAGACCC, The nucleotide sequence of the DIV1-T probe is CCATGACTGCCCATCTAACACCAT; The primers and probes of the PirA&PirB gene of the bacterial pathogen of acute hepatopancreas necrosis disease of shrimp are respectively: The nucleotide sequence of the VpAHPND-F forward primer is ACCATTTACAACGCCCTGA, The nucleotide sequence of the VpAHPND-R reverse primer is TTCGTTAGTCATGTGAGCACCT, The nucleotide sequence of the VpAHPND-T probe is TAACAATGGCGCTAGTCGTGGTTT; The primers and probes of the hemolysin gene of the Vibrio harveyi are respectively: The nucleotide sequence of the Vh-F forward primer is CTGTCATGCAGCCAGACCAA, The nucleotide sequence of the Vh-R reverse primer is AACCGTTTGAGAAGTGTCCCAA, The nucleotide sequence of the Vh-T probe is CTGTCACCCAACGCTACGACCT; The primers and probes of the tcdB gene of the highly pathogenic Vibrio are respectively: The nucleotide sequence of the HLV-F forward primer is ACTCTACCGGCCATCAGT, The nucleotide sequence of the HLV-R reverse primer is ATATCCTGTCGGCACAACCA, The nucleotide sequence of the HLV-T probe is ACGAACCCTCTTGGCTTGCT.

4. The multiplex fluorescent quantitative PCR detection kit for pathogenic bacteria of shrimp culture according to claim 3, characterized in that The fluorescent label modification of the probes is as follows: the 5' end of the probe sequence of the TDH-related hemolysin gene of Vp is modified as 6-FAM, and the 3' end is modified as BHQ1; the 5' end of the probe sequence of the ORF107 gene of WSSV is modified as HEX, and the 3' end is modified as BHQ1; the 5' end of the probe sequence of the small subunit ribosomal gene of EHP is modified as ROX, and the 3' end is modified as BHQ2; the 5' end of the probe sequence of the 37 kDa coat protein gene of IHHNV is modified as Cy5, and the 3' end is modified as BHQ3; the 5' end of the probe sequence of the DNA primase gene of DIV1 is modified as 6-FAM, and the 3' end is modified as BHQ1; the 5' end of the probe sequence of the PirA&PirB gene of VpAHPND is modified as HEX, and the 3' end is modified as BHQ1; the 5' end of the probe sequence of the hemolysin gene of Vh is modified as Cy5, and the 3' end is modified as BHQ2; the 5' end of the probe sequence of the tcdB gene of HLV is modified as ROX, and the 3' end is modified as BHQ3.

5. The multiplex fluorescent quantitative PCR detection kit for pathogenic bacteria of shrimp culture according to any one of claims 1-4, characterized in that The reaction system in the kit comprises: 1-5 μL of NDA template, 0.1-0.5 vt% of Triton X-100, 1.3-1.7 wt% of digitonin, 0.1-1 wt% of sodium dodecyl sulfate, 0.1-10 mM of EDTA, 0.8-1.2 wt% of Chelex-100, 10-100 mM of Tris-HCl, 50-100 mM of KCl, 0.1-1 M of trehalose, 0.5-2 wt% of polyethylene glycol, 0.1-0.5 mg / mL of bovine serum albumin, 2.0-8.0 wt% of PVP, 2.0-8.0 wt% of α-cyclodextrin, 1-10 mM of dithiothreitol, 1.0-7.0 mM of magnesium ions, 0.1-0.3 mM of dNTPs, 0.8-1.5 U of hot-start Taq DNA polymerase, 0.1-0.2 μL of 8-pathogen primers each at a concentration of 20 μM, and 0.1-0.3 μL of 8-pathogen probes each at a concentration of 20 μM.

6. The multiplex fluorescent quantitative PCR detection kit for pathogenic bacteria of shrimp culture according to claim 5, characterized in that The reaction procedure is: 95 ℃ for 60 s; 95 ℃ for 3-5 s, 58-62 ℃ for 7-15 s, for a total of 40 or 45 cycles.

Images