A multiplex PCR detection kit for identifying and distinguishing between salmonella pullorum and salmonella gallinarum

Abstract

The application belongs to the field of biotechnology detection, and particularly relates to a multiplex PCR detection kit for identifying and distinguishing chicken pullorum salmonella and chicken typhoid salmonella. The kit comprises stn gene detection primers, I137_14445 gene detection primers and ybgL gene detection primers. The kit can quickly, high-throughput and accurately identify and distinguish chicken pullorum salmonella and chicken typhoid salmonella, can replace traditional salmonella serological typing and biochemical identification and other complex procedures, and provides a simple, rapid, reproducible new method for monitoring and laboratory diagnosis of chicken pullorum salmonella and chicken typhoid salmonella.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology detection, specifically relating to a multiplex PCR detection kit for rapid identification and differentiation of Salmonella pullorum and Salmonella typhi. Background Technology

[0002] Salmonella infection is a public health concern. The pathogen, *Salmonella*, belongs to the Enterobacteriaceae family. Eggs, livestock, and meat products are the main transmission vectors. It can cause various diseases in livestock and poultry, leading to systemic septicemia and enteritis. Fowl typhoid and pullorum disease are caused by *Salmonella pullorum* and *Salmonella typhi*, respectively. *Salmonella pullorum* primarily infects chicks aged 2-3 weeks, causing white diarrhea with a high mortality rate. Adult chickens have a lower mortality rate after infection but can shed the virus for a long period. *Salmonella typhi* can cause disease in both chicks and adult chickens, characterized by anemia, leukocytosis, and hemorrhage. Therefore, *Salmonella pullorum* / *Salmonella typhi* are serious bacterium threats in my country's poultry industry. Currently, based on the Kauffman-White (KW) serotyping method and differences in *Salmonella* somatic and flagellate antigens, there are over 2650 serotypes of *Salmonella*. China has reported 292 different serotypes belonging to 35 O groups.

[0003] Traditional detection methods, including non-selective and selective enrichment, biochemical characterization, and serological identification, are laborious and time-consuming. Furthermore, distinguishing between *Salmonella pullorum* and *Salmonella typhi* requires additional biochemical reactions, taking 4-7 days to complete. Other methods, such as antibody testing, while rapid, suffer from high false-positive rates, making them unsuitable for routine detection. Therefore, there is an urgent need for rapid, specific, and sensitive detection methods to promptly identify *Salmonella pullorum* and *Salmonella typhi*, which is crucial for the effective prevention and control of these two diseases. Summary of the Invention

[0004] To address the problems existing in the prior art, the purpose of this invention is to provide a rapid multiplex PCR detection kit for identifying and differentiating Salmonella pullorum and Salmonella typhi, as well as its preparation and application.

[0005] To achieve the above and other related objectives, the present invention adopts the following technical solution:

[0006] In a first aspect, the present invention provides a multiplex PCR detection kit for identifying and distinguishing Salmonella pullorum and Salmonella typhimurium, the kit comprising detection primers for the stn gene, the I137_14445 gene, and the ybgL gene, wherein the detection primers for the stn gene, the I137_14445 gene, and the ybgL gene comprise forward primers with nucleotide sequences as shown in SEQ ID NO.1, SEQ ID NO.3, and SEQ ID NO.5 and reverse primers with nucleotide sequences as shown in SEQ ID NO.2, SEQ ID NO.4, and SEQ ID NO.6.

[0007] The kit of this invention uses multiplex PCR detection technology to detect the stn gene, I137_14445 gene, and ybgL gene. Based on the amplification and detection results, it can be analyzed to determine whether the tested organism belongs to Salmonella pullorum or Salmonella typhimurium. Therefore, primer design is the key to the kit of this invention.

[0008] Since the kit described in this invention uses PCR technology for detection, it can also include other commonly used PCR reagents, such as sterile water (ddH2O), dNTPs, PCR buffer, rTaq enzyme, and genomic DNA extraction reagents. Because these commonly used PCR reagents can be purchased commercially or prepared in-house, the specific reagents to be included in the kit can be configured according to the customer's actual needs. For convenience, all reagents can also be included in the kit.

[0009] The kit of the present invention may contain individually packaged primer pairs or may contain pre-prepared PCR detection solution containing primer pairs.

[0010] The PCR detection solution can be prepared by the user or obtained by adding primers to a commercially available primer-free universal PCR detection solution. For example, the kit may also contain sterile water (ddH2O), dNTPs, PCR buffer, and rTaq enzyme. The PCR reaction system can be obtained by adding the primers of this invention, DNA extract of the sample to be tested, or bacterial culture of the sample.

[0011] Preferably, the kit may also contain a positive control. The positive control is a DNA sample containing the genome of Salmonella pullorum or Salmonella typhimurium.

[0012] Preferably, the kit may also contain a negative control. The negative control may be a DNA sample of non-cowlick / typhoid Salmonella.

[0013] A second aspect of the present invention provides a method for using the aforementioned rapid PCR detection kit for identifying and differentiating Salmonella pullorum and Salmonella typhi, comprising the following steps:

[0014] (1) Extract genomic DNA from the sample;

[0015] (2) Sample addition: Add the sample genomic DNA, positive control or negative control to the PCR tube containing the PCR reaction system to obtain the corresponding sample reaction tube, positive reaction tube or negative reaction tube. The PCR reaction system contains the aforementioned detection primers for the stn gene, I137_14445 gene and ybgL gene.

[0016] (3) PCR reaction: Place the reaction tube on the PCR instrument, set the cycling parameters, and perform the PCR reaction;

[0017] (4) After the PCR reaction is completed, analyze the results.

[0018] Preferably, the method is for non-disease diagnosis purposes.

[0019] In step (1), extracting genomic DNA from the sample is a current technique.

[0020] Preferably, in step (3), the PCR reaction conditions are set as follows: (a) 94℃ for 3 min; (b) 94℃ for 40 s; (c) 53℃ for 30 s; (d) 72℃ for 60 s, steps (b) to (d) are repeated 30 times, and (e) 72℃ for 10 min.

[0021] A third aspect of the present invention provides the use of the aforementioned kit in the preparation of detection products for the stn gene, I137_14445 gene, and ybgL gene.

[0022] Preferably, the detection product is used to detect and screen Salmonella pullorum and Salmonella typhi, respectively.

[0023] Compared with the prior art, the present invention has the following beneficial effects:

[0024] This invention, through extensive and in-depth research, has for the first time discovered that the I137_14445 gene is not present in *Salmonella typhi*, but is present in *Salmonella pullorum* and other serotypes. Compared with the ybgL gene of *Salmonella typhi* and other serotypes, the *Salmonella pullorum* ybgL gene lacks a 68bp nucleotide sequence. The stn gene serves as an internal reference gene for multiplex PCR. Therefore, the distribution of the I137_14445 gene and the ybgL gene in different serotypes of *Salmonella* and other bacteria was verified using multiplex PCR with specific primers. The kit of this invention can rapidly and with high throughput identify and differentiate *Salmonella pullorum* and *Salmonella typhi*, replacing the complex procedures of traditional *Salmonella* serological typing and biochemical identification, and providing a simple, rapid, and reproducible new method for the monitoring and laboratory diagnosis of *Salmonella pullorum* and *Salmonella typhi*. Attached Figure Description

[0025] Figure 1 This diagram illustrates the identification and differentiation of Salmonella pullorum and Salmonella typhimurium using the I137_14445 and ybgL genes; SP represents Salmonella pullorum and SG represents Salmonella typhimurium. The I137_14445 gene is not present in Salmonella typhimurium. Compared with the ybgL genes of Salmonella typhimurium and other serotypes of Salmonella, the ybgL gene of Salmonella pullorum lacks a 68bp nucleotide sequence, meaning that Salmonella pullorum cannot amplify the ybgL fragment. The red arrows indicate primer positions.

[0026] Figure 2 Images show the distribution of the stn, I137_14445, and ybgL genes in different serotypes of Salmonella and other bacteria, identified by multiplex PCR. Lane M is the DL2000 marker; *S. pullorum* represents *Salmonella pullorum*, and *S. gallinarum* represents *Salmonella typhi*. A total of 75 Salmonella strains were tested, representing 29 different serotypes, and 43 non-Salmonella strains were also tested, including *Brucella*, *Mycobacterium tuberculosis*, *Staphylococcus aureus*, *Campylobacter jejuni*, *Campylobacter coli*, *Escherichia coli*, *Shigella*, and *Listeria monocytogenes*. The amplified band size for the stn gene was 731 bp, for the I137_14445 gene was 525 bp, and for the ybgL gene was 307 bp.

[0027] Figure 3The sensitivity of the PCR detection kits for identifying Salmonella pullorum and Salmonella typhi were determined. Lane M in (A) was the DL2000 Marker. Lanes 1, 3, 5, 7, and 9 contained the Salmonella pullorum S06004 genome, and lanes 2, 4, 6, 8, and 10 contained the Salmonella typhi SG9 genome. The genome concentrations in lanes 1-2, 3-4, 5-6, 7-8, and 9-10 were 21.4 ng / μl, 2.14 ng / μl, 214 pg / μl, 21.4 pg / μl, and 2.14 pg / μl, respectively. (B) Lane M is labeled with DL2000 Marker; lanes 1, 3, 5, 7, and 9 contain Salmonella pullorum S06004, and lanes 2, 4, 6, 8, and 10 contain Salmonella typhi SG9; the bacterial count in lanes 1-2, 3-4, 5-6, 7-8, and 9-10 is 10. 5 CFU, 10 4 CFU, 10 3 CFU, 10 2 CFU, 10 1 CFU. Detailed Implementation

[0028] Before further describing specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terminology used in the embodiments of the present invention is for describing specific embodiments and not for limiting the scope of protection of the present invention.

[0029] When numerical ranges are given in the embodiments, it should be understood that, unless otherwise stated in the present invention, both endpoints of each numerical range and any value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art. In addition to the specific methods, apparatus, and materials used in the embodiments, based on the knowledge of the prior art possessed by one of ordinary skill in the art and the description of this invention, any prior art methods, apparatus, and materials similar to or equivalent to those described, apparatus, and materials in the embodiments of this invention may be used to implement the present invention.

[0030] Example 1: Identification of the distribution of the I137_14445 and ybgL genes using bioinformatics methods

[0031] The I137_14445 and ybgL genes were searched in the whole genome database using the BLASTN online alignment software (http: / / blast.ncbi.nlm.nih.gov / Blast.cgi) in NCBI. The search results showed that the I137_14445 gene was absent in *Salmonella typhi*, but was found only in *Salmonella pullorum* and other serotypes of *Salmonella*. Compared to the ybgL gene in *Salmonella typhi* and other serotypes of *Salmonella pullorum*, the ybgL gene in *Salmonella pullorum* lacked a 68bp nucleotide sequence, meaning that *Salmonella pullorum* could not amplify the ybgL fragment. Based on the distribution characteristics of these two genes, these two serotypes of *Salmonella* can be identified and distinguished. Figure 1 ).

[0032] Example 2 Preparation of the reagent kit

[0033] Primer design and synthesis: Primers were designed and analyzed using the stn, I137_14445, and ybgL genes as templates, respectively. The stn gene template sequence is shown in SEQ ID NO.7, the I137_14445 gene template sequence is shown in SEQ ID NO.8, and the ybgL gene template sequence is shown in SEQ ID NO.9, as detailed below.

[0034] SEQ ID NO.7:

[0035] TTGTTAATCCTGTTGTCTCGCTATCACTGGCAACCAGATAGTAAAGACCGCGCCTTTACCCTCAATACTTTTCACCTTAATCGCGCCGCCATGCTGTTCGATGATATTTTGCACCACAGCCAGCCCCAGGCCTGTCCCGTCAGCTTTGGTCGTAAAATAAGGCGTAAAAATCGCCTCCAGCTGATCCGGGGCGATCCCTTTCCCGCTATCGGTAACAGTGATGATAACGCGGTCGGTCCCACTTTCTTTTGCCTCTACGCTAATCGTTCCCTGGCGGCCAATCGCATGAATAGCGTTCAGGTACAGATTCAACAGCACCTGAGTCAGCCTGTCCGGGTCAGCCTGAATACGCTTAAGCGTCTCATTCGCCGTGAATCTCAACTGAATCTCTCTGCTTTGGGCATCCTGACTGACCAGATTCAGGGAGTGAGTAATAATATCATTGAGGTTAACCGTCTGGAGCGTCAGATGCGCGGGCTTTACCAGTTCGAGCAATTCGCTTACCACCCGGTTCAAACGGTCGGCCTCTTTGGCCATCACCTGCGCCAGTTCATGCGACTCGCCGCCGGCAGGCGTGCGCTCGGCAAAGTATTTCGCCAGCCCTTTGATGGACGAGAGCGGGTTACGAATTTCGTGCGCGACGCCCGCCGCCAGATGCCCCATCGCCACCAGCTTTTCTTTACGCTTCATTGCATCAAGCAGTTCTCTGTGCGAGCGCTGATAACGCTGATGCCAAAAAAACGCCAGTAA

[0036] SEQ ID NO.8:

[0037] TCATGATGTCGCCCCTGCGTCCTTAAACGCGCAGTTCAGGGCATCGCAGGTGTAGCGATTCATCTGCAGTCCCCCGTAATCATCAATATACCCCACCCACAGCGTCCGGGTTTCTGCCGGCAGAACAGCCTTTAAAGGCAGGTTCCCCAGGGGCGGTACCATCACGCCCTCGCGGAAACCGCTGAGCCTGTGGCTACGGTCTGCTCCCAGCCACGCCACAGTGATGTAGTACGGCGTCGGGTTTCTGAGGGTCAGATGTCCCGCATTCCGCTCAGCAGTCAGCTTTCTTTCCGGCTGGTCACTGCTGCTTCTGATAATGGCTTTCGGACGGTAAAACAGTTTCAGCTGGCTCTGCATGGCCAGTTGCAGAACGTTGTCGTCTTCTGGCTTCGGGGGAACGCCCCGCACGTTAAGCCAGAACAGTGTTTCCCTGTCCTGAGGGAGCTTATCTGTCAGCCCGCGAACCTGGGTGATGCGGACCTGGGATTTCTGTCCGGCATCAATACGCTGCAGCGGCGGCAGCGCCATCAGCGCATCGGTTCTCACCCCGTCAGCGTCCGTCACCCAGGACTGCGCCAGGAACGGCGTGGTTTTGTCATCGTTATTCAGCGTGATGGCCACCGTTTTCTGCGGCGCATCCATGATAATACGGGTCCGGTCAACATTGACGGCCGCCGGGCTGTACTGGCTCCATGCTGCCGCCAGTGCGAGTAAAATCACACGGCTTCTTCTGCTGTTTTTCAC

[0038] SEQ ID NO.9:

[0039] ATGAACATTGATTTAAATGCGGATGTGGGCGAAGGCTGCGCCAGCGACAGCGAATTATTAACGCTGGTCTCCTCCGCCAATATCGCCTGTGGTTTTCACGCCGGTGATGCGCAAACCATGCTGACCAGCGTGCGCGAGGCGCTGAAAAACGGCGTGGCGATCGGCGCGCATCCCAGCTTTCCG GATCGGGATAATTTTGGGCGGACGGCGATGGCTTTGCCGCCGGAAACGGTATACGCCCAGACGCTGTACCAAATCGGCGCGCTGGGGGCGATTGTTCAGGCGCAAGGCAGCGTGATGCGCCATGTCAAACCGCACGGTATGCTCTATAACCAGGCGGCGAAAGATCCCCATCTGGCACAGGCGA TTGCGAAAGCGGTACACGACTATGATCCGTCACTGATACTGGTTGGACTGGCGGGAAGTGAGCTGATCCGGGCCGGTGAGCGCCATCGCCTGGTGACGCGGCAGGAGGTGTTTGCCGATCGCGGCTATCAGGCCGACGGTAGCCTGGTGCCGCGCATGCAACCTGGCGCGCTGATTCACGACGA AGAGCAGGCCTGGGCAAACGCTGGATATGGTACAAGCCGGGAGAGTGAAAAGCGTTACTGGCGTGTGGACGACTGTCACGGCGCAAACGGTGTGCATTCATGGCGACGGCGAGTATGCGCTTGCATTCGCTCAGGTTACGCGCCGCGTTCAATGCGCGTAATATACACGTTATTGCCTGA

[0040] Based on the genomic DNA sequence, the optimal primer pairs for detection were selected. The stn primer amplified a partial sequence (731 bp), the I137_14445 primer amplified a partial sequence (525 bp), and the ybgL primer amplified the intermediate fragment (307 bp) of the ybgL gene from non-chicken Salmonella pullorum. Their nucleotide sequences are shown in Table 1 below.

[0041] Table 1

[0042]

[0043] The primer pairs described above can be packaged individually or formulated into PCR detection solutions. In the PCR detection solutions, the amounts of the primer pairs are 40 nM stn F / R, 80 nM I137_14445F / R, and 80 nM ybgL F / R.

[0044] In other words, the kit of the present invention may contain the above-mentioned individually packaged primer pairs, or it may contain a pre-prepared PCR detection solution containing primer pairs.

[0045] Furthermore, the kit may also contain sterile water (ddH2O), dNTPs, PCR buffer, rTaq enzyme, sample genomic DNA extraction reagents, etc.

[0046] Example 3: Specific identification of Salmonella pullorum and Salmonella typhimurium using the kit

[0047] Using the three pairs of primers in the kit described in Example 2, and with the genomes of different serotypes of Salmonella and other bacteria as templates, multiplex PCR was used to identify the distribution characteristics of the I137_14445 gene and the ybgL gene in different bacteria.

[0048] The PCR reaction system was as follows (25 μL): dNTP 2 μL, 10×PCR buffer 2.5 μL, stn-F 40 nM, stn-R 40 nM, I137_14445-F 80 nM, I137_14445-R 80 nM, ybgL-F 80 nM, ybgL-R 80 nM, template 2 μL, rTaq enzyme 0.25 μL, and ddH2O to bring the total to 25 μL.

[0049] The PCR program was 94℃ for 3 min; 94℃ for 40 s, 53℃ for 30 s, 72℃ for 60 s, for 30 cycles; 72℃ for 10 min.

[0050] PCR products were subjected to 1% agarose gel electrophoresis. The results showed that the lane using *Salmonella pullorum* genome as a template amplified two bands: the stn gene (731 bp) and the I137_14445 gene (525 bp); the lane using *Salmonella typhi* genome as a template amplified two bands: the stn gene (731 bp) and the ybgL fragment (307 bp). Figure 2 This indicates that using the specific stn, I137_14445, and ybgL amplification primers in the kit described in Example 2, multiplex PCR can be used to rapidly identify whether an unknown bacterium is Salmonella pullorum or Salmonella typhimurium.

[0051] Example 4: Sensitivity assessment of the kit for detecting Salmonella pullorum and Salmonella typhimurium.

[0052] Using the three primer pairs in the kit described in Example 2, the genomes of Salmonella pullorum S06004 and Salmonella typhi SG9 were diluted 10-fold sequentially. Using the diluted genomes as templates, the sensitivity of the kit in detecting the genomic DNA of Salmonella pullorum and Salmonella typhi was determined. The bacterial suspensions of Salmonella pullorum S06004 and Salmonella typhi SG9 were washed three times with PBS and then diluted 10-fold sequentially. Using the diluted bacteria as templates, the sensitivity of the kit in detecting the bacterial counts of Salmonella pullorum and Salmonella typhi was determined.

[0053] The PCR reaction system was as follows (25 μL): dNTP 2 μL, 10×PCR buffer 2.5 μL, stn-F 40 nM, stn-R 40 nM, I137_14445-F 80 nM, I137_14445-R 80 nM, ybgL-F 80 nM, ybgL-R 80 nM, template 2 μL, rTaq enzyme 0.25 μL, and ddH2O to bring the total to 25 μL.

[0054] The PCR program was 94℃ for 3 min; 94℃ for 40 s, 53℃ for 30 s, 72℃ for 60 s, for 30 cycles; 72℃ for 10 min.

[0055] PCR products were subjected to 1% agarose gel electrophoresis. The PCR electrophoresis results showed that the multiplex PCR detection kit based on stn, I137_14445, and ybgL could detect 21.4 pg / μL. Figure 3 A) and 100 CFU ( Figure 3 B) Salmonella pullorum and Salmonella typhi.

[0056] Example 5: Application of the reagent kit in a chicken farm

[0057] Using the kit described in Example 2, 24 strains of Salmonella isolated from a chicken farm were detected, and Salmonella pullorum and Salmonella typhimurium were quickly and accurately identified. The specific steps are as follows:

[0058] 1) Isolation of Salmonella

[0059] The samples in this experiment were collected from a chicken farm in Jiangsu Province. The collection, enrichment, isolation and physiological and biochemical identification of Salmonella were carried out in accordance with the established methods in the existing technology (Li Y, et al. Food Control, 2016; Cai Y, et al. Int J Food Microbiol, 2016). A total of 24 Salmonella strains were isolated and identified in this experiment.

[0060] 2) Multiplex PCR method for detecting Salmonella pullorum and Salmonella typhi in samples.

[0061] Twenty-four Salmonella strains were inoculated into LB liquid medium and cultured overnight at 37°C and 180 rpm. The next day, the genomes of each strain were extracted using a bacterial genome extraction kit. The stn, I137_14445, and ybgL genes were amplified using the genomes as templates. The PCR reaction system (25 μL) consisted of: 2 μL dNTPs, 2.5 μL 10×PCR buffer, 40 nM stn-F, 40 nM stn-R, 80 nM I137_14445-F, 80 nM I137_14445-R, 80 nM ybgL-F, 80 nM ybgL-R, 2 μL template, 0.25 μL rTaq enzyme, and ddH2O to a final volume of 25 μL. The PCR program was as follows: 94℃ for 3 min; 94℃ for 40 s, 53℃ for 30 s, 72℃ for 60 s, 30 cycles; 72℃ for 10 min. The PCR products were subjected to 1% agarose gel electrophoresis. The lane that amplified the stn gene (731 bp) and the I137_14445 gene (525 bp) was identified as *Salmonella pullorum*, and the lane that amplified the stn gene (731 bp) and the ybgL fragment (307 bp) was identified as *Salmonella typhi*. The results showed that 10 out of the 24 Salmonella samples could detect both the stn gene and the I137_14445 gene, namely Ch4, Ch5, Ch9, Ch10, Ch11, Ch12, Ch16, Ch17, Ch18 and Ch24. These Salmonella strains were identified as Salmonella pullorum. Two strains could detect both the stn gene and the ybgL gene, namely Ch22 and Ch23. These Salmonella strains were identified as Salmonella typhimurium (Table 2).

[0062] Table 2

[0063]

[0064]

[0065] 3) Traditional serotype identification of Salmonella

[0066] The serotype identification of the 24 Salmonella strains isolated in this experiment was performed according to existing methods (Li Y, et al. Food Control, 2016; Cai Y, et al. Int J Food Microbiol, 2016). Salmonella pullorum and Salmonella typhi were distinguished using eurythritol fermentation and ornithine decarboxylation experiments. Serological and biochemical identification results showed that 10 strains were Salmonella pullorum (Ch4, Ch5, Ch9, Ch10, Ch11, Ch12, Ch16, Ch17, Ch18, and Ch24), and 2 strains were Salmonella typhi (Ch22 and Ch23). The PCR results were completely consistent with the serotype identification and biochemical reaction results.

[0067] In this embodiment, using serotype identification and biochemical tests to screen out *Salmonella pullorum* and *Salmonella typhi* from 24 *Salmonella* strains requires at least 2 days. However, using the detection kit of Embodiment 2 of this invention, *Salmonella pullorum* and *Salmonella typhi* can be accurately screened out from 24 *Salmonella* strains in just 3 hours, with a 100% accuracy rate.

[0068] In summary, the advantages of the kit of the present invention compared with traditional serological identification methods are as follows:

[0069] Traditional serotyping requires the purchase of specific Salmonella serotyping kits, which are expensive and cumbersome. Isolating specific Salmonella serotypes (such as Salmonella pullorum and Salmonella typhi) from large samples is particularly time-consuming (at least two days) and labor-intensive. Traditional serotyping kits alone cannot distinguish between Salmonella pullorum and Salmonella typhi, requiring biochemical reactions such as euonymus alcohol fermentation and ornithine decarboxylation, with results judged visually, potentially leading to human error. In contrast, the kit of this invention offers a simple, low-cost detection method that is not limited by the bacterial form (single colony, frozen culture, or fresh culture are all acceptable). The entire identification process can be completed within three hours (including PCR and agarose gel electrophoresis) with 100% accuracy.

[0070] Therefore, the multiplex PCR detection kit for rapid identification and differentiation of Salmonella pullorum and Salmonella typhi of the present invention simplifies the traditional steps of Salmonella serotype identification and provides a new rapid identification method for screening Salmonella pullorum and Salmonella typhi in a large number of samples.

[0071] The above embodiments are merely illustrative of the principles and effects of the present invention and are not intended to limit the invention. Any person skilled in the art can modify or alter the above embodiments without departing from the spirit and scope of the present invention. Therefore, all equivalent modifications or alterations made by those skilled in the art without departing from the spirit and technical concept disclosed in the present invention should still be covered by the claims of the present invention.

Claims

1. A multiplex PCR detection kit for identifying and distinguishing Salmonella pullorum and Salmonella gallinarum, the kit comprising detection primers of stn gene, I137_14445 gene and ybgL gene, the detection primers of stn gene, I137_14445 gene and ybgL gene comprising forward primers with nucleotide sequences as shown in SEQ ID NO. 1, SEQ ID NO. 3 and SEQ ID NO. 5 and reverse primers with nucleotide sequences as shown in SEQ ID NO. 2, SEQ ID NO. 4 and SEQ ID NO.

6.

2. The test kit according to claim 1, characterized in that, The kit further comprises one or more of sterile water, dNTP, PCR buffer, rTaq enzyme and sample genomic DNA extraction reagent.

3. The test kit according to claim 1, characterized in that, The kit further comprises one or more of positive control or negative control.

4. The test kit according to claim 3, characterized in that, The positive control is a DNA sample containing genome of Salmonella pullorum or Salmonella gallinarum.

5. The test kit according to claim 3, characterized in that, The negative control can be a DNA sample of non-Salmonella pullorum / Salmonella gallinarum. 6.A method for using the kit according to any one of claims 1 to 5, comprising the following steps: (1) extracting sample genomic DNA; (2) adding sample: adding sample genomic DNA, positive control or negative control into PCR tubes containing PCR reaction system respectively, to obtain corresponding sample reaction tube, positive reaction tube or negative reaction tube, the PCR reaction system containing the detection primers of stn gene, I137_14445 gene and ybgL gene as described in claim 1; (3) PCR reaction: placing the reaction tube on a PCR instrument and setting cycle parameters to perform PCR reaction; (4) after the PCR reaction, analyzing the results; The method is a method for non-disease diagnosis purpose.

7. The method of claim 6, wherein, In step (3), the PCR reaction is set as follows: (a) 94℃ for 3 min; (b) 94℃ for 40 s; (c) 53℃ for 30 s; (d) 72℃ for 60 s, steps (b) to (d) are repeated for 30 times, and (e) 72℃ for 10 min. 8.Use of the kit according to any one of claims 1 to 5 in the preparation of a detection product of stn gene, I137_14445 gene and ybgL gene.

9. Use according to claim 8, characterized in that, The detection product is used for detecting and distinguishing Salmonella pullorum and Salmonella gallinarum respectively.

Images