Universal probe for multiplex nucleic acid detection, probe combination and application thereof

By designing a universal thiolized probe and a bridge probe system, and combining it with colloidal gold chromatography technology, we have achieved rapid and low-cost multiplex nucleic acid detection, solving the problems of strong equipment dependence and complex operation in existing technologies, and realizing high sensitivity and specificity detection.

CN121592789APending Publication Date: 2026-03-03WUHAN ZHONGZHI BIOTECHNOLOGIES INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511790935.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2015-10-12
Publication Date
2026-03-03

Smart Images

  • Figure CN121592789A_ABST
    Figure CN121592789A_ABST
Patent Text Reader

Abstract

The invention discloses a universal probe for multiple nucleic acid detection, a probe combination and application of the universal probe and the probe combination, aiming at the limitation that the existing nucleic acid detection technology depends on expensive equipment, is complicated to operate and is difficult to realize multiple detection. A bridging detection system is formed by innovatively designing a general probe, a specific probe series A (two ends of which are fixed in sequence and are used for connecting the general probe and a quality control line) and a specific probe series B (one end of which is fixed on a detection line); the test strip structurally comprises a sample pad, a colloidal gold pad (for fixing a universal probe), an NC (nitrocellulose) membrane (containing a plurality of detection lines and quality control lines) and absorbent paper. The method is suitable for single-stranded nucleic acid (such as NASBA amplification products) detection, has high sensitivity, high specificity (no false positive), rapidness (completion within 10 minutes) and multiple detection capability, does not need complex instruments, is low in cost, and is easy to popularize in a basic level.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of pharmaceutical technology, and in particular to a universal probe, probe combination, and its application for multiplex nucleic acid detection. This invention is a divisional application of the invention patent with application number "201510658968.8", the original application date being "October 12, 2015", and the invention title being "A method and kit for multiplex nucleic acid detection using colloidal gold chromatography technology". Background Technology

[0002] Nucleic acid detection technology, as an important method for pathogen detection, plays a crucial role in clinical diagnosis, food safety, and environmental monitoring. Compared with traditional serological testing, nucleic acid detection directly targets the genetic material (DNA or RNA) of pathogens, offering significant advantages such as high specificity, high sensitivity, and a short detection window, effectively improving pathogen detection rates. Currently, most mainstream nucleic acid detection technologies are based on polymerase chain reaction (PCR) technology, with real-time fluorescence quantitative PCR (RTFQ PCR) being the most widely used. This technology achieves quantitative analysis of target nucleic acids by monitoring changes in fluorescence signals during the amplification process in real time. Although RTFQ PCR has high sensitivity and quantitative capabilities, it relies on expensive thermal cyclers and fluorescence detection systems, resulting in high equipment costs and relatively complex operation procedures, requiring highly skilled personnel. Furthermore, RTFQ PCR has limitations in multiplexing capabilities, typically requiring complex primer-probe design and optimization processes, making it difficult to achieve low-cost, high-throughput simultaneous multi-target detection. In recent years, some isothermal amplification techniques have been introduced into the field of nucleic acid detection, attempting to overcome some of the limitations of PCR technology. For example: Nucleic Acid Sequence-based Amplification (NASBA); Rolling Circle Amplification (RCA); Loop-mediated Isothermal Amplification (LAMP); Transcription Mediated Amplification (TMA).

[0003] These technologies can complete nucleic acid amplification at constant temperatures, reducing the need for precise temperature control equipment. However, they still face some common challenges: First, most isothermal amplification methods still require instruments such as electrophoresis, fluorescence detection, or colorimetric analysis for result interpretation, making it difficult to achieve truly rapid on-site detection; second, multiplex detection usually requires the design of complex multi-primer systems, which can easily lead to cross-reactions between primers, resulting in decreased specificity; third, existing technologies often require open-tube operation for detecting amplified products, increasing the risk of aerosol contamination. Colloidal gold immunochromatography, as a mature rapid detection platform, has been widely used in the field of antigen-antibody detection. This technology utilizes probes labeled with colloidal gold particles that move on the chromatographic membrane, achieving visual interpretation of the detection results through specific binding of antigens and antibodies. It has advantages such as simple operation, rapid detection (usually 10-15 minutes), low cost, and no need for special equipment.

[0004] However, applying colloidal gold chromatography to nucleic acid detection faces several technical bottlenecks. Traditional colloidal gold nucleic acid detection methods often employ a direct labeling strategy, directly labeling colloidal gold particles with specific probes. This method has significant drawbacks: First, different gold-labeled probes need to be prepared for different detection targets, increasing production costs and process complexity. Second, single-probe detection systems have limited sensitivity, often requiring additional signal amplification steps, such as gold enhancement solution treatment, which increases operational steps and time costs. Third, direct labeling methods have inherent limitations in multiplex detection; different gold-labeled probes may interfere with each other, affecting detection specificity. Brittany A. Rohrman et al. attempted to use colloidal gold chromatography for HIV nucleic acid detection, but their single-probe capture method suffered from insufficient sensitivity, requiring gold enhancement solution to reach acceptable detection limits. This method failed to solve the problem of multiplex detection, and the detection process is relatively cumbersome, hindering its promotion in primary healthcare institutions. Furthermore, existing nucleic acid detection technologies primarily target double-stranded DNA for amplification products, while research on direct detection methods for single-stranded nucleic acids (such as RNA generated by NASBA amplification) is relatively insufficient. Single-stranded nucleic acid detection requires addressing issues such as probe design specificity, hybridization efficiency, and non-specific binding, which presents even greater challenges on colloidal gold chromatography platforms.

[0005] Therefore, there is an urgent need in this field to develop a novel nucleic acid detection method that can combine the advantages of colloidal gold chromatography technology in terms of simplicity and speed, while achieving high sensitivity and high specificity in multiplex detection, especially for single-stranded nucleic acid targets, without the need for complex instruments and equipment, making it easy to promote and apply in primary healthcare institutions. Summary of the Invention

[0006] The purpose of this invention is to provide a universal probe, probe combination, and its application for multiplex nucleic acid detection. This probe combination is suitable for the detection of single-stranded nucleic acids (such as NASBA amplification products) and has high sensitivity (detection limit up to 10). 5 It features high specificity (no false positives), rapid detection (completed within 10 minutes), and multiplex detection capabilities (can simultaneously detect pathogens such as Mycoplasma pneumoniae and Chlamydia pneumoniae). It requires no complex instruments, is low in cost, and is easy to promote at the grassroots level.

[0007] To achieve the aforementioned objective, the present invention adopts the following technical solution: In a first aspect of the invention, a universal probe for multiplex nucleic acid detection is provided, the nucleotide sequence (5'-3') of the universal probe being: SH-CATCTTCCAGCGGCCTTATGCAGTTGCTCTCCATTTTTAGAAGGCGTCCGTCTTTGAGGC (SEQ ID NO: 1), SH represents a thiol group, and the 5' end is modified with a thiol group. Other chemical groups can also be modified, such as -NH2 (amino).

[0008] Furthermore, the probe is suitable for the detection of single-stranded nucleic acids.

[0009] In a second aspect of the invention, a specific probe combination is provided, the combination comprising: The aforementioned universal probe; At least one specific probe A comprises the following: the 5' end hybridizes with the universal probe, the middle end hybridizes with the single-stranded nucleic acid to be tested, and the 3' end hybridizes with the coating sequence of the test strip control line.

[0010] At least one specific probe B comprises the following: one end hybridizes to the single-stranded nucleic acid to be tested, and the other end hybridizes to the coating sequence of the T line of the test strip.

[0011] Furthermore, the nucleotide sequence (5'-3') at the 5' end of the specific probe A for hybridization with the universal probe is: GCCTCAAAGACGGACGCCTTCT (SEQ ID NO:17). The nucleotide sequence (5'-3') at the 3' end of the specific probe A, which is used to hybridize with the coating sequence of the control line on the test strip, is: GTTCGAGCCACGTCCTCATTAG (SEQ ID NO:18).

[0012] Furthermore, the specific probes A and B are designed for Mycoplasma pneumoniae and include: (1) Primer sequences (5'-3') for amplifying the nucleic acid to be tested: R primer: TAATACGACTCACTATAGGGAGACTCGTGAACTTGGTGTGGTTT (SEQ ID NO: 2), F primer: GGCAGTCAGACGATGATTACAGGC (SEQ ID NO:3); (2) Specific probe A sequence (5'-3'): GTTCGAGCCACGTCCTCATTAGTTTTCCTCCAGCTCTGAACGTTTTGCCTCAAAGACGGACGCCTTCT (SEQ ID NO: 4), GTTCGAGCCACGTCCTCATTAGTTTTATGATAAGGCTTCAAGTTTTGCCTCAAAGACGGACGCCTTCT (SEQ ID NO: 5); (3) Specific probe B sequence (5'-3'): GGTTCGCCTCGAAGAATTTTCTGTAGGAATGAATGT (SEQ ID NO:6), CCCTCGACCAAGCCAATTTTCTGTAGGAATGAATGT (SEQ ID NO:7); (4) Nucleic acid sequence (5'-3') of the detection line coating: ACATTCATTCCTACAG (SEQ ID NO:8).

[0013] The specific probes A and B are designed for Chlamydia pneumoniae and include: (1) Primer sequences (5'-3') for amplifying the nucleic acid to be tested: R primer: TAATACGACTCACTATAGGGAGAATACGTGAGCAGCTCTCTCGTT (SEQ ID NO:9) F primer: AGACTTCATGCAAATTGTTTCC (SEQ ID NO:10); (2) Specific probe A sequence (5'-3'): GTTCGAGCCACGTCCTCATTAGTTTTTTGTGGAGTTACTGTATTTTGCCTCAAAGACGGACGCCTTCT (SEQ ID NO: 11), GTTCGAGCCACGTCCTCATTAGTTTTGGAGCTACTTTAGTTGTTTTGCCTCAAAGACGGACGCCTTCT (SEQ ID NO: 12); (3) Specific probe B sequence (5'-3'): TGTCAGATCAACAAGTTTTTGTAGGCCTTCAAGCCGTCCA (SEQ ID NO: 13), TTAAATCTAGAAAAGCTTTTGTAGGCTCTCAAGCCGTCCA (SEQ ID NO: 14); (4) Nucleic acid sequence (5'-3') of the detection line coating: TGGACGGCTTAGAGGCCTAC (SEQ ID NO: 15); (5) Nucleic acid sequence (5'-3') coated with the quality control line: CTAATGAGGACGTGGCTCGAAC (SEQ ID NO: 16).

[0014] In a third aspect of the invention, the use of the probe combination described herein is provided in the preparation of a kit for the multiplex detection of single-stranded nucleic acids for pathogens.

[0015] Furthermore, the pathogens are selected from parasites, fungi, bacteria, viruses, mycoplasma, and chlamydia.

[0016] In a fourth aspect of the invention, a nucleic acid detection kit is provided, comprising the aforementioned probe combination.

[0017] Furthermore, the kit is used for multiplex detection of Mycoplasma pneumoniae and Chlamydia pneumoniae.

[0018] This invention provides a rapid colloidal gold-labeled detection method for multiplex nucleic acid detection, applying the advantages of colloidal gold immunochromatography—simple operation, speed, and low cost—to the multiplex detection of nucleic acids. The method includes the following steps: (1) Probe design: universal probe, specific probe series A and specific probe series B for each nucleic acid to be tested. The 5' end of the universal probe is thiolized and labeled with colloidal gold particles, which can hybridize with specific probe series A. Specific probe series A consists of three parts: one end can hybridize with the universal probe, the middle can hybridize with the nucleic acid to be tested, and the other end can hybridize with the nucleic acid coated on the C line of the NC membrane. There can be multiple specific probe series A for a nucleic acid to be tested, such as A1, A2, etc., which can hybridize with different regions of the nucleic acid to be tested respectively. Specific probe series B consists of two parts: one end can hybridize with the nucleic acid to be tested, and the other end can hybridize with the nucleic acid coated on the corresponding T line of the NC membrane. There can be multiple specific probe series B for a nucleic acid to be tested, such as B1, B2, etc., which can hybridize with different regions of the nucleic acid to be tested respectively.

[0019] (2) Preparation of colloidal gold test strips: The test strips are fixed on a PVC base plate, and from left to right are a sample pad, a glass cellulose membrane, an NC membrane, and absorbent paper; the NC membrane has a T line (detection line) and a C line (control line); the detection line is coated with a nucleic acid sequence that can specifically hybridize and bind to a specific probe B series targeting a nucleic acid to be tested, and there is one or more detection lines; the C line is coated with another nucleic acid sequence that can specifically hybridize and bind to a specific probe A series; the universal probe labeled with colloidal gold is placed on the colloidal gold pad of the test strip, and the specific probe A series, specific probe B series and the specific amplification product of the nucleic acid to be tested are hybridized and dropped onto the sample pad for chromatography. The color development of the detection line indicates the presence of the nucleic acid to be tested, and the color development of the control line indicates that the detection is effective.

[0020] The universal probe can be used to detect each nucleic acid molecule to be tested. When designing it, the GC% ratio must be carefully considered to minimize non-specific binding with gold particles. The universal probe must also pay attention to the Tm value of its binding sites with other probes to maximize hybridization effectiveness at lower temperatures. Based on experimental comparisons, the published universal probe sequence is the optimal design sequence. The universal probe sequence (5'-3') is as follows: SH-CATCTTCCAGCGGCCTTATGCAGTTGCTCTCCATTTTTAGAAGGCGTCCGTCTTTGAGGC (SEQ ID NO.1), where SH is a thiol group and the 5'-end is a thiol-modified group. Other chemical groups can also be modified, such as -NH2 (amino group).

[0021] Based on the working principle, the working process of the above-mentioned method of the present invention is described as follows: 1. Design three types of probes: a universal probe, a specific probe A (multiple probes are possible, such as A1, A2, etc.), and a specific probe B (multiple probes are possible, such as B1, B2, etc.). The universal probe is thiol-modified at its 5' end to label colloidal gold particles and can hybridize complementary to the specific probe A series. The specific probe A series consists of three parts: one end hybridizes with the universal probe, the middle end hybridizes with the target nucleic acid, and the other end hybridizes with the nucleic acid coated at the C-line on the NC membrane. The specific probe B series consists of two parts: one end hybridizes with the target nucleic acid, and the other end hybridizes with the nucleic acid coated at the T-line on the NC membrane.

[0022] 2. A sequence is coated at the "T line" (detection line) on the NC membrane. This sequence can hybridize with the specific probe B series to capture the specific probe B and form the T line. Another sequence is coated at the "C line" (quality control line). This sequence can hybridize with the specific probe A to capture the hybridization complex of the specific probe A and the free gold-labeled universal probe and form the C line.

[0023] 3. After the general probe is labeled with colloidal gold particles, it can hybridize with the specific probe A series to form a gold particle general probe-specific probe A complex.

[0024] 4. When a nucleic acid fragment to be tested is available, the nucleic acid to be tested can hybridize and bind with the specific probe B series to form a nucleic acid to be tested-specific probe B complex.

[0025] 5. Hybridize the nucleic acid-specific probe B complex formed in step 4 with the gold particle universal probe-specific probe A complex formed in step 3 to form the gold particle universal probe-specific probe A-nucleic acid-specific probe B complex.

[0026] 6. The colloidal gold complex obtained in step 5 flows forward along the fibrous membrane of the test strip via capillary action. When it reaches the T-line, the sequence on the specific probe B series hybridizes and binds to the sequence coated at the T-line, thus retaining the complex obtained in step 5 on the T-line, forming a visible colored band, which is a positive result (as shown in Figure 1). Alternatively, 7. When the nucleic acid fragment to be tested is absent, steps 4-5 will not occur, and the gold particle universal probe-specific probe A-specific amplification product-specific probe B complex cannot be formed. Therefore, the colloidal gold particles cannot aggregate at the T line, and no visible band will form; this is a negative result (e.g., Figure 2 ).

[0027] 8. Regardless of whether there is a nucleic acid fragment to be tested, there will be an excess of the gold particle universal probe-specific probe A complex. The excess complex will cross the T line and continue to flow forward along the fiber membrane. When it reaches the C line, it will bind to the sequence coated at the C line and remain at the C line, forming a visible colored band. This indicates that the experimental result is valid.

[0028] This invention successfully applies colloidal gold immunochromatography to the detection of nucleic acid fragments, enabling rapid, simple, and multiplex nucleic acid detection. The invention employs direct gold labeling of nucleic acids to prepare the labeled detection probes. The connection between the probes and the nucleic acid is covalently bonded, which is more effective than labeling haptens and antibodies with colloidal gold via electrostatic adsorption. The gold-labeled probe sequence used in this invention is a universal sequence. This universal sequence is modified at its 5' end with thiol (or other chemical groups, such as -NH2 (amino)) and then labeled with colloidal gold particles, serving as a universal colored probe that can be used for the detection of nucleic acids from all pathogens. With this universal gold-labeled probe, multiplex detection of pathogen nucleic acids can be achieved on the same test strip. In multiplex detection of pathogen nucleic acids, all pathogen nucleic acids share the same colored probe. By designing specific probes for different pathogen nucleic acids, the detection of multiple nucleic acids on the same test strip can be completed, avoiding the inconvenience of one pathogen per colloidal gold particle probe, and significantly reducing detection costs.

[0029] All detection probes used in this invention, except for the universal probe labeled with colloidal gold particles, are of conventional design and do not have special requirements for the nucleic acid fragments to be detected. No labeling or modification of the nucleic acid fragments to be detected is required. This greatly facilitates the amplification of pathogen nucleic acid fragments and significantly reduces the design requirements for pathogen nucleic acid amplification primers (the amplification primers do not require any modification). This invention can detect nucleic acid fragments amplified by all methods and has extremely wide applicability. This invention designs two sets of specific probes, namely specific probe A and specific probe B, for detecting the nucleic acid of a pathogen. The use of these two sets of probes ensures that if either set fails to hybridize with the amplified fragment of the pathogen's nucleic acid, it cannot form the complex detected by the test strip, thus preventing a positive result and guaranteeing the specificity of the detection. In this invention, specific probes A and B, introduced during the design process, act as bridging molecules. These two probes successfully tandemly bind the gold-labeled probe and the target nucleic acid fragment, achieving specific detection of the nucleic acid fragment. The introduction of bridging molecules allows for the design of multiple specific probes A (such as specific probes A1, A2, A3, etc.) based on different regions of the target nucleic acid fragment, enabling the binding of one target nucleic acid fragment to multiple gold-labeled probes, significantly improving detection sensitivity. When Brittany A. Rohrman et al. used colloidal gold immunochromatography to detect HIV viral nucleic acid amplification products, they did not design multiple specific probes targeting multiple sites of the HIV nucleic acid amplification fragment. Instead, they simply labeled colloidal gold particles with one probe as a specific probe to hybridize and bind to the HIV nucleic acid amplification product. The other end of the HIV nucleic acid amplification fragment was directly captured by another specific probe coated on an NC membrane, thus trapping the complex at the T-line to form a visible band. This is a successful example of colloidal gold detection of nucleic acids. However, the sensitivity of this specific single-probe capture method is not high, and a gold enhancement solution is necessary to enhance the color development and improve sensitivity. In this invention, specific probes A and B can be designed in multiples according to different regions of the nucleic acid fragment to be detected. This allows for the enrichment of multiple colloidal gold particles on a single nucleic acid molecule, significantly improving sensitivity. This invention also utilizes this bridging molecule design to achieve multiplex detection of pathogen nucleic acid fragments. Depending on the different pathogen nucleic acid fragments, we only need to redesign the middle sequence of specific probe A and specific probe B; there is no need to modify the quality control line and the design of the gold-labeled probe, making it simpler and significantly reducing costs.

[0030] One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages: 1. This invention combines the speed of colloidal gold chromatography with nucleic acid detection, significantly improving detection efficiency: Short detection time: From sample addition to result interpretation, it only takes 5-10 minutes (Example 3), which is much shorter than traditional PCR or isothermal amplification techniques (which usually take 1-2 hours). This is due to the chromatographic design of the test strip and the optimization of probe hybridization.

[0031] Simplified operation: No complex instruments or professional training are required; simply mix the amplification product with the probe and add it to the test strip. This method "has low technical requirements for experimental personnel and is easy to promote at the grassroots level."

[0032] 2. This invention achieves true multiplex detection through a universal probe design and multiple T-line coating: a single test strip can simultaneously be set with multiple detection lines (T-lines) for different pathogens (such as Mycoplasma pneumoniae and Chlamydia pneumoniae). Multiplex detection does not interfere with each other, and the sensitivity remains consistent.

[0033] 3. Cost Advantage: The universal probe (SEQ ID NO:1) can be used in all detection systems, avoiding the cost of labeling colloidal gold separately for each target. This universal probe has optimal performance, no false positives, and reduces the complexity of reagent development.

[0034] 4. This invention achieves highly sensitive detection of single-stranded nucleic acids (such as NASBA amplification products) through optimized probe design. The probe design of this invention ensures detection specificity, especially in multiplex detection scenarios: by designing specific T-line coating sequences and fixed B-ends for different pathogens, multiple targets (such as Mycoplasma pneumoniae, Chlamydia pneumoniae, H1N1, and H3N2) can be detected simultaneously on the same test strip without cross-reactivity. The detection lines for H1N1 and H3N2 do not interfere with each other and maintain specificity even at high concentrations. Attached Figure Description

[0035] Figure 1 This is a schematic diagram illustrating the principle of using colloidal gold chromatography (general probe, specific probes A and B) to detect positive results of nucleic acid.

[0036] Figure 2 This is a schematic diagram illustrating the principle of using colloidal gold chromatography (general probe, specific probes A and B) to detect negative results for the nucleic acid to be tested.

[0037] Figure 3 This is a diagram showing the assembly structure of a nucleic acid test strip.

[0038] Figure 4 The images show the results of sample testing using colloidal gold chromatography. In the images, A represents the test results containing CP and MP, B represents the test results containing CP, C represents the test results containing MP, and D represents the negative test results.

[0039] Figure 5 The results (after 5 minutes) of water detection using five universal probes labeled with colloidal gold particles are shown. The test lines are as follows: 1: Water detection result using a gold probe test strip prepared with thiolated universal probe 1 (no nonspecific detection); 2: Water detection result using a gold probe test strip prepared with thiolated universal probe 2 (nonspecific band appears at the T-line position of CPn / MP); 3: Water detection result using a gold probe test strip prepared with thiolated universal probe 3 (nonspecific band appears at the T-line position of CPn / MP); 4: Water detection result using a gold probe test strip prepared with thiolated universal probe 4 (no nonspecific detection); 5: Water detection result using a gold probe test strip prepared with thiolated universal probe 5 (no nonspecific detection).

[0040] Figure 6Results of detecting nucleic acid (unamplified) in human pharyngeal swab samples after 5 minutes using gold probes labeled with five universal probes: 1: Gold probe test strip prepared with thiolized universal probe 1 showed no nonspecific detection of nucleic acid (unamplified) in human pharyngeal swab samples; 2: Gold probe test strip prepared with thiolized universal probe 2 showed a nonspecific band at the T-line position of CPn / MP in human pharyngeal swab samples; 3: Gold probe test strip prepared with thiolized universal probe 3 showed a nonspecific band at the T-line position of CPn / MP in human pharyngeal swab samples; 4: Gold probe test strip prepared with thiolized universal probe 4 showed no nonspecific detection of nucleic acid (unamplified) in human pharyngeal swab samples; 5: Gold probe test strip prepared with thiolized universal probe 5 showed no nonspecific detection of nucleic acid (unamplified) in human pharyngeal swab samples.

[0041] Figure 7 The results of high-concentration CPn / MPNASBA amplification products were detected under different hybridization incubation conditions after labeling colloidal gold particles with three universal probes. 1: Gold probe test strips prepared with thiolized universal probe 1 were used to detect 10 8 Results of CPn / MP NASBA amplification mixture with 10⁸ copies (chromatography time: 5 min): MP and CPn were positive; 2: Results of gold probe test strip prepared with thiolized universal probe 4 for CPn / MP NASBA amplification mixture with 10⁸ copies (chromatography time: 5 min): MP and CPn were weakly positive; 3: Results of gold probe test strip prepared with thiolized universal probe 5 for 10⁸ copies of CPn / MP NASBA amplification mixture (chromatography time: 5 min): MP and CPn were weakly positive. 8 Results of CPn / MPNASBA amplification mixture of copies (chromatography time: 5 min), weak positive for MP and CPn; 4: detection of 10 copies of gold probe test strip prepared by thiolized universal probe 1. 8 Results of CPn / MP NASBA amplification mixture of copies (chromatography time: 10 min), MP and CPn were positive; 5: Gold probe test strip prepared with thiolized universal probe 4 detected 10 8 Results of CPn / MP NASBA amplification mixture of copies (chromatography time: 10 min), positive for both MP and CPn; 6: Gold probe test strip prepared with thiolized universal probe 5 to detect 10 8 Results of CPn / MP NASBA amplification mixture of copies (chromatography time: 10 min), positive for both MP and CPn; 7: Gold probe test strip prepared with thiolized universal probe 1 detected 10 8Results of CPn / MP NASBA amplification mixture of copies (chromatography time: 20 min), positive for both MP and CPn; 8: Detection of 10 copies of the gold probe test strip prepared with thiolized universal probe 4. 8 Results of CPn / MP NASBA amplification mixture of copies (chromatography time: 20 min), positive for both MP and CPn; 9: Detection of 10 by gold probe test strip prepared with thiolized universal probe 5. 8 Results of CPn / MP NASBA amplification mixture of copies (chromatography time: 20 min), MP and CPn were positive.

[0042] Figure 8 The results of amplification products of medium concentrations of CPn / MPNASBA were detected under different hybridization incubation conditions after labeling colloidal gold particles with three universal probes. 1: Gold probe test strips prepared with thiolized universal probe 1 were used to detect 10 6 Results of CPn / MPNASBA amplification mixture (chromatography time: 5 min) at copies, MP and CPn were positive; 2: Gold probe test strip prepared with thiolized universal probe 4 detected 10 6 Results of CPn / MP NASBA amplification mixture (chromatography time: 5 min), MP and CPn detection negative; 3: Gold probe test strip prepared with thiolized universal probe 5 detected 10 6 Results of CPn / MPNASBA amplification mixture of copies (chromatography time: 5 min), MP and CPn detection negative; 4: Gold probe test strip prepared with thiolized universal probe 1 to detect 10 6 Results of CPn / MP NASBA amplification mixture of copies (chromatography time: 10 min), MP and CPn were positive; 5: Gold probe test strip prepared with thiolized universal probe 4 detected 10 6 Results of CPn / MP NASBA amplification mixture of copies (chromatography time: 10 min), positive for both MP and CPn; 6: Gold probe test strip prepared with thiolized universal probe 5 to detect 10 6 Results of CPn / MP NASBA amplification mixture of copies (chromatography time: 10 min), MP and CPn were positive. 7: Detection of 10 copies of the gold probe test strip prepared with the thiolized universal probe 1. 6 Results of CPn / MP NASBA amplification mixture of copies (chromatography time: 20 min), positive for both MP and CPn; 8: Detection of 10 copies of the gold probe test strip prepared with thiolized universal probe 4. 6Results of CPn / MP NASBA amplification mixture of copies (chromatography time: 20 min), positive for both MP and CPn; 9: Detection of 10 by gold probe test strip prepared with thiolized universal probe 5. 6 Results of CPn / MP NASBA amplification mixture of copies (chromatography time: 20 min), MP and CPn were positive.

[0043] Figure 9 The results of low-concentration CPn / MPNASBA amplification products were detected under different hybridization incubation conditions after labeling colloidal gold particles with three universal probes. 1: Gold probe test strips prepared with thiolized universal probe 1 were used to detect 10 5 Results of CPn / MPNASBA amplification mixture (chromatography time: 5 min) at copies, MP and CPn were positive; 2: Gold probe test strip prepared with thiolized universal probe 4 detected 10 5 Results of CPn / MP NASBA amplification mixture (chromatography time: 5 min), MP and CPn detection negative; 3: Gold probe test strip prepared with thiolized universal probe 5 detected 10 5 Results of CPn / MPNASBA amplification mixture of copies (chromatography time: 5 min), MP and CPn detection negative; 4: Gold probe test strip prepared with thiolized universal probe 1 to detect 10 5 Results of CPn / MP NASBA amplification mixture of copies (chromatography time: 10 min), MP and CPn were positive; 5: Gold probe test strip prepared with thiolized universal probe 4 detected 10 5 Results of CPn / MP NASBA amplification mixture (chromatography time: 10 min), MP and CPn detection negative; 6: Gold probe test strip prepared with thiolized universal probe 5 detected 10 5 Results of CPn / MP NASBA amplification mixture of copies (chromatography time: 10 min), MP and CPn detection negative; 7: Gold probe test strip prepared with thiolized universal probe 1 to detect 10 5 Results of CPn / MP NASBA amplification mixture of copies (chromatography time: 20 min), positive for both MP and CPn; 8: Detection of 10 copies of the gold probe test strip prepared with thiolized universal probe 4. 5 Results of CPn / MP NASBA amplification mixture of copies (chromatography time: 20 min), MP and CPn detection negative; 9: Detection of 10 by gold probe test strip prepared with thiolized universal probe 5. 5Results of CPn / MP NASBA amplification mixture of copies (chromatography time: 20 min), MP and CPn were negative.

[0044] Figure 10 To compare the detection effects of two probe combinations at different concentrations. Detailed Implementation

[0045] The following detailed description of the embodiments and examples will illustrate the present invention in more detail, thereby making the advantages and various effects of the embodiments more clearly apparent. Those skilled in the art should understand that these detailed embodiments and examples are for illustrative purposes only and are not intended to limit the scope of the present invention.

[0046] Throughout this specification, unless otherwise specified, the terminology used herein should be understood as having the meaning commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the embodiments of this invention pertain. In the event of any conflict, this specification shall prevail.

[0047] Unless otherwise specified, all raw materials, reagents, instruments and equipment used in the embodiments of the present invention can be obtained by purchasing them on the market or by existing methods.

[0048] The overall concept of this invention is as follows: This invention addresses the problems of existing nucleic acid detection technologies, such as strong equipment dependence, complex operation, and difficulty in achieving multiplexing, by providing an innovative colloidal gold chromatography method and kit for nucleic acid detection. The core idea of ​​this invention is to combine the simplicity and speed of colloidal gold chromatography with the high specificity of nucleic acid detection through a unique probe system design.

[0049] 1. A single universal probe is used to label colloidal gold particles. This probe covalently binds to the gold particles through thiol modification, forming a stable detection basis. The universal probe sequence is specially designed to optimize GC content and hybridization characteristics, ensuring compatibility with all detection systems. Standardized fixed-end sequences achieve multi-detection compatibility (e.g., ...). Figure 4 ).

[0050] 2. Construction of Bridge Probe System Two innovative specialized probe systems were designed: Specific probe A: As a linker molecule, one end hybridizes to a universal probe, the other end binds to a control line, and the middle part hybridizes to the target nucleic acid. Specific probe B: One end hybridizes with the target nucleic acid, and the other end binds to the detection line. This bridge design enables effective signal conversion and amplification.

[0051] 3. Multi-detection implementation mechanism By coating different capture sequences at different detection line positions, each detection line corresponds to a fixed end sequence of a specific probe B, thereby enabling the simultaneous detection of multiple targets on the same test strip.

[0052] The following will provide a detailed description of a universal probe, probe combination, and its application for multiplex nucleic acid detection, in conjunction with embodiments and experimental data.

[0053] Example 1: Universal Nucleic Acid Probe Labeling Colloidal Gold Particles 1. Design a universal probe sequence for thiolation (5'-3'): SH-CATCTTCCAGCGGCCTTATGCAGTTGCTCTCCATTTTTAGAAGGCGTCCGTCTTTGAGGC; 2. Add 20 μl of the designed universal probe (concentration 0.1 mM) to 10 μl of TCEP-HCl (concentration 100 mM), and make up the volume with water to 110 μl. Reduce the thiolized DNA universal probe at room temperature. 3. Add the processed universal probe to colloidal gold solution containing 30 nm diameter particles and incubate overnight at room temperature.

[0054] 4. Add 2% SDS solution to make the final concentration 0.01%, and incubate at room temperature for 30 minutes.

[0055] 5. Add 2M NaCl dropwise to the solution until the final concentration is 0.15M.

[0056] 6. Centrifugation purification of gold-labeled nucleic acid probe: Centrifuge at 15000 rpm for 15 min, wash the precipitate four times with washing buffer (0.15M NaCl, 0.01% SDS), and resuspend the colloidal gold precipitate in resuspension buffer (0.15M NaCl, 5% BSA, 0.25% Tween, 10% sucrose) to obtain the labeled universal nucleic acid probe-labeled colloidal gold particles.

[0057] Example 2: Preparation of Nucleic Acid Test Strips The main raw materials required for preparing nucleic acid test strips include: glass fiber membrane, nitrocellulose membrane (NC membrane), sample pad, absorbent paper, and PVC base plate.

[0058] 1. Preparation of colloidal gold pads: Cut glass fiber membranes into 0.5×1cm square modules. Add 10μl of gold-labeled nucleic acid probe solution evenly to each module using a pipette. Allow the modules to dry at room temperature and then seal and store for later use.

[0059] 2. Spraying film: Detection line (T line): Capable of capturing and binding specific probe B sequence (5 μM), spray volume: 2~3 μl / cm; Control line (C line): Capable of capturing and binding specific probe A sequence (5 μM), spray volume: 2~3 μl / cm; After the film is sprayed, place the film strip at room temperature to dry, automatically crosslink it once in a UV crosslinker, dry it in a clean constant temperature oven at 37℃ for 2 hours, and store it in a dry environment for later use.

[0060] 3. Test strip assembly Cut 2cm lengths of absorbent paper, coated NC membrane, glass fiber membrane for adsorbing gold-labeled probes, and sample pad, and fix them sequentially onto a PVC base plate from top to bottom to form the test strip. The assembly structure diagram of the test strip is shown below. Figure 3 .

[0061] Example 3: Detection of Mycoplasma pneumoniae (MP) and Chlamydia pneumoniae (Cpn) nucleic acid amplification fragments using a universal multiplex test strip. 1. For the detection of Mycoplasma pneumoniae (MP) (all sequences below are in the 5'-3' orientation) (1) Primer sequences for amplifying MP nucleic acid: R primer: TAATACGACTCACTATAGGGAGACTCGTGAACTTGGTGTGGTTT F primer: GGCAGTCAGACGATGATTACAGGC (2) The specific probe A1 sequences (two sequences) for detecting MP are: GTTCGAGCCACGTCCTCATTAGTTTTCCTCCAGCTCTGAACGTTTTGCCTCAAAGACGGACGCCTTCT GTTCGAGCCACGTCCTCATTAGTTTTATGATAAGGCTTCAAGTTTTGCCTCAAAGACGGACGCCTTCT (3) The specific probes B1 (two probes) for detecting MP are: GGTTCGCCTCGAAGAATTTTCTGTAGGAATGAATGT CCCTCGACCAAGCCAATTTTCTGTAGGAATGAATGT (4) The T-line envelope sequence for detecting MP is: ACATTCATTCCTACAG 2. For the detection of Chlamydia pneumoniae (Cpn) (1) Primer sequences for amplifying Cpn nucleic acid: R primer: TAATACGACTCACTATAGGGAGAATACGTGAGCAGCTCTCTCGTT F primer: AGACTTCATGCAAATTGTTTCC (2) The specific probe A1 sequences (two sequences) for detecting Cpn are: GTTCGAGCCACGTCCTCATTAGTTTTTTGTGGAGTTACTGTATTTTGCCTCAAAGACGGACGCCTTCT; GTTCGAGCCACGTCCTCATTAGTTTTGGAGCTACTTTAGTTGTTTTGCCTCAAAGACGGACGCCTTCT; (3) The specific probe sequences B1 and B2 for detecting Cpn (two sequences) are as follows: TGTCAGATCAACAAGTTTTTGTAGGCCTTCAAGCCGTCCA; TTAAATCTAGAAAAGCTTTTGTAGGCCTTCAAGCCGTCCA; (4) The T-line envelope sequence for detecting Cpn is: TGGACGGCTTAGAGGCCTAC; The encapsulated sequence at line C is: CTAATGAGGACGTGGCTCGAAC; 3. Methods (1) T7 linear amplification of Mycoplasma pneumoniae and Chlamydia pneumoniae nucleic acid fragments: Table 1

[0062] After reacting at 95℃ for 2 min and 42℃ for 2 min, add 1 μl of amplification enzyme mixture (AMV & T7 polymerase & RNaseH), react at 42℃ for 45 min, and then test.

[0063] (2) Detection of Mycoplasma pneumoniae and Chlamydia pneumoniae specific amplification products in (1): Table 2

[0064] After incubating at 42℃ for 10 minutes, apply the sample to the test strip and observe the results after 5 minutes (as shown in Figure 4). Figure 4 It can be seen that the test strip can detect MP and CPn simultaneously, with clear color development and no mutual interference.

[0065] Example 4: Performance Comparison Experiment of Colloidal Gold Particles Labeled by Different Universal Probes Objective: This embodiment aims to systematically evaluate the detection performance of different designed universal probes on labeled colloidal gold particles, including specificity, sensitivity, and stability, to verify the superiority of the universal probe sequence (SEQ ID NO:1) of this invention. By comparing the designs of five thiolated universal probes, experimental basis is provided for probe selection in this invention.

[0066] I. Methods 1. Probe Design: Preparation of five universal thiolation probes: Table 3

[0067] All probes were labeled with 30 nm colloidal gold particles by thiol modification (method as in Example 1).

[0068] 2. Test strip preparation: Assemble the test strip according to the method in Example 2, fix the colloidal gold pad with universal probe labeling, and encapsulate the detection line (T line) and control line (C line) sequences of Mycoplasma pneumoniae (MP) and Chlamydia pneumoniae (CPn) with NC membrane.

[0069] 3. Test samples: The test subjects include water, extracted human pharyngeal swab nucleic acid (without NASBA amplification), 108 copies of CPn / MP NASBA amplification mixture, 106 copies of CP / MP NASBA amplification mixture, and 105 copies of CPn / MP NASBA amplification mixture.

[0070] The NASBA amplification fragment of the CPn pathogen was 176 bp in length and had a GC content of 44%; the NASBA amplification fragment of the MP pathogen was 323 bp in length and had a GC content of 48%. Based on the formula "mass (g) = copy number × (average molecular weight (g / mol) × sequence length (bp)) / Avogadro's constant" (assuming a GC content of 50% and an average molecular weight of 330 g / mol), the masses of the NASBA amplification products at each concentration were calculated as follows: Table 4

[0071] 4. Detection procedure: Mix the sample with specific probes A series (10 μM each) and B series (1 μM each), add chromatography buffer (10x SSC + 0.4% SDS) to 100 μL, hybridize at 42℃ for 10 min, and then spot the sample. Observe the chromatography results at 5 min, 10 min, and 20 min.

[0072] II. Results 1. Specificity test results Results of testing negative samples after labeling colloidal gold particles with five universal probes are as follows: Figure 5 and Figure 6 As shown, Universal probes 1 and 4, 5 showed no false positives in detecting negative samples from water and human throat swabs, while universal probes 2 and 3 showed nonspecific bands at the T-line position of CPn / MP. This indicates that the design of universal probe 1 (in this invention) avoids nonspecific binding.

[0073] 2. Sensitivity Comparison Results Results of detecting NASBA amplification products of different concentrations of CPn / MP using different universal probes are as follows: Figure 7 , Figure 8 and Figure 9 As shown.

[0074] For high concentrations of NASBA products (10) 8 All universal probes showed positive results after 10 min of chromatography (copies); however, for low concentration products (10 copies), all probes showed positive results. 5 (Copies), only universal probe 1 showed a positive result after 5 minutes of chromatography, while probes 4 and 5 required up to 10 minutes to develop color, and the signal was weaker. The detection limit of universal probe 1 is 10. 5 Copies (Fink Level) are significantly superior to other designs.

[0075] III. Conclusion In summary, this embodiment, through systematic comparative experiments, demonstrates the significant advantages of the universal probe 1 (SEQ ID NO: 1) of the present invention in terms of sensitivity and specificity. 1. Specificity analysis Universal probes 2 and 3 exhibited nonspecific bands when detecting negative samples. This is due to insufficient spatial resistance caused by the poly(A) sequence design, which easily leads to nonspecific binding. In contrast, universal probe 1, through reasonable GC content design and sequence optimization, effectively avoids false positive results and ensures the reliability of the detection.

[0076] 2. Sensitivity Analysis Universal probe 1 is used to detect low concentration samples (10 5 The sequence exhibits optimal performance when used with copies of the original, developing color within 5 minutes, with detection limits reaching the femtogram level (18 fg for MP, 9.7 fg for CPn). This indicates that the sequence design, while ensuring hybridization efficiency, reduces non-specific binding to gold particles and improves detection sensitivity.

[0077] 3. Stability and practicality Universal probe 1 exhibited stable detection performance at different chromatography time points and achieved ideal detection results without extending the hybridization time. This is of great significance in practical applications, as it can significantly shorten detection time and improve detection efficiency. This experiment fully verifies the rationality and superiority of the universal probe sequence design of this invention, laying a solid foundation for subsequent multiplex nucleic acid detection applications. As shown in Example 4, the detection method of this invention has high sensitivity (detection limit up to 10). 5 The high specificity (no false positives) and high number of copies of multiplex nucleic acid testing provide core support for its reliability.

[0078] Example 5: Evaluation of the impact of probe number on detection sensitivity I. Experimental Objective This embodiment aims to study the effect of the number (single vs. multiple) of specific probe A and specific probe B on nucleic acid detection sensitivity, verify the signal amplification effect of the multi-site hybridization strategy, and provide experimental basis for the optimization of probe combination in this invention.

[0079] II. Experimental Materials and Methods 1. Pathogen selection and probe design Mycoplasma pneumoniae (MP) and Chlamydia pneumoniae (CPn) were selected as target pathogens, and two different probe combination schemes were designed: Table 5 - MPn Detection System

[0080] Table 6 - CPn Detection System

[0081] 2. Experimental Sample Preparation Preparation of CPn / MP NASBA amplification products at different concentrations: High concentration: 10 8 copies / mL Medium concentration: 10 6 copies / mL Low concentration: 10 5 copies / mL 3. Testing System and Process Composition of the chromatography reaction system: CPn / MP amplification product / water analyte: 10 μL CPn-Specific Probe Series B (1μM): 1μL per probe CPn-Specific Probe Series A (10μM): 1μL per probe MP-Specific Probe Series B (1μM): 1μL per probe MP-Specific Probe Series A (10μM): 1μL per probe Chromatography buffer (10×SSC + 0.4% SDS): Add to a final volume of 100 μL Reaction conditions: After hybridization incubation at 42℃ for 10 min, take 100 μL of the mixture and spot it on the sample pad of the test strip. Observe the chromatography results at 5 min, 10 min and 20 min respectively.

[0082] III. Experimental Results 1. Comparison of test results for samples with different concentrations The results are as follows Figure 10 As shown, by comparing the detection effects of the two probe combinations at different concentrations, it was found that the multi-site probe design significantly improved the detection sensitivity: High concentration sample (10 8 Detection results (copies): Both probe combination 1 and combination 2 showed positive results for MP and CPn detection lines. There was no significant difference in color intensity between the two, and clear detection results could be obtained within 5 minutes.

[0083] Comparison of test results for medium and low concentration samples: 10 6 At a concentration of copies, probe combination 1 showed weak positive or negative results for both MP and CPn, while probe combination 2 showed significantly positive results for both MP and CPn. 10 5 At a concentration of copies, probe combination 1 showed no detection signal, while probe combination 2 still showed a clear positive band.

[0084] 2. The impact of detection time on results Results at different chromatography time points show that multi-site probe combinations can achieve ideal detection results in a relatively short time: (1) Chromatography results after 5 min: Probe assembly 2 in 10 5 Color development is achieved at a concentration of copies, while probe combination 1 only requires 10 copies. 8 Colorimetric development at concentration of copies (2) Chromatography results after 10 min: Probe combination 2 achieved stable results at all concentrations, while probe combination 1 achieved stable results at 10... 8 Color development begins at a concentration of copies. (3) Chromatography results after 20 min: The difference between the two decreased, but the color intensity of probe combination 2 was still significantly better than that of combination 1.

[0085] IV. Experimental Conclusions 1. Signal amplification mechanism of multisite hybridization This experiment demonstrates that multi-site binding on the same target molecule can be achieved by increasing the number of specific probes A and B. This design is equivalent to enriching more colloidal gold particles on each target nucleic acid molecule, thereby generating a stronger detection signal. Experimental results show that the detection sensitivity of probe combination 2 (multiple probes) is nearly 100 times higher than that of combination 1 (single probe).

[0086] 2. The practical value of improved sensitivity Detection sensitivity from 10 8 copies increased to 10 5 Copies have significant practical value. In clinical sample testing, many early-stage infections present with low pathogen loads, and highly sensitive detection methods can identify infections earlier, providing valuable time for timely treatment.

[0087] 3. Key Technical Aspects of Probe Design Multi-site probe design requires careful attention to avoid interference between probes. The hybridization sites of each probe should be kept at an appropriate distance to ensure effective binding to the target. The probe sequences in this experiment were optimized to maintain both high sensitivity and specificity.

[0088] Finally, it should be noted that the terms “comprising,” “including,” or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such process, method, article, or apparatus.

[0089] Although preferred embodiments of the present invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments as well as all changes and modifications falling within the scope of the embodiments of the present invention.

[0090] Obviously, those skilled in the art can make various modifications and variations to the embodiments of the present invention without departing from the spirit and scope of the embodiments of the present invention. Therefore, if these modifications and variations to the embodiments of the present invention fall within the scope of the claims of the embodiments of the present invention and their equivalents, the embodiments of the present invention are also intended to include these modifications and variations.

Claims

1. A universal probe for multiplex nucleic acid detection, characterized in that, The nucleotide sequence of the universal probe is as follows: 5'-SH-CATCTTCCAGCGGCCTTATGCAGTTGCTCTCCATTTTTAGAAGGCGTCCGTCTTTGAGGC-3' (SEQ ID NO:1), wherein the 5' end is modified with a thiol group, and is used to label colloidal gold particles.

2. The universal probe according to claim 1, characterized in that, The probe is suitable for the detection of single-stranded nucleic acids.

3. A specific probe array, characterized in that, The combination includes: The universal probe as described in claim 1; At least one specific probe A comprises the following: its 5' end hybridizes with the universal probe of claim 1, its middle end hybridizes with the single-stranded nucleic acid to be tested, and its 3' end hybridizes with the coating sequence of the test strip control line. At least one specific probe B comprises the following: one end hybridizes to the single-stranded nucleic acid to be tested, and the other end hybridizes to the coating sequence of the T line of the test strip.

4. The specific probe combination according to claim 3, characterized in that, The nucleotide sequence at the 5' end of the specific probe A, used for hybridization with the universal probe, is as follows: 5'-GCCTCAAAGACGGACGCCTTCT-3' (SEQ ID NO: 17); The nucleotide sequence at the 3' end of the specific probe A, which is used to hybridize with the coating sequence of the control line on the test strip, is: 5'-GTTCGAGCCACGTCCTCATTAG-3' (SEQ ID NO:18).

5. The specific probe combination according to claim 3, characterized in that, The specific probes A and B are designed for Mycoplasma pneumoniae and include: (1) Primer sequences for amplification of the nucleic acid to be tested: R primer: 5'-TAATACGACTCACTATAGGGAGACTCGTGAACTTGGTGTGGTTT-3' (SEQ ID NO: 2), F primer: 5'-GGCAGTCAGACGATGATTACAGGC-3' (SEQ ID NO:3); (2) Specific probe A sequence: 5'-GTTCGAGCCACGTCCTCATTAGTTTTCCTCCAGCTCTGAACGTTTTGCCTCAAAGACGGACGCCTTCT-3' (SEQ ID NO: 4), 5'-GTTCGAGCCACGTCCTCATTAGTTTTATGATAAGGCTTCAAGTTTTGCCTCAAAGACGGACGCCTTCT-3' (SEQ ID NO: 5); (3) Specific probe B sequence: 5'-GGTTCGCCTCGAAGAATTTTCTGTAGGAATGAATGT-3' (SEQ ID NO: 6), 5'-CCCTCGACCAAGCCAATTTTCTGTAGGAATGAATGT-3' (SEQ ID NO:7); (4) Nucleic acid sequence of the detection line coating: 5'-ACATTCATTCCTACAG-3' (SEQ ID NO:8).

6. The specific probe combination according to claim 3, characterized in that, The specific probes A and B are designed for Chlamydia pneumoniae and include: (1) Primer sequences for amplification of the nucleic acid to be tested: R primer: 5'-TAATACGACTCACTATAGGGAGAATACGTGAGCAGCTCTCTCGTT-3' (SEQ ID NO:9) F primer: 5'-AGACTTCATGCAAATTGTTTCC-3' (SEQ ID NO: 10); (2) Specific probe A sequence: 5'-GTTCGAGCCACGTCCTCATTAGTTTTTTGTGGAGTTACTGTATTTTGCCTCAAAGACGGACGCCTTCT-3' (SEQ ID NO: 11), 5'-GTTCGAGCCACGTCCTCATTAGTTTTGGAGCTACTTTAGTTGTTTTGCCTCAAAGACGGACGCCTTCT-3' (SEQ ID NO: 12); (3) Specific probe B sequence: 5'-TGTCAGATCAACAAGTTTTTGTAGGCTCTCAAGCCGTCCA-3' (SEQ ID NO: 13), 5'-TTAAATCTAGAAAAGCTTTTGTAGGCCTTCAAGCCGTCCA-3' (SEQ ID NO: 14); (4) Nucleic acid sequence of the detection line coating: 5'-TGGACGGCTTAGAGGCCTAC-3' (SEQ ID NO: 15); (5) Nucleic acid sequence coated with quality control line: 5'-CTAATGAGGACGTGGCTCGAAC-3' (SEQ ID NO: 16).

7. The use of the universal probe of any one of claims 1-2 and the probe combination of any one of claims 3-6 in the preparation of a kit for multiplex detection of single-stranded nucleic acids of pathogens.

8. The application according to claim 7, characterized in that, The pathogens mentioned are selected from parasites, fungi, bacteria, viruses, mycoplasma, and chlamydia.

9. The application according to claim 7, characterized in that, The kit includes colloidal gold test strips.

10. The application according to claim 9, characterized in that, The test strip is fixed to a PVC base plate. From left to right, the components are a sample pad, glass fiber, NC membrane, and absorbent paper. The NC membrane has a T-line (detection line) and a C-line (control line). The detection line is coated with a nucleic acid sequence that can specifically hybridize and bind to the corresponding specific probe B series. There is one or more detection lines. The C-line is coated with another nucleic acid sequence that can specifically hybridize and bind to the specific probe A series. The 5' end of the universal probe is thiolized or modified with other chemical groups, such as -NH (amino). Colloidal gold particles are then labeled, and the universal probe can specifically hybridize with two complementary pairs of probe A series. The universal probe labeled with colloidal gold is fixed on the glass fiber membrane of the test strip.