Crispr-related methods and compositions for targeting fl1-1 expression
By targeting and editing the FLI-1 gene using the CRISPR/Cas12a system, the problem of regulating FLI-1 expression in existing technologies has been solved, achieving the goal of reducing GVHD and enhancing the efficacy of T-cell therapy.
Patent Information
- Application Number
- CN202480035444.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2023-05-26
- Filing Date
- 2024-05-24
- Publication Date
- 2025-12-26
AI Technical Summary
Existing technologies struggle to effectively target and edit the FLI-1 gene, particularly in immunotherapy to modulate its expression to reduce T-cell-mediated graft-versus-host disease (GVHD) and other autoimmune diseases.
Using the CRISPR/Cas12a system, gene editing, including insertion, deletion and gene knockout, is performed by targeting the FLI-1 gene with RNA-guided nucleases (such as Cas12a protein and gRNA) to enhance the immunotherapy effect of T cells.
Precise editing of the FLI-1 gene was achieved, reducing GVHD and other autoimmune diseases and enhancing the therapeutic efficacy of T cells.
Smart Images

Figure CN121219418A_ABST
Abstract
Description
Related applications
[0001] This application claims priority to U.S. Provisional Patent Application No. 63 / 504,676, filed May 26, 2023, the entire contents of which are incorporated herein by reference. Technical Field
[0002] This disclosure relates to CRISPR-related systems and components for targeting, editing, and / or regulating FLI-1 (Friend virus leukemia integration 1 transcription factor; Fli-1 proto-oncogene, ETS transcription factor) gene expression. This disclosure also relates to its disease-related methods and applications, including, for example, engineered cells (including T cells or T cell precursors), and reducing T cell-mediated graft-versus-host disease (GVHD) associated with allogeneic hematopoietic cell therapy. Background Technology
[0003] CRISPR (clustered regularly spaced short palindromic repeats) evolved in bacteria and archaea as an adaptive immune system to defend against viral attacks. Upon exposure to a virus, short segments of viral DNA are integrated into a CRISPR locus. RNA is transcribed from a portion of the CRISPR locus containing the viral sequence. This RNA contains a sequence complementary to the viral genome, mediating the targeting of the Cas protein to the target sequence in the viral genome. The Cas protein then cleaves the viral target, thereby silencing it. Naturally occurring CRISPR systems are evolutionarily classified into two classes and five types. Cas12a (also known as Cpf1) represents a class 2 type V CRISPR / Cas system adapted for genome editing in eukaryotic cells. Introducing site-specific double-strand breaks (DSBs) into the target sequence allows for gene knockout through insertion / deletion formation via endogenous DNA repair mechanisms such as non-homologous end joining (NHEJ). Introducing site-specific DSBs into target sequences can also promote gene conversion or gene correction by incorporating exogenous or endogenous homologous sequences with repair templates (e.g., homology-directed repair (HDR)).
[0004] The human FLI-1 (FLI1) gene is located on chromosome 11. The FLI-1 transcript ENST00000527786.7 contains nine exons encoding the FLI-1 protein (Fli-1 proto-oncogene, ETS transcription factor). FLI-1 is a member of the ETS transcription factor family and has been shown to play roles in embryogenesis, angiogenesis, megakaryogenesis, and the development of myeloid, erythroid, and natural killer (NK) cells. FLI-1 is expressed in hematopoietic lineages and regulates the expression of genes involved in T cell proliferation, differentiation, and cell death. Furthermore, elevated FLI-1 expression in lymphocytes is associated with autoimmune diseases. Summary of the Invention
[0005] This disclosure relates to RNA-guided nuclease-associated (e.g., CRISPR / Cas-associated) methods, genome editing systems, and compositions for targeting FLI-1 nucleic acid sequences, editing target FLI-1 nucleic acid sequences, or regulating the expression of target FLI-1 genes. This disclosure also provides genome editing systems, compositions, vectors, and methods for using CRISPR / Cas-associated components to edit target FLI-1 genes in cells (e.g., human T cells). Some aspects of this disclosure provide pharmaceutical compositions, cells, cell populations, methods, strategies, and modalities available in the context of immunotherapeutic approaches such as immuno-oncology. In some embodiments, this disclosure provides modified cells, such as T cells (or other lymphocytes), that can be used in immunotherapeutic approaches.
[0006] This document provides a genome editing system for regulating FLI-1 expression, an RNA-guided nuclease, a Cas12a (also known as Cpf1) protein (including modified Cas12a proteins (Cas12a variants)), a guide RNA, and a ribonucleoprotein (RNP) complex. In some embodiments, the RNP complex may include a guide RNA (gRNA) complexed with wild-type Cas12a or a modified Cas12a RNA-guided nuclease (modified Cas12a protein). In some embodiments, the modified Cas12a protein is an activity-enhanced AsCas12a protein with a nuclear localization sequence (NLS). In some embodiments, the AsCas12a protein contains amino acid alterations to increase activity and / or inactivate RNase activity. In some embodiments, the AsCas12a protein contains a C-terminal linker and a nuclear localization sequence. In some embodiments, the RNP complex contains a guide RNA (gRNA) molecule that targets the FLI-1 gene sequence. In some embodiments, the RNP complex is transfected into target cells and induces editing, resulting in an insertion or deletion within or near the target sequence of the FLI-1 gene. In some embodiments, the editing results in the knockout of the FLI-1 gene.
[0007] In some embodiments, the target cells provided herein are engineered cells and include one or more genome edits. In some embodiments, the target cells provided herein are immune-active cells, such as T cells, CD8+ T cells (e.g., CD8+ native T cells, central memory T cells, or effector memory T cells), CD4+ T cells, α / β T cells, γ / δ T cells, natural killer T cells (NKT cells), regulatory T cells (Tregs), stem cell memory T cells, lymphoid progenitor cells, hematopoietic stem cells, natural killer cells (NK cells), or dendritic cells. In some embodiments, the target cells further include chimeric antigen receptors (CARs). In some embodiments, the target cells are T cells, and one or more edits enhance their efficacy in immunotherapeutic treatments. For example, in some embodiments, T cells are provided that include one or more edits (resulting in loss of function of genes or proteins associated with suppressing T cell function in a therapeutic context) and / or one or more modifications (enabling expression of exogenous nucleic acids or proteins associated with enhanced T cell function in a therapeutic context). In some embodiments, the target cells provided herein include one or more genome edits, such as insertions, deletions, or additions of exogenous nucleic acid constructs resulting from RNA-guided nuclease cleavage of genomic loci. Using RNA-guided nuclease technology in the context of generating modified T cells allows for the engineering of complex alterations with enhanced clinically relevant features. Attached Figure Description
[0008] The accompanying drawings are intended to provide illustrative and schematic representations of certain aspects and embodiments of this disclosure, rather than to provide a complete list of examples. The drawings are not intended to limit or be bound to any particular theory or model, and are not necessarily to scale. Without limiting the foregoing, nucleic acids and peptides may be depicted as linear sequences or as schematic two-dimensional or three-dimensional structures; these depictions are intended to be illustrative and not to limit or bind to any particular model or theory regarding their structure.
[0009] Figure 1 The screening results for RNPs targeting FLI-1, including different guide RNAs, are depicted. The insertion / deletion fraction window (Y-axis) is a measure of the percentage of total sequencing reads showing insertions / deletions (edits) within + / - 15 bases of the expected cleavage site for each given RNP. Table 4 lists the gRNA target sequences for each screened RNP (X-axis). RNP24 is highlighted in the box.
[0010] Figure 2A-2C The RNP44 concentration response data (A) are shown as the percentage of editing determined by NGS, and the percentage of protein reduction determined by an automated Western blot system (B and C). Detailed Implementation
[0011] Definitions and abbreviations
[0012] Unless otherwise specified, each of the following terms has the meaning relating to it in this section.
[0013] The indefinite article “a” (“a” and “an”) refers to at least one of the related nouns and is used interchangeably with the terms “at least one” and “one or more”. For example, “a module” means at least one module, or one or more modules.
[0014] The term "about" or "approximately" means within an acceptable margin of error for a particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, according to practice in the art, "about" may mean within three or more standard deviations. Alternatively, "about" may mean a range of up to 20%, preferably up to 10%, more preferably up to 5%, and still more preferably up to 1%, of a given value. Alternatively, particularly for biological systems or processes, the term may mean within an order of magnitude of the value, preferably within five times, and more preferably within two times.
[0015] The conjunctions “or” and “and / or” can be used interchangeably as non-exclusive disjunctive words.
[0016] The phrase “consistently composed of” means that the described species is the dominant species, but other species may be present in trace amounts or quantities that do not affect the structure, function, or behavior of the subject composition. For example, a composition that is essentially composed of a particular species typically contains 90%, 95%, 96%, or more of that species.
[0017] A "domain" is used to describe a segment of a protein or nucleic acid. Unless otherwise specified, a domain is not required to have any specific functional properties.
[0018] "Insertion-deletion" is an insertion and / or deletion in a nucleic acid sequence. Insertion-deletion can be a product of DNA double-strand break repair, such as those formed by the genome editing system disclosed herein. Insertion-deletion most commonly occurs when breaks are repaired via "error-prone" repair pathways (such as the NHEJ pathway described below).
[0019] "Genetic conversion" refers to altering the DNA sequence by incorporating endogenous homologous sequences (such as homologous sequences within a gene array). "Genetic correction" refers to altering the DNA sequence by incorporating exogenous homologous sequences (such as exogenous single-stranded or double-stranded donor template DNA). Genetic conversion and gene correction are products of repairing DNA double-strand breaks through HDR pathways (such as those described below).
[0020] Insertion / deletion, gene shift, gene correction, and other genome editing results are typically evaluated by sequencing (most commonly by next-gen or sequencing-by-synthesis methods, but Sanger sequencing is still possible) and quantified by the relative frequency of numerical variations (e.g., ±1, ±2, or more bases) at the target site across all sequencing reads. DNA samples for sequencing can be prepared by a variety of methods known in the art and may include amplification of the target site by polymerase chain reaction (PCR), capture of DNA ends resulting from double-strand breaks, as described in the GUIDEseq method of Tsai et al. (Nat. Biotechnol. [Nature Biotechnology] 34(5): 483 (2016), which is incorporated herein by reference), or by other means well known in the art. Genome editing results can also be evaluated by in situ hybridization (e.g., the FiberComb™ system, commercially available from Genomic Vision (Bargnac, France)) and by any other suitable method known in the art.
[0021] "Alt-HDR," "alternative homology-directed repair," or "alternative HDR" are used interchangeably and refer to the process of repairing DNA damage using homologous nucleic acids (e.g., endogenous homologous sequences (e.g., sister chromatids)) or exogenous nucleic acids (e.g., template nucleic acids)). Alt-HDR differs from classic HDR in that it utilizes a different pathway and can be inhibited by the classic HDR mediators RAD51 and BRCA2. Alt-HDR also differs in that it involves single-stranded or nicked homologous nucleic acid templates, while classic HDR typically involves double-stranded homologous templates.
[0022] "Classical HDR," "classical homology-directed repair," or "cHDR" refers to the process of repairing DNA damage using homologous nucleic acids (e.g., endogenous homologous sequences (e.g., sister chromatids)) or exogenous nucleic acids (e.g., template nucleic acids)). Classical HDR typically works when there is significant excision at the double-strand break, forming at least one single-stranded portion of the DNA. In normal cells, cHDR typically involves a series of steps, such as break recognition, break stabilization, excision, stabilization of single-stranded DNA, formation of DNA cross-linking intermediates, dissociation of cross-linking intermediates, and ligation. The process requires RAD51 and BRCA2, and the homologous nucleic acids are usually double-stranded.
[0023] Unless otherwise specified, the term "HDR" as used herein encompasses both classic HDR and alt-HDR.
[0024] "Non-homologous end joining" or "NHEJ" refers to join-mediated repair and / or template-free repair, including classical NHEJ (cNHEJ) and alternative NHEJ (altNHEJ). Alternative NHEJ includes micro-homologous end joining (MMEJ), single-chain annealing (SSA), and synthesis-dependent micro-homologous end joining (SD-MMEJ).
[0025] When used in connection with the modification of molecules (such as nucleic acids or proteins), “substitute” or “alternative” does not require limiting the method, but only indicates that the substitute entity exists.
[0026] The term "knockout" refers to an inactivating mutation of a target gene, in which the product of the target gene contains a loss of function.
[0027] "Gene products" refer to the biochemical products produced by gene expression, including RNA or protein encoded by the gene.
[0028] "Target site" refers to the precise genomic sequence or locus within the target gene that guides RNA design for targeting. "Off-target site" refers to a genomic sequence or locus outside the target gene that can be edited by RNA-guided nucleases.
[0029] "Subject" refers to a human or a non-human animal. A human subject can be of any age (e.g., an infant, child, young adult, or adult) and may have a disease or require genetic alteration. Alternatively, a subject can be an animal, including but not limited to mammals, birds, fish, reptiles, amphibians, and more particularly non-human primates, rodents (e.g., mice, rats, hamsters, etc.), rabbits, guinea pigs, dogs, cats, etc. In some embodiments of this disclosure, the subject is livestock, such as cattle, horses, sheep, or goats. In some embodiments, the subject is poultry.
[0030] "α / β T cells" refer to T lymphocytes that express αβ T cell receptors (TCRs), while "γ / δ T cells" express γδ TCRs.
[0031] As used herein, "therapeutic effective amount" means the amount of cells and / or compositions that, when administered to a subject to treat a disease, are sufficient to beneficially affect the treatment of such disease.
[0032] "Treatment" means treating a subject's (e.g., a human subject) disease, including one or more of the following: suppressing the disease, i.e., stopping or preventing its development or progression; alleviating the disease, i.e., causing the disease state to subside; reducing one or more symptoms of the disease; and curing the disease.
[0033] "Prevent", "preventing" and "prevention" refer to the prevention of disease in mammals (such as humans), including: (a) avoiding or preventing disease; (b) influencing the tendency toward disease; or (c) preventing or delaying the onset of at least one symptom of disease.
[0034] "Kit" refers to any collection of two or more components that together constitute a functional unit that can be used for a specific purpose. By way of illustration (not limitation), a kit according to this disclosure may include a guide RNA complexed with or capable of complexing with an RNA-directed nuclease, and accompanied by (e.g., suspended in, or suspendable in) a pharmaceutically acceptable carrier. The kit may be used to introduce the complex into, for example, cells or a subject, for the purpose of inducing a desired genomic alteration in such cells or a subject. The components of the kit may be packaged together or may be packaged separately. The kit according to this disclosure may also optionally include a user manual (DFU) that describes, for example, the method of using the kit according to this disclosure. The DFU may be physically packaged with the kit or may be provided to the user of the kit, for example, electronically.
[0035] The terms “polynucleotide,” “nucleotide sequence,” “nucleic acid,” “nucleic acid molecule,” “nucleic acid sequence,” and “oligonucleotide” refer to a series of nucleotide bases (also called “nucleotides”) in DNA and RNA, and mean any chain of two or more nucleotides. Polynucleotides, nucleotide sequences, nucleic acids, etc., can be chimeric mixtures or derivatives or modified forms, single-stranded or double-stranded. They can be modified on the base moieties, sugar moieties, or phosphate backbones, for example, to improve the stability of the molecule, its hybridization parameters, etc. Nucleotide sequences often carry genetic information, including but not limited to information used by cellular machinery to make proteins and enzymes. These terms include double-stranded or single-stranded genomic DNA, RNA, any synthetic and genetically manipulated polynucleotides, and both sense and antisense polynucleotides. These terms also include nucleic acids containing modified bases.
[0036] The standard IUPAC notation is used in the nucleotide sequences presented herein, as shown in Table 1 below (see also Cornish-Bowden A, Nucleic Acids Res. [Nucleic Acid Research] May 10, 1985; 13(9):3021-30, which is incorporated herein by reference). However, it should be noted that in those cases where the sequence may be encoded by DNA or RNA, such as in gRNA, for example in the gRNA targeting domain, “T” indicates “thymine or uracil”.
[0037] Table 1: IUPAC Nucleic Acid Representation
[0038]
[0039] The terms “protein,” “peptide,” and “polypeptide” are used interchangeably to refer to a continuous chain of amino acids linked together by peptide bonds. These terms include individual proteins, groups or complexes of associated proteins, and fragments or portions, variants, derivatives, and analogs of such proteins. Peptide sequences are presented herein using conventional notation, beginning on the left with an amino or N-terminus and proceeding to the right with a carboxyl or C-terminus. Standard single-letter or three-letter abbreviations may be used.
[0040] The term "variant" refers to an entity such as a polypeptide, polynucleotide, or small molecule that exhibits significant structural identity with a reference entity but differs structurally from the reference entity in the presence or level of one or more chemical moieties. In many embodiments, the variant is also functionally different from its reference entity. Generally, whether a particular entity is properly considered a "variant" of a reference entity is based on the degree of its structural identity with the reference entity.
[0041] As used in this article, the term "promoter" refers to the genomic region (i.e., DNA sequence) that initiates gene transcription.
[0042] As used herein, in the context of nucleic acids (e.g., genes, protein-coding genomic regions, promoters), the term "endogenous" refers to native nucleic acids or proteins in their natural location (e.g., within the genome of a cell). In contrast, the term "exogenous," as used herein in the context of nucleic acids such as expression constructs, cDNA, insertions / deletions, and nucleic acid vectors, refers to nucleic acids that have been artificially introduced into the genome of a cell using, for example, gene editing or genetic engineering techniques (e.g., CRISPR-based editing techniques).
[0043] The terms “RNA-directed nuclease” and “RNA-directed nuclease molecule” are used interchangeably herein. In some embodiments, the RNA-directed nuclease is an RNA-directed DNA endonuclease. In some embodiments, the RNA-directed nuclease is a CRISPR nuclease. Non-limiting examples of RNA-directed nucleases are listed in Table 2 below, and any combination of RNA-directed nucleases disclosed herein or known to those skilled in the art may be used with respect to the methods and compositions disclosed herein. Those skilled in the art will recognize additional nucleases and nuclease variants suitable for the context of this disclosure, and it should be understood that this disclosure is not limited in this respect.
[0044] Table 2: RNA-directed nucleases
[0045]
[0046] According to this disclosure, other suitable RNA-directed nucleases (e.g., Cas9 and Cas12 nucleases) will be apparent to those skilled in the art, and this disclosure is not limited to the exemplary suitable nucleases provided herein. In some embodiments, a suitable nuclease is a Cas9 or Cas12a (Cpf1) nuclease. In some embodiments, this disclosure also includes nuclease variants, such as Cas9 or Cas12a nuclease variants. A nuclease variant is a nuclease comprising an amino acid sequence characterized by substitutions, deletions, or additions of one or more amino acids compared to the wild-type amino acid sequence of the nuclease. Suitable nucleases and nuclease variants may also comprise purification tags (e.g., multihistidine tags) and signal peptides (e.g., containing or consisting of nuclear localization signal sequences). Suitable non-limiting examples of nucleases and nuclease variants are described in more detail elsewhere in this document, and also include those described in PCT application PCT / US2019 / 22374, filed March 14, 2019, entitled “Systems and Methods for the Treatment of Hemoglobinopathies,” the entire contents of which are incorporated herein by reference.
[0047] In some embodiments, the RNA-directed nuclease is a variant of the Cas12a (Cpf1) species *Acidaminococcus* sp. (also known as AsCas12a or AsCpf1 variants). Based on this disclosure, suitable Cas12a nuclease variants (including suitable AsCas12a variants) will be known or obvious to those skilled in the art, and include, but are not limited to, the AsCas12a variants disclosed herein or others known in the art. For example, in some embodiments, the RNA-directed nuclease is the *Acidaminococcus* sp. Cas12a RR variant (AsCas12-RR). In another embodiment, the RNA-directed nuclease is the AsCas12a RVR variant. For example, suitable AsCas12a variants include those having M537R substitution, H800A substitution, and / or F870L substitution, or any combination thereof (according to the numbering scheme for the AsCas12a wild-type sequence). Other non-limiting instances of suitable Cas12a variants are described in PCT application PCT / US2018 / 065032, filed December 11, 2018, the entire contents of which are incorporated herein by reference.
[0048] As used in this article, the term "hematopoietic stem cells" refers to CD34+ stem cells that are capable of producing mature myeloid and lymphoid cell types, including T cells, natural killer cells, and B cells.
[0049] Genome editing system
[0050] Various genome editing systems known in the art can be used in the methods disclosed herein. Non-limiting examples of genome editing systems that can be used in connection with the subject matter of this disclosure include, but are not limited to, the CRISPR system, zinc finger nuclease (ZFN) systems, transcription activator-like effector nuclease (TALEN) systems, large nuclease (MN) systems, MegaTAL systems, other targeted endonuclease systems, and other chimeric endonuclease systems.
[0051] In some embodiments, the genome editing system has RNA-guided DNA editing activity. In some embodiments, the genome editing system comprises at least two components adapted from a naturally occurring CRISPR system: guide RNA (gRNA) and an RNA-guided nuclease. These two components form a complex capable of associating with a specific nucleic acid sequence and optionally editing DNA in or around that nucleic acid sequence, for example by creating one or more of single-strand breaks (SSBs or nicks), double-strand breaks (DSBs), and / or point mutations.
[0052] Naturally occurring CRISPR systems are evolutionarily organized into two classes and five types (Makarova et al., Nat Rev Microbiol [Nature Microbiology Reviews]. June 2011; 9(6): 467-477 (Makarova), which is incorporated herein by reference), and while the genome editing systems disclosed herein can be adapted to components of either type or class of naturally occurring CRISPR systems, the embodiments presented herein are generally adapted from Class 2 and Type II or Type V CRISPR systems. Class 2 systems encompass Type II and Type V, characterized by relatively large multi-domain RNA-guided nuclease proteins (e.g., Cas9 or Cas12a) and one or more guide RNAs (e.g., crRNA and optionally tracrRNA), which form ribonucleoprotein (RNP) complexes that associate (i.e., target) and cleave specific loci complementary to the target sequence (or spacer sequence) of the crRNA. The genome editing systems disclosed herein similarly target and optionally edit cellular DNA sequences, but are significantly different from naturally occurring CRISPR systems. For example, the single-molecule guide RNA described herein does not exist in nature, and both the guide RNA and the RNA-guided nuclease disclosed herein can be incorporated into any number of non-naturally existing modifications.
[0053] The genome editing system disclosed in this article can be delivered into cells via electroporation. Other non-viral methods can also be used for gene editing of the target cells disclosed in this article. For example, nucleic acid molecules can be introduced into cells / subjects via: administration of nucleic acids in the presence of lipid transfection (Feigner et al., Proc. Natl. Acad. Sci. USA [Proceedings of the National Academy of Sciences] 84:7413, 1987; Ono et al., Neuroscience Letters [Neuroscience Letters] 17:259, 1990; Brigham et al., Am. J. Med. Sci. [American Journal of Medicine] 298:278, 1989; Staubinger et al., Methods in Enzymology [Enzymological Methods] 101:512, 1983), and sialic acid-free serum mucin-polylysine conjugation (Wu et al., Journal of Biological Chemistry [Journal of Biological Chemistry] 263:14621, 1988; Wu et al., Journal of Biological Chemistry [Journal of Biological Chemistry] 264:16985, (1989), or via microinjection under surgical conditions (Wolff et al., Science 247:1465, 1990). Other non-viral methods for gene transfer include in vitro transfection using calcium phosphate, DEAE dextran, electroporation, and protoplast fusion. Lipid nanoparticles (LNPs) or liposomes are also considered for delivering nucleic acid molecules into cells.
[0054] The genome editing system disclosed herein can be delivered to a subject or cells using a viral vector, such as a retroviral vector, like a gamma retroviral vector or a lentiviral vector. A combination of a retroviral vector and a suitable packaging line is appropriate, wherein the capsid protein will have the function of infecting human cells. Various cell lines that produce facultative viruses are known, including but not limited to PA12 (Miller, et al. (1985) Mol. Cell. Biol. [Molecular and Cell Biology] 5:431-437); PA317 (Miller, et al. (1986) Mol. Cell. Biol. [Molecular and Cell Biology] 6:2895-2902); and CRIP (Danos, et al. (1988) Proc. Natl. Acad. Sci. USA [Proceedings of the National Academy of Sciences] 85:6460-6464). Non-facultative particles are also suitable, such as particles pseudotyped with a VSVG, RD114, or GALV envelope, and any other particles known in the art. Possible transduction methods also include direct co-culturing of cells with producing cells (e.g., by Bregni et al. (1992) Blood 80:1418-1422), or culturing with viral supernatant alone or with concentrated carrier stock with or without appropriate growth factors and polycations (e.g., by Xu et al. (1994) Exp. Hemat. 22:223-230; and Hughes et al. (1992) J. Clin. Invest. 89:1817).
[0055] Genome editing systems can be implemented in various ways (e.g., administered or delivered to cells or subjects), and different implementations may be suitable for different applications. For example, in some embodiments, the genome editing system is implemented as a protein / RNA complex (ribonucleoprotein or RNP) that may be included in a pharmaceutical composition that optionally includes a pharmaceutically acceptable carrier and / or encapsulating agent, such as lipid or polymeric microparticles or nanoparticles, micelles, liposomes, etc. In some embodiments, the genome editing system is implemented as one or more nucleic acids (optionally having one or more additional components) encoding the aforementioned RNA-directed nuclease and the directing RNA component. In some embodiments, the genome editing system is implemented as one or more vectors containing such nucleic acids, such as viral vectors, such as adeno-associated virus. In some embodiments, the genome editing system is implemented as a combination of any of the foregoing. Other or modified implementations operating according to the principles described herein will be apparent to those skilled in the art and are within the scope of this disclosure.
[0056] It should be noted that the genome editing system disclosed herein can target a single specific nucleotide sequence, or can target (and edit in parallel) two or more specific nucleotide sequences using two or more guide RNAs. Throughout this disclosure, the use of multiple gRNAs is referred to as "multiplexing" and can be used to target multiple unrelated target sequences, or to form multiple SSBs or DSBs within a single target domain, and in some cases, to produce specific edits within such target domains. For example, International Patent Publication No. WO 2015 / 138510 (Maeder) (incorporated herein by reference) by Maeder et al. describes a genome editing system for correcting a point mutation (C.2991+1655A to G) in the human CEP290 gene that results in a hidden splice site, which in turn reduces or eliminates the function of the gene. Maeder's genome editing system utilizes two guide RNAs that target (i.e., lateral) sequences on either side of the point mutation and form a DSB lateralized to that mutation. This, in turn, promotes the deletion of intercalation sequences, including mutations, thereby eliminating hidden splicing sites and restoring normal gene function.
[0057] In some cases, genome editing systems can create double-strand breaks that are repaired by cellular DNA double-strand break mechanisms such as NHEJ or HDR. These mechanisms are described extensively in the literature, for example, Davis and Maizels, PNAS, 111(10):E924-932, March 11, 2014 (Davis) (describing Alt-HDR); Frit et al., DNA Repair 17(2014) 81-97 (Frit) (describing Alt-NHEJ); and Iyama and Wilson III, DNA Repair (Amst.) August 2013; 12(8): 620-636 (Iyama) (summarizing the classic HDR and NHEJ pathways).
[0058] If a genome editing system operates by forming a double-strand break (DSB), then such a system optionally includes one or more components that promote or contribute to a specific double-strand break repair pattern or a specific repair outcome. For example, Cotta-Ramusino also describes a genome editing system in which a single-stranded oligonucleotide "donor template" is added; the donor template is incorporated into a target region of the cellular DNA, which is cut by the genome editing system, and can result in changes in the target sequence.
[0059] In some embodiments, the genome editing system modifies the target sequence or gene expression in or near the target sequence without causing double-strand breaks, for example by causing single-strand breaks or without cleavage (i.e., without generating strand breaks). For example, the genome editing system may include an RNA-guided nuclease fused to a functional domain acting on DNA, thereby modifying the target sequence or its expression. As an example, the RNA-guided nuclease may be linked to (e.g., fused to) a cytidine deaminase functional domain and may operate by generating a targeted C-to-A substitution. For example, the RNA-guided nuclease may also be linked to (e.g., fused to) an adenosine deaminase functional domain. Exemplary nuclease / deaminase fusions are described in Komor et al., Nature [Nature] 533, 420-424 (May 19, 2016) and Kantor et al., Int. J. Mol. Sci. [International Journal of Molecular Sciences] 21(17) 6240 (2020), which are hereby incorporated by reference in their entirety. Further non-limiting examples of suitable base editors, their variants, and strategies for preparing RNA-directed nucleases containing them are described in the following PCT applications: PCT / US2020 / 016664, filed February 4, 2020; PCT / US2020 / 018192, filed February 13, 2020; PCT / US2020 / 049975, filed September 9, 2020; PCT / US2022 / 012054, filed January 11, 2022; and PCT / US2022 / 078655, filed October 25, 2022, the entire contents of which are incorporated herein by reference. Alternatively, genome editing systems may utilize cleavage-inactivated (i.e., “dead”) nucleases, such as dead Cas9 (dCas9), and can operate by forming stable complexes on one or more target regions of cellular DNA, thereby recruiting other functional domains and / or interfering with functions involving one or more target regions, including but not limited to mRNA transcription, chromatin remodeling, etc. In some embodiments, the RNA-directed nucleases disclosed herein may comprise polymerase domains (e.g., reverse transcriptase domains). In some embodiments, RNA-directed nucleases may use gRNA having primer-binding sequences and / or polymerase domain templates.
[0060] In some embodiments, the RNA-directed nuclease may be a leader editor (PE), wherein the PE is an RNA-directed nuclease with nicking enzyme activity fused to a reverse transcriptase domain. In some embodiments, the PE may use a leader-editing gRNA (pegRNA), wherein the pegRNA is a gRNA having a primer-binding sequence (PBS) and a donor template, for example, appended to one of the ends (e.g., the 3′ end). In some embodiments, the PE:pegRNA complex binds to the target DNA, and the nicking enzyme domain of the leader editor cleaves only one strand, producing a flap. The PBS located on the pegRNA binds to the DNA flap, and the edited RNA sequence is reverse transcribed using the reverse transcriptase domain of the leader editor. The edited strand is incorporated into the DNA at the end of the nicked flap, and the target DNA is repaired with new reverse-transcribed DNA. The original DNA segment is removed by an intracellular nuclease. Other methods for template-mediated gene editing using RNA-guided nucleases and polymerases are described in the following PCT publications: WO 2020 / 191233, WO 2020 / 191248, WO 2021226558, WO 2023283246, WO 2023 / 235501 and WO 2023 / 076898, each of which is incorporated herein by reference for all purposes.
[0061] Guide RNA (gRNA) molecules
[0062] The terms “guide molecule,” “guide RNA,” and “gRNA” refer to any nucleic acid that facilitates the specific association (or “targeting”) of an RNA-guided nuclease (e.g., Cas9 or Cas12a (Cpf1)) with a target sequence in the cell (e.g., a genomic or episodic sequence). gRNA can be a single molecule (containing a single RNA molecule and alternatively referred to as a chimera) or a module (containing more than one, and usually two, separate RNA molecules, such as crRNA and tracrRNA, which are typically associated with each other, for example, by double stranding). Descriptions of gRNA and its components are found throughout the literature, such as Briner et al. (Molecular Cell [Molecular Cell] 56(2), 333-339, October 23, 2014 (Briner), which is incorporated by reference), and Cotta-Ramusino. Guide molecules can be RNA molecules. Guide molecules can also contain one or more nucleotides other than RNA nucleotides; for example, a guide molecule can be a DNA / RNA hybrid molecule, and / or a guide molecule can contain one or more modified nucleotides (including, but not limited to, one or more modified DNA or RNA nucleotides).
[0063] In bacteria and archaea, type II CRISPR systems typically consist of an RNA-directed nuclease protein (e.g., Cas9), a CRISPR RNA (crRNA) comprising a 5' region complementary to a foreign sequence, and a trans-activating crRNA (tracrRNA) comprising a 5' region complementary to the 3' region of the crRNA, forming a double strand. This double strand facilitates the formation of the Cas9 / gRNA complex and is essential for its activity. When type II CRISPR systems were adapted for gene editing, it was found that crRNA and tracrRNA could be ligated into a single molecule or a chimeric guide RNA, in one non-restrictive instance via a tetranucleotide (e.g., GAAA) "tetraloop" or "connector" sequence bridging the complementary regions of the crRNA (at its 3' end) and the tracrRNA (at its 5' end). (Mali et al. Science. 2013 Feb 15; 339(6121): 823-826 (“Mali”); Jiang et al. Nat Biotechnol [Nature Biotechnology]. 2013 Mar; 31(3): 233-239 (“Jiang”); and Jinek et al. 2012 Science [Science] Aug 17; 337(6096): 816-821 (“Jinek”), all incorporated herein by reference).
[0064] Guide RNAs, whether single molecules or modules, include a “targeting domain” that is fully or partially complementary to a target domain within a target sequence, such as a DNA sequence in the cell genome to be edited. The targeting domain is referred to in the literature by various names, including but not limited to “guide sequence” (Hsu et al., Nat Biotechnol. [Nature Biotechnology] Sept. 2013; 31(9): 827-832 (“Hsu”), which is incorporated herein by reference), “complementary region” (Cotta-Ramusino), “spacer region” (Briner), and collectively referred to as “crRNA” (Jiang). Regardless of the name given to it, the targeting domain is typically 10-30 nucleotides in length, and in some embodiments 16-24 nucleotides in length (e.g., 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides in length), and is located at or near the 5' end in the case of Cas9 gRNA, and at or near the 3' end in the case of Cas12a gRNA.
[0065] In addition to the target domain, gRNAs typically (but not necessarily, as discussed below) include multiple domains that can influence the formation or activity of the gRNA / Cas9 complex. For example, as mentioned above, the double-stranded structure formed by the first and second complementary domains of the gRNA (also known as the repeat:anti-repeat double-stranded structure) interacts with the Cas9 recognition (REC) leaflet and can mediate the formation of the Cas9 / gRNA complex. (Nishimasu et al., Cell 156, 935-949, Feb 27, 2014 (Nishimasu 2014) and Nishimasu et al., Cell 162, 1113-1126, Aug 27, 2015 (Nishimasu 2015), both of which are incorporated herein by reference). It should be noted that the first and / or second complementary domains may contain one or more poly-A segments, which can be recognized by RNA polymerase as a termination signal. Therefore, the sequences of the first and second complementary domains are optionally modified to eliminate these segments and facilitate the completion of in vitro transcription of the gRNA, for example by using AG exchange as described in Briner, or by using AU exchange. These and other similar modifications to the first and second complementary domains are within the scope of this disclosure.
[0066] In addition to the first and second complementary domains, Cas9 gRNAs typically include two or more additional double-stranded regions that participate in nuclease activity in vivo but not necessarily in vitro (Nishimasu 2015). The first stem-loop 1 near the 3' portion of the second complementary domain is referred to differently as the "proximal domain" (Cotta-Ramusino), "stem-loop 1" (Nishimasu 2014 and 2015), and "nexus" (Briner). One or more additional stem-loop structures are typically present near the 3' end of the gRNA, and their number varies by species: *Streptococcus pyogenes* gRNAs typically include two 3' stem-loops (a total of four stem-loop structures, including the repeat: anti-repeat double strand), while *Staphylococcus aureus* and other species have only one (a total of three stem-loop structures). A description of conserved stem-loop structures (more generally, and gRNA structures) organized according to species is provided in *Briner*.
[0067] While the foregoing description focuses on gRNAs used with Cas9, it should be understood that other RNA-directed nucleases have been (or may be) discovered or invented that utilize gRNAs that differ in some respects from those described for this purpose. For example, Cas12a (also known as Cpf1; "CRISPR from *Prevotella* and *Francis* 1") is an RNA-directed nuclease that does not require tracrRNA to function. (Zetsche et al., 2015, Cell [Cell] 163, 759-771, October 22, 2015 (Zetsche I), which is incorporated herein by reference). gRNAs used in the Cas12a genome editing system typically include a target domain and a complementarity domain (alternatively referred to as a "handle"). It should also be noted that in gRNAs used with Cas12a, the target domain is typically located at or near the 3' end, rather than at the 5' end as described above for Cas9 gRNAs (where the handle is located at or near the 5' end of the Cas12a gRNA).
[0068] Those skilled in the art will understand that while structural differences may exist between gRNAs from different prokaryotic species or between Cas12a and Cas9 gRNAs, the operational principles of gRNAs are generally consistent. Because of this operational consistency, gRNAs can be broadly defined by their target domain sequence, and those skilled in the art will understand that a given target domain sequence can be incorporated into any suitable gRNA, including single-molecule or chimeric gRNAs, or gRNAs comprising one or more chemical modifications and / or sequence modifications (substitution, additional nucleotides, truncation, etc.). Therefore, for the purposes of this disclosure, gRNAs may be described only in terms of their target domain sequence.
[0069] More generally, those skilled in the art will understand that some aspects of this disclosure relate to systems, methods, and compositions that can be implemented using a variety of RNA-guided nucleases. Therefore, unless otherwise specified, the term gRNA should be understood to encompass not only those gRNAs compatible with a particular RNA-guided nuclease (e.g., a specific species of Cas9 or Cas12a), but also any suitable gRNA that can be used with any RNA-guided nuclease. By way of illustration, in some embodiments, the term gRNA may include gRNAs used with any RNA-guided nuclease present in or derived from or modified from any type II CRISPR system (e.g., type II or type V CRISPR system).
[0070] In some embodiments, the guide RNA used contains modifications compared to a standard gRNA scaffold. Such modifications may include, for example, chemical modifications to a portion of the gRNA (e.g., nucleobases or backbone portions). In some embodiments, such modifications may also include the presence of DNA nucleotides within the gRNA, for example, inside or outside the target domain. In some embodiments, the modifications may include extensions of the gRNA scaffold, for example, by adding 1-100 nucleotides, including RNA and / or DNA nucleotides, at the 3' or 5' end of the guide RNA (e.g., distal to the target domain).
[0071] In some embodiments, the gRNA complexed with the unmodified or modified Cas12a protein can be modified to improve the editing efficiency of the target nucleic acid. In some embodiments, the modified gRNA may contain one or more modifications, including phosphate thioester (PS2) bond modification, 2'-O-methyl modification, one or more or a segment of deoxyribonucleic acid (DNA) bases (also referred to herein as "DNA extension"), or a combination thereof.
[0072] In some embodiments, the gRNA disclosed herein comprises one or more deoxyribonucleic acid (DNA) bases, also referred to herein as a “DNA extension.” In some embodiments, the gRNA disclosed herein includes a DNA extension at the 5' end, the 3' end, or a combination thereof. In some embodiments, the DNA extension may be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, The DNA extension can be 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 DNA bases long. For example, in some embodiments, the DNA extension can be 1, 2, 3, 4, 5, 10, 15, 20, or 25 DNA bases long. In some embodiments, the DNA extension can include one or more DNA bases selected from adenine (A), guanine (G), cytosine (C), or thymine (T). In some embodiments, the DNA extension comprises the same DNA bases. For example, a DNA extension may include an adenine (A) base. In some embodiments, a DNA extension may include a thymine (T) base. In some embodiments, a DNA extension may include a combination of different DNA bases. In some embodiments, a DNA extension may comprise or consist of the sequences shown in Table 3. In some embodiments, the gRNAs disclosed herein include a DNA extension and one or more phosphate-thioester bond modifications, one or more phosphate-dithioester (PS2) bond modifications, one or more 2'-O-methyl modifications, or combinations thereof. In some embodiments, one or more modifications may be at the 5' end, at the 3' end, or a combination thereof of the gRNA. In some embodiments, a gRNA including a DNA extension may comprise the sequences including a DNA extension shown in Table 3. Without wishing to be bound by theory, it is contemplated that any DNA extension may be used herein, provided it does not hybridize with the target nucleic acid targeted by the gRNA. In some embodiments, compared to gRNAs without such a DNA extension, the DNA extension also exhibits increased editing efficiency at the target nucleic acid site, for example, by altering gRNA stability, uptake, and / or activity.
[0073] In some embodiments, the gRNA disclosed herein comprises one or more ribonucleic acid (RNA) bases, also referred to herein as "RNA extension". In some embodiments, the gRNA disclosed herein includes RNA extension at the 5' end, the 3' end, or a combination thereof. In some embodiments, the RNA extension may be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 RNA bases in length. For example, in some embodiments, the RNA extension can be 1, 2, 3, 4, 5, 10, 15, 20, or 25 RNA bases in length. In some embodiments, RNA extension may include one or more RNA bases selected from adenine (rA), guanine (rG), cytosine (rC), or uracil (rU), where "r" represents RNA, 2'-hydroxyl. In some embodiments, RNA extension includes the same RNA bases. For example, RNA extension may include a segment of adenine (rA) bases. In some embodiments, RNA extension includes a combination of different RNA bases. In some embodiments, RNA extension may comprise or consist of the sequences shown in Table 3. In some embodiments, the gRNA disclosed herein includes RNA extension and one or more phosphate thioester bond modifications, one or more phosphate dithioester (PS2) bond modifications, one or more 2'-O-methyl modifications, or combinations thereof. In some embodiments, one or more modifications may be at the 5' end, at the 3' end, or a combination thereof of the gRNA. In some embodiments, gRNA including RNA extension may comprise the sequences including RNA extension shown in Table 3. gRNA including RNA extension at the 5' end of the gRNA may comprise the sequences disclosed herein. gRNA including RNA extension at the 3' end of the gRNA may comprise the sequences disclosed herein.
[0074] It is anticipated that the gRNA disclosed herein may also include RNA extension and DNA extension. In some embodiments, both RNA extension and DNA extension may be located at the 5' end, the 3' end, or a combination thereof of the gRNA. In some embodiments, RNA extension is at the 5' end of the gRNA, and DNA extension is at the 3' end of the gRNA. In some embodiments, RNA extension is at the 3' end of the gRNA, and DNA extension is at the 5' end of the gRNA.
[0075] In some embodiments, a gRNA comprising modifications (e.g., DNA extension at the 5' end) is complexed with an RNA-directed nuclease (e.g., AsCas12a nuclease) to form an RNP, which is then used to edit target cells, such as T cells. The following table provides exemplary suitable 5' extensions for guide RNAs (e.g., Cas12a guide RNAs):
[0076] Table 3: gRNA 5' extension
[0077]
[0078] Based on this disclosure, other suitable gRNA modifications will be apparent to those skilled in the art. Suitable gRNA modifications include, for example, those described below: PCT application PCT / US2018 / 054027, filed October 2, 2018, entitled "MODIFIED CPF1GUIDE RNA"; PCT application PCT / US2015 / 000143, filed December 3, 2015, entitled "GUIDE RNA WITH CHEMICAL MODIFICATIONS"; PCT application PCT / US2016 / 026028, filed April 5, 2016, entitled "CHEMICALLY MODIFIED GUIDE RNASFOR CRISPR / CAS-MEDIATED GENE REGULATION"; and PCT application PCT / US2016 / 026028, filed September 23, 2016, entitled "NUCLEASE-MEDIATED GENOME EDITING OF The PCT application PCT / US2016 / 053344, titled "PRIMARY CELLS AND ENRICHMENT THEREOF [Nuclease-mediated genome editing and enrichment in primary cells]", is incorporated herein by reference in its entirety.
[0079] gRNA design
[0080] Methods for target sequence selection and validation, as well as off-target analysis, have been previously described (e.g., Mali; Hsu; Fu et al., 2014 Nat biotechnol [Nature Biotechnology] 32(3): 279-84; Heigwer et al., 2014 Nat methods [Nature Methods] 11(2):122-3; Bae et al. (2014) Bioinformatics [Bioinformatics] 30(10): 1473-5; and Xiao A et al. (2014) Bioinformatics [Bioinformatics] 30(8):1180-1182. Each of these references is incorporated herein by reference. In some non-limiting embodiments, gRNA design may include the use of software tools to optimize the selection of potential target sequences corresponding to the user's target sequence, for example, to minimize overall genome-wide off-target activity. These and other guided selection methods are described in detail in Maeder and Cotta-Ramusino.
[0081] In some embodiments, one or more or all nucleotides in the gRNA molecule are modified. Strategies for modifying gRNAs are described in WO 2019 / 152519, published August 8, 2019, the entire contents of which are expressly incorporated herein by reference.
[0082] Non-limiting examples of guide RNAs suitable for certain embodiments included in this disclosure are provided herein (e.g., in the table below). Those skilled in the art will be able to envision suitable guide RNA sequences for specific nucleases (e.g., Cas9 or Cas12a nucleases) based on the disclosure of the target domain sequence as a DNA or RNA sequence. For example, a guide RNA comprising a target sequence of RNA nucleotides would contain an RNA sequence corresponding to the target domain sequence provided as a DNA sequence, and therefore contain uracil instead of thymidine nucleotides. For example, a guide RNA comprising a target domain sequence of RNA nucleotides and described by the DNA sequence CCTCTCAGGTTCACTGCTGGC (SEQ ID NO: 47) would have a target domain of the corresponding RNA sequence rCrCrUrCrUrCrArGrGrUrUrCrArCrUrGrGrC (SEQ ID NO: 90). As will be apparent to those skilled in the art, such a target sequence would be coupled to a suitable guide RNA scaffold (e.g., a crRNA scaffold sequence or a chimeric crRNA / tracrRNA scaffold sequence). Suitable gRNA scaffold sequences are known to those skilled in the art. For AsCas12a, for example, a suitable scaffold sequence comprising the sequence rUrArArUrUrUrCrUrArCrUrCrUrUrGrUrArGrArU (SEQ ID NO: 162) is added to the 5' end of the targeting domain. In the example above, this would yield a Cas12a guide RNA having the sequence rUrArArUrUrUrCrUrArCrUrCrUrGrUrArGrArUrCrCrUrCrUrCrUrCrUrCrUrGrC (SEQ ID NO: 133). Those skilled in the art will further understand how to modify such a guide RNA. For example, adding a 25-mer DNA extension (SEQ ID NO: 7) will result in a guide RNA having, for example, the sequence ATGTGTTTTTGTCAAAAGACCTTTTrUrArUrUrUrCrUrArCrUrCrUrUrGrUrArGrArUrCrCrUrCrUrCrUrCrArGrGrGrC (SEQ ID NO: 163). It should be understood that the exemplary targeting sequences provided herein are not limiting, and based on this disclosure, other suitable sequences (e.g., variants of the specific sequences disclosed herein) will be apparent to those skilled in the art, given general knowledge of the art.
[0083] In some embodiments, the gRNA used in this disclosure is a gRNA targeting FLI-1 (FLI-1 gRNA). In some embodiments, the target sequence of the FLI-1 gene comprises or is composed of a nucleotide sequence of at least 10, at least 16, at least 17, at least 18, at least 20, or at least 21 nucleotides in length. In some embodiments, the target sequence or target locus of the FLI-1 gene has at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity with the nucleotide sequence shown in SEQ ID NO: 24-66. In some embodiments, the target sequence or target locus of the FLI-1 gene has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mutations relative to the nucleotide sequence shown in SEQ ID NO: 24-66. In some embodiments, the target sequence or target locus of the FLI-1 gene has fewer than 2, 3, 4, 5, 6, 7, 8, 9, or 10 mutations relative to the nucleotide sequence shown in SEQ ID NO: 24-66. In some embodiments, the target sequence of the FLI-1 gene comprises or consists of the nucleotide sequence shown in SEQ ID NO: 24-66. In some embodiments, the target locus of the FLI-1 gene comprises the nucleotides shown in SEQ ID NO: 24-66.
[0084] In some embodiments, the target sequence or locus of the FLI-1 gene is located in exon 5 of FLI-1. In some embodiments, the target sequence or locus of the FLI-1 gene comprises or is composed of a nucleotide sequence of at least 10, at least 16, at least 17, at least 18, at least 20, or at least 21 nucleotides in length. In some embodiments, the target sequence of the FLI-1 gene has at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity with the nucleotide sequence shown in SEQ ID NO: 181. SEQ ID NO: 181 is shown below.
[0085] gtttatgttttgcctctcagGTTCACTGCTGGCCTATAATACAACCTCCCACACCGACCAATCCTCACGATTGAGTGTCAAAGAAGgtaagtttgttcttttgtgc [SEQ ID NO: SEQ ID NO: 181]
[0086] In some embodiments, the target sequence of the FLI-1 gene comprises or is composed of the nucleotides shown in SEQ ID NO: 25, SEQ ID NO: 36, or SEQ ID NO: 47. In some embodiments, the target sequence of the FLI-1 gene comprises or is composed of the nucleotide sequence shown in SEQ ID NO: 47.
[0087] In some embodiments, the targeting domain of the gRNA may be complementary to either strand of the target sequence or locus of the FLI-1 gene. In some embodiments, the targeting domain of the gRNA molecule has at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity with the nucleotide sequences shown in SEQ ID NO: 67-109. In some embodiments, the targeting domain of the gRNA molecule has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mutations relative to the nucleotide sequences shown in SEQ ID NO: 67-109. In some embodiments, the targeting domain of the gRNA molecule has fewer than 2, 3, 4, 5, 6, 7, 8, 9, or 10 mutations relative to the nucleotide sequences shown in SEQ ID NO: 67-109. In some embodiments, the targeting domain of the gRNA targeting the FLI-1 gene is SEQ ID NO: 90.
[0088] In some embodiments, the gRNA molecule targeting the FLI-1 gene has at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity with the nucleotide sequence shown in SEQ ID NO: 110-161. In some embodiments, the gRNA molecule targeting the FLI-1 gene has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mutations relative to the nucleotide sequence shown in SEQ ID NO: 110-161. In some embodiments, the gRNA molecule targeting the FLI-1 gene has fewer than 2, 3, 4, 5, 6, 7, 8, 9, or 10 mutations relative to the nucleotide sequence shown in SEQ ID NO: 110-161. In some embodiments, the gRNA molecule targeting the FLI-1 gene comprises or is composed of the sequence shown in SEQ ID NO: 133. Table 7 lists exemplary FLI-1 gene target sequences, gRNA target domains, scaffold sequences, and DNA extensions.
[0089] Table 4: FLI-1 target sequences
[0090]
[0091] Table 5: FLI-1 Guidance Sequence
[0092]
[0093] Table 6: FLI-1 (crRNA oligonucleotide)
[0094]
[0095]
[0096]
[0097] Table 7: Exemplary Guide RNAs (DNA / RNA Oligonucleotides)
[0098]
[0099] gRNA modification
[0100] The activity, stability, or other characteristics of gRNAs can be altered by incorporating certain modifications. As an example, transiently expressed or delivered nucleic acids may be readily degraded by, for example, cellular nucleases. Therefore, the gRNAs described herein may contain nucleosides or nucleotides with one or more modifications introduced to enhance stability against nucleases. While not wishing to be bound by theory, it should be believed that certain modified gRNAs described herein may exhibit a reduced innate immune response upon introduction into cells. Those skilled in the art will understand certain cellular responses generally observed in cells (e.g., mammalian cells) in response to exogenous nucleic acids, particularly those of viral or bacterial origin. Such responses may include the induction of cytokine expression and release, as well as cell death, which can be reduced or completely eliminated by the modifications presented herein.
[0101] Certain exemplary modifications discussed in this section may be present at any location within the gRNA sequence, including but not limited to at or near the 5' end (e.g., within 1-10, 1-5, or 1-2 nucleotides at the 5' end) and / or at or near the 3' end (e.g., within 1-10, 1-5, or 1-2 nucleotides at the 3' end). In some cases, modifications are located within functional motifs, such as the repeat-anti-repeat duplex of Cas9 gRNA, the stem-loop structure of Cas9 or Cas12a gRNA, and / or the targeting domain of the gRNA.
[0102] As an example, the 5' end of a gRNA may include a eukaryotic mRNA cap structure or a cap analogue (e.g., G(5')ppp(5')G cap analogue, m7G(5')ppp(5')G cap analogue, or 3'-O-Me-m7G(5')ppp(5')G anti-reverse cap analogue (ARCA)), as shown below:
[0103]
[0104] Caps or cap analogs can be added during the chemical synthesis or in vitro transcription of gRNA.
[0105] In a similar manner, the 5' end of gRNA may lack a 5' triphosphate group. For example, gRNA transcribed in vitro may be treated with a phosphatase (e.g., using calf intestinal alkaline phosphatase) to remove the 5' triphosphate group.
[0106] Another modification involves adding multiple (e.g., 1-10, 10-20, or 25-200) adenine (A) residues, called a polyA segment, to the 3' end of the gRNA. The polyA segment can be added to the gRNA during chemical synthesis, post-transcriptionally in vitro using a polyadenosine polymerase (e.g., E. coli poly(A) polymerase), or in vivo via a polyadenosine-modified sequence, as described in Maeder.
[0107] It should be noted that the modifications described herein can be combined in any suitable manner, for example, gRNA transcribed from a DNA vector in vivo or gRNA transcribed in vitro can include one or both of the 5' cap structure or cap analogue and the 3' polyA segment.
[0108] The guide RNA can be modified at the 3' terminal U-ribose. For example, the two terminal hydroxyl groups of the U-ribose can be oxidized to aldehydes, accompanied by the opening of the ribose ring, to provide a modified nucleoside as shown below:
[0109]
[0110] The "U" can be either unmodified or modified uridine.
[0111] The 3' terminal U-ribose can be modified with a 2'3' cyclic phosphate ester as shown below:
[0112]
[0113] The "U" can be either unmodified or modified uridine.
[0114] The guide RNA may contain a 3' nucleotide that is stable against degradation, for example, by incorporating one or more of the modified nucleotides described herein. In some embodiments, uridine may be replaced by modified uridine (e.g., 5-(2-amino)propyluridine and 5-bromouridine) or by any of the modified uridines described herein; adenosine and guanosine may be replaced by modified adenosine and guanosine (e.g., with a modification at position 8, such as 8-bromoguanosine) or by any of the modified adenosine and guanosines described herein.
[0115] In some embodiments, sugar-modified ribonucleotides may be incorporated into the gRNA, for example, wherein the 2'OH- group is replaced by a group selected from: H, -OR, -R (where R may be, for example, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar), halogen, -SH, -SR (where R may be, for example, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar), amino (where the amino group may be, for example, NH2; alkylamino, dialkylamino, heterocyclic, arylamino, diarylamino, heteroarylamino, diheteroarylamino, or amino acid); or cyano (-CN). In some embodiments, the phosphate backbone may be modified as described herein, for example, modified with a phosphate thioester (PhTx) group. In some embodiments, one or more nucleotides of the gRNA may be independently modified or unmodified nucleotides, including but not limited to 2'-sugar modified nucleotides, such as 2'-O-methyl, 2'-O-methoxyethyl, or 2'-fluorine modified nucleotides, including, for example, 2'-F or 2'-O-methyladenosine (A), 2'-F or 2'-O-methylcytidine (C), 2'-F or 2'-O-methyluridine (U), 2'-F or 2'-O-methylthymidine (T), 2'-F or 2'-O-methylguanosine (G), 2'-O-methoxyethyl-5-methyluridine (Teo), 2'-O-methoxyethyladenosine (Aeo), 2'-O-methoxyethyl-5-methylcytidine (m5Ceo), and any combination thereof.
[0116] The guide RNA may also include a “locked” nucleic acid (LNA) in which the 2' OH- group can be linked to the 4' carbon of the same ribose, for example, via a C1-6 alkylene or C1-6 heteroalkylene bridge. Any suitable portion can be used to provide such a bridge, including but not limited to methylene, propylene, ether, or amino bridges; O-amino groups (where the amino group can be, for example, NH2; alkylamino, dialkylamino, heterocyclic, arylamino, diarylamino, heteroarylamino, or dihexarylamino, ethylenediamine, or polyamino) and aminoalkoxy or O(CH2). n -Amino (wherein the amino group can be, for example, NH2; alkylamino, dialkylamino, heterocyclic, arylamino, diarylamino, heteroarylamino or diheteroarylamino, ethylenediamine or polyamino).
[0117] In some embodiments, gRNA may include modified nucleotides that are polycyclic (e.g., tricyclic; and "unlocked" forms such as diol nucleic acids (GNA) (e.g., R-GNA or S-GNA, wherein the ribose is replaced by a diol unit attached to a phosphodiester bond), or threofuranosyl nucleic acid (TNA, wherein the ribose is replaced by α-L-threofuranosyl-(3'→2')).
[0118] Typically, gRNA comprises a glycosylribose, which is a 5-membered ring with oxygen. Exemplary modified gRNAs may include, but are not limited to, substitution of oxygen in the ribose (e.g., with sulfur (S), selenium (Se), or alkylene compounds, such as methylene or ethylene); addition of double bonds (e.g., replacing the ribose with cyclopentenyl or cyclohexenyl); ring-condensation of the ribose (e.g., to form a 4-membered ring of cyclobutane or oxetane); ring-expansion of the ribose (e.g., to form a 6- or 7-membered ring with additional carbon or heteroatoms, such as anhydride hexitol, atroitol, mannitol, cyclohexyl, cyclohexenyl, and morpholino, which also have an aminophosphate backbone). Although most sugar analogue alterations are located at the 2' position, other sites are also suitable for modification, including the 4' position. In some embodiments, the gRNA contains 4'-S, 4'-Se, or 4'-C-aminomethyl-2'-O-Me modifications.
[0119] In some embodiments, denitronucleotides (e.g., 7-denitro-adenosine) may be incorporated into the gRNA. In some embodiments, O-alkylated and N-alkylated nucleotides (e.g., N6-methyladenosine) may be incorporated into the gRNA. In some embodiments, one or more or all of the nucleotides in the gRNA molecule are deoxynucleotides.
[0120] RNA-directed nucleases
[0121] RNA-directed nucleases according to this disclosure include, but are not limited to, two naturally occurring classes of CRISPR nucleases, such as Cas9 and Cas12a, and other nucleases derived from or obtained therefrom. Functionally, RNA-directed nucleases are defined as those nucleases that: (a) interact with (e.g., complex) gRNA; and (b) associate with or optionally cleave or modify a target region of DNA with gRNA, the target region comprising (i) a sequence complementary to the target domain of the gRNA, and optionally, (ii) another sequence referred to as a “prototype spacer adjacent motif” or “PAM,” which is described in more detail below. In illustrating the following examples, RNA-directed nucleases may be defined broadly based on their PAM specificity and cleavage activity, even though variations may exist between individual RNA-directed nucleases sharing the same PAM specificity or cleavage activity. Those skilled in the art will understand that some aspects of this disclosure relate to systems, methods, and compositions that can be implemented using any suitable RNA-directed nuclease having a certain PAM specificity and / or cleavage activity. Therefore, unless otherwise specified, the term RNA-directed nuclease should be understood as a general term and is not limited to any particular type (e.g., Cas9 vs. Cas12a), species (e.g., Streptococcus pyogenes vs. Staphylococcus aureus), or variant (e.g., full-length vs. truncated or split; naturally occurring PAM specificity vs. engineered PAM specificity, etc.) of RNA-directed nuclease.
[0122] The PAM sequence is named for its sequence relationship with the "prototype spacer" sequence, which is complementary to the gRNA targeting domain (or "spacer sequence"). Together with the prototype spacer, the PAM sequence defines the target region or sequence for a specific RNA-guided nuclease / gRNA combination.
[0123] Many RNA-directed nucleases may require different sequence relationships between the PAM and the prototype spacer. For example, the Cas9 nuclease recognizes the PAM sequence at the 3' of the prototype spacer, while Cas12a typically recognizes the PAM sequence at the 5' of the prototype spacer.
[0124] In addition to recognizing specific sequence orientations of PAMs and prototype spacers, RNA-guided nucleases can also recognize specific PAM sequences. For example, Staphylococcus aureus Cas9 recognizes the PAM sequence NNGRRT or NNGRRV, where N residues are adjacent to the 3' of the region recognized by the gRNA targeting domain. Streptococcus pyogenes Cas9 recognizes the NGG PAM sequence. And the novel culprit F. novicida Cas12a recognizes the TTN PAM sequence. PAM sequences of various RNA-guided nucleases have been identified, and strategies for identifying novel PAM sequences have been described in Shmakov et al., 2015, Molecular Cell, 60, 385-397, November 5, 2015. It should also be noted that engineered RNA-guided nucleases may have PAM specificity different from that of a reference molecule (e.g., in the case of engineered RNA-guided nucleases, the reference molecule may be a naturally occurring variant that derives from the RNA-guided nuclease, or a naturally occurring variant that has the greatest amino acid sequence homology with the engineered RNA-guided nuclease).
[0125] In addition to their PAM specificity, RNA-directed nucleases can be characterized by their DNA cleavage activity: naturally occurring RNA-directed nucleases typically form DSBs in target nucleic acids, but engineered variants that only generate SSBs have been produced (discussed above) (Ran and Hsu et al., Cell [Cell] 154(6), 1380-1389, 12 September 2013 (Ran), which is incorporated herein by reference), or engineered variants that do not cleave at all.
[0126] Cas9
[0127] The crystal structures of Streptococcus pyogenes Cas9 have been determined (Jinek 2014) and Staphylococcus aureus Cas9 complexed with single-molecule guide RNA and target DNA have been determined (Nishimasu 2014; Anders 2014; and Nishimasu 2015).
[0128] The naturally occurring Cas9 protein comprises two lobes: a recognition (REC) lobe and a nuclease (NUC) lobe; each lobe contains specific structural and / or functional domains. The REC lobe contains an arginine-rich bridged helix (BH) domain, as well as at least one REC domain (e.g., a REC1 domain and optionally a REC2 domain). The REC lobe does not share structural similarities with other known proteins, indicating that it is a unique functional domain. Not wishing to be limited by any theory, mutation analysis proposes specific functional roles for the BH and REC domains: the BH domain appears to play a role in gRNA:DNA recognition, while the REC domain is thought to interact with the repeat:anti-repeat duplex of gRNA and mediate the formation of the Cas9 / gRNA complex.
[0129] The NUC leaflet contains a RuvC domain, an HNH domain, and a PAM interaction (PI) domain. The RuvC domain shares structural similarity with members of the retroviral integrase superfamily and cleaves the non-complementary (i.e., bottom) strand of the target nucleic acid. It can be formed from two or more split RuvC motifs (e.g., RuvC I, RuvCII, and RuvCIII in *Streptococcus pyogenes* and *Staphylococcus aureus*). Simultaneously, the HNH domain is structurally similar to the HNN endonuclease motif and cleaves the complementary (i.e., top) strand of the target nucleic acid. As its name suggests, the PI domain contributes to PAM specificity.
[0130] While some functions of Cas9 are related to (but not necessarily entirely dependent on) the specific domains described above, these and other functions can be mediated or influenced by other Cas9 domains or multiple domains on any one lobe. For example, in *Streptococcus pyogenes* Cas9, as described in Nishimasu 2014, the gRNA repeat: the anti-repeat duplex falls in the groove between the REC and NUC lobes, and the nucleotides in the duplex interact with amino acids in the BH, PI, and REC domains. Some nucleotides in the first stem-loop structure also interact with amino acids in multiple domains (PI, BH, and REC1), as do some nucleotides in the second and third stem-loops (RuvC and PI domains).
[0131] Cas12a (formerly known as Cpf1)
[0132] The crystal structure of the amino acid complex with crRNA and a double-stranded (ds) DNA target including the TTTN PAM sequence of the genus *Acidaminococcus* Cas12a has been resolved by Yamano et al. (Cell. [Cell] 2016 May 5; 165(4):949-962 (Yamano, which is incorporated herein by reference). Cas12a, like Cas9, has two lobes: a REC (recognition) lobe and a NUC (nuclease) lobe. The REC lobe comprises the REC1 and REC2 domains, which lack similarity to any known protein structure. Meanwhile, the NUC lobe comprises three RuvC domains (RuvC-I, -II, and -III) and a BH domain. However, unlike Cas9, Cas12a REC leaves lack the HNH domain and include other domains that also lack similarity to known protein structures: the structurally unique PI domain, three wedge-shaped (WED) domains (WED-I, -II, and -III), and a nuclease (Nuc) domain.
[0133] Although Cas9 and Cas12a share structural and functional similarities, it should be understood that some Cas12a activities are mediated by domains that are dissimilar to any of the Cas9 domains. For example, cleavage of the complementary strand of the target DNA appears to be mediated by the Nuc domain, which differs sequentially and spatially from the HNH domain of Cas9. Furthermore, the non-target portion (handle) of Cas12a gRNA employs a pseudo-knot structure, rather than the stem-loop structure formed by the repeat:anti-repeat duplex in Cas9 gRNA.
[0134] RNA-directed nuclease modification
[0135] The aforementioned RNA-directed nucleases possess activities and properties suitable for a variety of applications. However, those skilled in the art will understand that RNA-directed nucleases can also be modified in certain circumstances to alter cleavage activity, PAM specificity, or other structural or functional characteristics.
[0136] First, refer to modifications that alter cleavage activity; mutations reducing or eliminating the activity of the NUC leaf domain have been described above. Exemplary mutations that can be performed in the RuvC domain, the Cas9 HNH domain, or the Cas12a Nuc domain are described in Ran and Yamano, as well as Cotta-Ramusino. Generally, mutations reducing or eliminating the activity of one of the two nuclease domains result in an RNA-directed nuclease with cleavage enzyme activity; however, it should be noted that the type of cleavage enzyme activity varies depending on which domain is inactivated. As an example, inactivation of either the RuvC domain or the Cas9 HNH domain yields a cleavage enzyme.
[0137] For *Streptococcus pyogenes* (Kleinstiver et al., *Nature*, 23 July 2015; 523(7561):481-5 (Kleinstiver I)) and *Staphylococcus aureus* (Kleinstiver et al., *Nat Biotechnol*, 2015 Dec; 33(12): 1293-1298 (Kleinstiver II)), PAM-specific modifications relative to the naturally occurring Cas9 reference molecule have been described by Kleinstiver et al. Kleinstiver et al. also described modifications to improve the targeting fidelity of Cas9 (*Nature*, 28 January 2016; 529, 490-495 (Kleinstiver III)). Each of these references is incorporated herein by reference.
[0138] RNA-directed nucleases have been divided into two or more parts, as described by Zetsche et al. (Nat Biotechnol. [Nature Biotechnology] Feb 2015;33(2):139-42 (Zetsche II), which is incorporated by reference) and Fine et al. (Sci Rep. [Scientific Reports] 1 July 2015;5:10777 (Fine), which is incorporated by reference).
[0139] In some embodiments, the RNA-guided nuclease may be size-optimized or truncated, for example via one or more deletions that reduce the size of the nuclease while still retaining gRNA association, target and PAM recognition, and cleavage activity. In some embodiments, the RNA-guided nuclease optionally binds to another polypeptide, nucleotide, or other structure in a covalent or non-covalent manner via a linker. Exemplary bound nucleases and linkers are described in Guilinger et al., Nature Biotechnology 32, 577-582 (2014), which is incorporated herein by reference for all purposes.
[0140] RNA-directed nucleases may optionally include tags, such as, but not limited to, nuclear localization signals, to facilitate the movement of the RNA-directed nuclease protein into the cell nucleus. In some embodiments, the RNA-directed nuclease may incorporate C-terminal and / or N-terminal nuclear localization signals. Nuclear localization sequences are known in the art and described in Maeder and other literature.
[0141] The foregoing list of modifications is intended to be exemplary in nature, and those skilled in the art will understand from this disclosure that other modifications may be possible or desired in certain applications. Therefore, for the sake of brevity, exemplary systems, methods, and compositions of this disclosure are presented with reference to specific RNA-guided nucleases, but it should be understood that the RNA-guided nucleases used can be modified in a manner that does not alter their operating principles. Such modifications are within the scope of this disclosure.
[0142] Exemplary suitable nuclease variants include, but are not limited to, AsCas12a variants containing M537R substitution, H800A substitution, and / or F870L substitution, or any combination thereof (according to the numbering scheme of the AsCas12a wild-type sequence). Other suitable modifications to the AsCas12a amino acid sequence are known to those skilled in the art. Some non-limiting exemplary sequences of wild-type AsCa12a and AsCas12a variants are as follows:
[0143] His-AsCas12a-sNLS-sNLS H800A amino acid sequence
[0144]
[0145] Cas12a variant 1 amino acid
[0146]
[0147] Cas12a variant 2 amino acid sequence
[0148]
[0149] Cas12a variant 3 amino acid sequence
[0150]
[0151] Cas12a variant 4 amino acid sequence
[0152]
[0153] Cas12a variant 4 amino acid sequence
[0154]
[0155] Cas12a variant 5 amino acid sequence
[0156]
[0157] Cas12a variant 6 amino acid sequence
[0158]
[0159] Cas12a variant 7 amino acid sequence
[0160]
[0161] Exemplary AsCas12a wild-type amino acid sequence
[0162]
[0163] In some embodiments, relative to wild-type RNA-guided nucleases and / or RNA-guided nucleases disclosed herein (e.g., RNA-guided nucleases comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 164-172 and SEQ ID NO: 182), the RNA-guided nucleases have at least 80%, at least 85%, at least 86%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity. In some embodiments, relative to wild-type RNA-guided nucleases and / or RNA-guided nucleases disclosed herein (e.g., RNA-guided nucleases comprising amino acid sequences selected from the group consisting of SEQ ID NO: 164-172 and SEQ ID NO: 182), the RNA-guided nucleases have 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 mutations. In some embodiments, relative to wild-type RNA-guided nucleases and / or RNA-guided nucleases disclosed herein (e.g., RNA-guided nucleases comprising amino acid sequences selected from the group consisting of SEQ ID NO: 164-172 and SEQ ID NO: 182), the RNA-guided nucleases have fewer than 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 mutations.
[0164] Nucleic acid encoding RNA-directed nucleases
[0165] This article provides nucleic acids encoding RNA-directed nucleases (e.g., Cas9, Cas12a, or functional fragments thereof). Exemplary nucleic acids encoding RNA-directed nucleases have been previously described (see, for example, Cong 2013; Wang 2013; Mali 2013; Jinek 2012).
[0166] In some cases, the nucleic acid encoding the RNA-directed nuclease can be a synthetic nucleic acid sequence. For example, the synthetic nucleic acid molecule can be chemically modified. In some embodiments, the nucleic acid encoding the RNA-directed nuclease is RNA. In some embodiments, the nucleic acid encoding the RNA-directed nuclease is mRNA. In some embodiments, the mRNA encoding the RNA-directed nuclease will have one or more (e.g., all) of the following properties: it can be capped; polyadenylated; and substituted with 5-methylcytidine and / or pseudouridine.
[0167] Synthesized nucleic acid sequences can also be codon-optimized, for example, by replacing at least one uncommon or less common codon with a common codon. For instance, the synthesized nucleic acid can guide the synthesis of optimized messenger mRNAs (e.g., optimized for expression in mammalian expression systems such as those described herein). An example of a codon-optimized Cas9 coding sequence is presented in Cotta-Ramusino.
[0168] Alternatively, the nucleic acid encoding an RNA-directed nuclease may contain a nucleic acid encoding a nuclear localization sequence (NLS). Nuclear localization sequences are known in the art.
[0169] Functional analysis of candidate molecules
[0170] Candidate RNA-guided nucleases, gRNAs, and their complexes can be evaluated using standard methods known in the art. See, for example, Cotta-Ramusino. The stability of RNP complexes can be assessed using differential scanning fluorometry, as described below.
[0171] Differential scanning fluorescence (DSF)
[0172] The thermal stability of ribonucleoprotein (RNP) complexes containing gRNA and RNA-directed nucleases can be measured via DSF. DSF technology measures the thermal stability of proteins, which can be increased under favorable conditions, such as the addition of binding RNA molecules, like gRNA.
[0173] DSF assays can be performed according to any suitable protocol and can be used in any suitable environment, including but not limited to (a) testing different conditions (e.g., different stoichiometric ratios of gRNA:RNA-directed nuclease protein, different buffer solutions, etc.) to identify optimal conditions for RNP formation; and (b) testing RNA-directed nuclease and / or gRNA modifications (e.g., chemical modifications, sequence alterations, etc.) to identify those modifications that improve RNP formation or stability. One readout of a DSF assay is a shift in the melting temperature of the RNP complex; a relatively high shift indicates that the RNP complex is more stable (and may therefore have higher activity or more favorable formation kinetics, degradation kinetics, or another functional characteristic) relative to a reference RNP complex characterized by a lower shift. When setting up a DSF assay as a screening tool, a threshold melting temperature shift can be specified such that the output is one or more RNPs with a melting temperature shift equal to or higher than the threshold. For example, the threshold can be 5°C–10°C (e.g., 5°, 6°, 7°, 8°, 9°, 10°) or higher, and the output can be one or more RNPs characterized by a melting temperature shift greater than or equal to that threshold.
[0174] Two non-limiting examples of DSF determination conditions are presented below:
[0175] To determine the optimal solution for RNP complex formation, a fixed concentration (e.g., 2 µM) of RNA-directed nuclease (e.g., Cas9 or Cas12a) in water + 10x SYPRO Orange® (Life Technologies catalog number S-6650) was dispensed into 384-well plates. Equimolar amounts of gRNA diluted in solutions with different pH and salt concentrations were then added. After incubation at room temperature for 10 minutes and brief centrifugation to remove any air bubbles, a gradient from 20°C to 90°C was run using a Bio-Rad CFX384™ Real-Time System C1000 Touch™ thermal cycler and Bio-Rad CFX Manager software, increasing the temperature by 1°C every 10 seconds.
[0176] The second assay involves the following steps: GRNA of varying concentrations is mixed with a fixed concentration (e.g., 2 µM) of RNA-directed nuclease (e.g., Cas9 or Cas12a) in the optimal buffer from Assay 1 above, and incubated in a 384-well plate (e.g., at room temperature for 10 minutes). An equal volume of optimal buffer + 10x SYPRO Orange® (Lifetech Corporation catalog number S-6650) is added, and the plate is sealed with Microseal® B adhesive (MSB-1001). After a brief centrifugation to remove any air bubbles, a gradient from 20°C to 90°C is run using a Bio-Rad CFX384™ Real-Time System C1000 Touch™ thermal cycler and Bio-Rad CFXManager software, increasing the temperature by 1°C every 10 seconds.
[0177] Genome editing strategies
[0178] In the various embodiments disclosed herein, the genome editing systems described above are used to produce edits (i.e., alterations) in targeted regions of DNA obtained within or from cells. Various strategies for producing specific edits are described herein, and these strategies are generally described in terms of the desired repair outcome, the number and location of individual edits (e.g., SSBs or DSBs), and the target sites of such edits.
[0179] Genome editing strategies involving the formation of SSBs or DSBs are characterized by repair outcomes, which include: (a) the complete or partial deletion of the target region; (b) the insertion or substitution of the target region in complete or partial form; or (c) the complete or partial interruption of the target region. This grouping is not intended to be restrictive or to be attached to any particular theory or model, but is provided solely for ease of presentation. Those skilled in the art will understand that the listed outcomes are not mutually exclusive and that some repairs may lead to other outcomes. Unless otherwise specified, the description of a particular editing strategy or method should not be construed as requiring a specific repair outcome.
[0180] In some embodiments, substitution of the target region involves replacing all or part of an existing sequence within the target region with a homologous sequence, for example, through gene modification or gene conversion, both of which are mediated via the HDR pathway. HDR is facilitated by using a donor template, which can be single-stranded or double-stranded, as described in more detail below. The single-stranded or double-stranded template can be exogenous, in which case it will facilitate gene modification, or it can be endogenous (e.g., a homologous sequence within the cellular genome) to facilitate gene conversion. The exogenous template can have asymmetric overhangs (i.e., the portion of the template complementary to the DSB site may be offset in the 3' or 5' direction, rather than located at the center within the donor template), for example as described by Richardson et al. (Nature Biotechnology 34, 339-344 (2016), (Richardson), which is incorporated by reference). In the case of a single-stranded template, it can correspond to the complementary (top) or non-complementary (bottom) strand of the target region.
[0181] In some cases, gene conversion and gene correction are facilitated by forming one or more nicks in or around the target region, as described in Ran and Cotta-Ramusino. In other cases, a dual-nicking enzyme strategy is used to form two offset SSBs, which in turn form a single DSB with overhangs (e.g., 5' overhangs).
[0182] The complete or partial interruption and / or deletion of a target sequence can be achieved through a variety of repair outcomes. As an example, the sequence can be deleted by simultaneously generating two or more DSBs flanking the target region, and then the target region can be excised during DSB repair, as described in Maeder for the LCA10 mutation. As another example, the sequence can be interrupted before repair by creating a double-strand break with a single-stranded overhang, followed by exonuclease processing of the overhang.
[0183] A specific subset of target sequence interruptions are mediated by the formation of insertions and deletions within the target sequence, where repair outcomes are typically mediated via the NHEJ pathway (including Alt-NHEJ). NHEJ is known as the "error-prone" repair pathway due to its association with insertion-deletion mutations. However, in some cases, DSBs are repaired via NHEJ without altering the surrounding sequence (so-called "perfect" or "scarless" repair); this usually requires perfect ligation at both ends of the DSB. Meanwhile, insertions and deletions are thought to arise from enzymatic processing of the free ends of DNA prior to ligation, involving the addition and / or removal of nucleotides at one or both ends of one or both strands.
[0184] Because enzymatic processing of the free ends of DSBs can be random, insertion and deletion mutations are often variable, occur along a distribution, and can be influenced by various factors, including specific target sites, cell types used, and genome editing strategies employed. Even so, this can lead to limited generalization regarding insertion and deletion formation: deletions formed by repairing a single DSB are most commonly in the range of 1–50 bp, but can reach greater than 100–200 bp. Insertions formed by repairing a single DSB tend to be short and often consist of short repetitions of sequences tightly surrounding the break site. However, large insertions are possible, and in these cases, the inserted sequence is usually traced back to other regions of the genome or to plasmid DNA present in the cell.
[0185] Insertion-deletion mutations and genome editing systems configured to produce insertions and deletions can be used, for example, to interrupt target sequences when a specific final sequence is not required and / or in cases where frameshift mutations are tolerated. They can also be used in sequences-preferred environments, provided that certain desired sequences tend to occur preferentially via the repair of SSBs or DSBs at a given site. Insertion-deletion mutations are also tools that can be used to evaluate or screen the activity of specific genome editing systems and their components. In these and other environments, insertions and deletions can be characterized by: (a) their relative and absolute frequencies in the genome of cells in contact with the genome editing system, and (b) the distribution of numerical differences relative to unedited sequences, e.g., ±1, ±2, ±3, etc. As an example, in a lead-finding environment, multiple gRNAs can be screened based on insertion-deletion readouts under controlled conditions to identify those gRNAs that most effectively drive cleavage at the target site. Guidelines for producing insertions and deletions at a threshold frequency or at frequencies above a threshold, or producing a specific distribution of insertions and deletions, can be selected for further research and development. Insertion / deletion frequencies and distributions can also be used as readouts to evaluate different genome editing system implementations or configurations and delivery methods, for example, by keeping the gRNA unchanged and changing certain other reaction conditions or delivery methods.
[0186] Multiple strategies
[0187] While the exemplary strategies discussed above focus on repair outcomes mediated by a single DSB, the genome editing system according to this disclosure can also be used to generate two or more DSBs at the same locus or at different loci. Editing strategies involving the formation of multiple DSBs or SSBs are described, for example, in Cotta-Ramusino.
[0188] In some embodiments, this disclosure provides an isolated T cell or population of T cells comprising modifications (e.g., disruption) in two or more endogenous genes of the T cells. In some embodiments, such modifications are introduced into the T cells or population of T cells using one or more genome editing systems described herein. In some embodiments, this disclosure relates to the use of a genome editing system to edit a target FLI-1 nucleic acid sequence of the T cells and one or more additional endogenous genes. For example, the additional endogenous genes may be selected from the group consisting of FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, CIITA, TRBC, and any combination thereof. For example, but not limited to, multiple modifications in the T cell genome can be generated by delivering two or more complexes containing an RNA-directed nuclease (e.g., Cas9 and / or Cas12a) and a gRNA molecule, such as an RNP complex, that targets one or more of the following gene sequences: FLI-1, FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, CIITA, TRBC, or combinations thereof. For example, but not limited to, two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, or ten complexes, such as the RNP complex, can be delivered, each targeting a different gene. In some embodiments, the gRNA may be complementary to any strand of the gene to be targeted. In some embodiments, the gRNA molecule may target a regulatory region, intron, or exon of the gene to be targeted. In some embodiments, the genome editing system comprises a gRNA complementary to the target nucleic acid sequence of FLI-1 and a gRNA complementary to the target nucleic acid sequence of one or more additional endogenous genes selected from the group consisting of FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, CIITA, TRBC, and combinations thereof. In some embodiments, the gRNA may be complementary to any strand of the additional endogenous gene. In some embodiments, the target portion of the additional endogenous gene is within the coding sequence of the additional endogenous gene. In some embodiments, the target portion of the additional endogenous gene is within an exon. In some embodiments, the target portion of the additional endogenous gene is within an intron. In some embodiments, the target portion of the additional endogenous gene is within a regulatory region of the gene. In some embodiments, more than one sequence of the additional endogenous gene is targeted, and the target portion of the additional endogenous gene is located within one or more exons, one or more introns, one or more regulatory regions, or one or more exons, one or more introns, and one or more regulatory regions.In some embodiments, sequences of one or more gRNAs targeting other endogenous genes, or sequences of one or more target DNA sequences of such other endogenous genes, are set forth in International Patent Publication No. WO 2019 / 118516 or International Patent Publication No. WO 2015 / 161276, both of which are incorporated herein by reference in their entirety.
[0189] Donor template design
[0190] Donor template design is described in detail in the literature, such as in Cotta-Ramusino. DNA oligomer donor templates (oligodeoxynucleotides or ODNs) can be single-stranded (ssODN) or double-stranded (dsODN) and can be used to facilitate HDR-based DSB repair, and are particularly useful for introducing alterations into the target DNA sequence, inserting new sequences into the target sequence, or completely replacing the target sequence.
[0191] Whether single-stranded or double-stranded, the donor template typically includes regions homologous to or near (e.g., flanked or adjacent) DNA regions within or adjacent to the target sequence to be cleaved. These homologous regions are referred to herein as “homologous arms” and are schematically illustrated below:
[0192] [5' homologous arm]-[substitution sequence]-[3' homologous arm].
[0193] Homologous arms can have any suitable length (including 0 nucleotides if only one homologous arm is used), and the 3' and 5' homologous arms can have the same length or can have different lengths. The choice of appropriate homologous arm length can be influenced by a variety of factors, such as the expectation of avoiding homology or microhomology with certain sequences (e.g., Alu repeat sequences or other elements). For example, the 5' homologous arm can be shortened to avoid sequence repeat elements. In other embodiments, the 3' homologous arm can be shortened to avoid sequence repeat elements. In some embodiments, both the 5' and 3' homologous arms can be shortened to avoid including certain sequence repeat elements. In addition, some homologous arm designs can improve editing efficiency or increase the frequency of desired repair outcomes. For example, Richardson et al. (Nature Biotechnology 34, 339-344 (2016) (Richardson, incorporated by reference) found that the relative asymmetry of the 3' and 5' homologous arms of a single-stranded donor template affects repair rates and / or outcomes.
[0194] The substitution sequence in the donor template has been described in other literature, including by Cotta-Ramusino et al. The substitution sequence can be of any suitable length (including 0 nucleotides if the desired repair result is deletion) and typically includes one, two, three, or more sequence modifications relative to the naturally occurring sequence within the cell to be edited. One exemplary sequence modification involves altering a naturally occurring sequence to repair a mutation associated with a disease or condition requiring treatment. Another exemplary sequence modification involves altering one or more sequences that are complementary to or encode the PAM sequence of an RNA-directed nuclease or the targeting domain of one or more gRNAs used to generate SSBs or DSBs, to reduce or eliminate redundant cleavage at the target site after the substitution sequence is incorporated into the target site.
[0195] If a linear ssODN is used, it can be configured to (i) anneal to the nicked strand of the target nucleic acid, (ii) anneal to the intact strand of the target nucleic acid, (iii) anneal to the positive strand of the target nucleic acid, and / or (iv) anneal to the negative strand of the target nucleic acid. The ssODN can have any suitable length, for example, about, at least, or no more than 150-200 nucleotides (e.g., 150, 160, 170, 180, 190, or 200 nucleotides).
[0196] It should be noted that the template nucleic acid can also be a nucleic acid vector, such as a viral genome or circular double-stranded DNA, such as a plasmid. Nucleic acid vectors containing a donor template may include other coding or non-coding elements. For example, the template nucleic acid may be delivered as part of a viral genome (e.g., in an AAV or lentiviral genome), which includes certain genomic backbone elements (e.g., terminal inverted repeat sequences in the case of an AAV genome) and optionally includes additional sequences encoding gRNA and / or RNA-directed nucleases. In some embodiments, the donor template may be adjacent to or lateral to a target site recognized by one or more gRNAs to facilitate the formation of a free DSB at one or both ends of the donor template, which may participate in the repair of a corresponding SSB or DSB formed in cellular DNA using the same gRNA. Exemplary nucleic acid vectors suitable for use as donor templates are described in Cotta-Ramusino.
[0197] Regardless of the form used, template nucleic acids can be designed to avoid unwanted sequences. In some embodiments, one or two homologous arms can be shortened to avoid overlap with certain sequence repetitive elements (e.g., Alu repeats, LINE elements, etc.).
[0198] Quantitative measurement of mid-target and off-target gene editing
[0199] It should be noted that the genome editing system disclosed herein allows for the detection and quantification of on-target and off-target gene editing outcomes. The compositions and methods described herein can rely on the use of PCR primer sequences to amplify genomic loci containing the intended cleavage sites of RNA-guided nucleases. In some embodiments, the primers include adaptor tails for a two-step PCR amplification process to prepare an amplicon library for next-generation sequencing (NGS) analysis. Table 8 shows non-limiting examples of primers and amplification sites used to evaluate the on-target genome editing efficiency of the FLI-1 target site shown in [SEQ ID NO:47].
[0200] Table 8: Exemplary primer and amplicon sequences for mid-target cleavage site analysis
[0201]
[0202] In some embodiments, the RNPs disclosed herein have minimal or no off-target effects. In some embodiments, the off-target effects of the RNPs are measured by digenome-seq analysis (Kim et al., Nature Methods (2015); 12:237-243). In some embodiments, the off-target effects of the RNA are represented by off-target counts measured by digenome-seq analysis. In some embodiments, off-target counts are measured by digenome-seq analysis at 1000 nM RNP. In some embodiments, off-target counts are measured by digenome-seq analysis at 100 nM RNP.
[0203] In some embodiments, the off-target counts of the RNP disclosed herein, measured by Digenome-seq analysis at 1000 nM, are less than about 20, less than about 19, less than about 18, less than about 17, less than about 16, less than about 15, less than about 14, less than about 13, less than about 12, less than about 11, less than about 10, less than about 9, less than about 8, less than about 7, less than about 6, less than about 5, less than about 4, less than about 3, less than about 2, or less than about 1. In some embodiments, the off-target counts of the RNP disclosed herein, measured by Digenome-seq at 1000 nM, are zero or approximately zero. In some embodiments, the off-target count of the RNP disclosed herein, measured by Digenome-seq at 100 nM, is less than about 20, less than about 19, less than about 18, less than about 17, less than about 16, less than about 15, less than about 14, less than about 13, less than about 12, less than about 11, less than about 10, less than about 9, less than about 8, less than about 7, less than about 6, less than about 5, less than about 4, less than about 3, less than about 2, or less than about 1. In some embodiments, the off-target count of the RNP disclosed herein, measured by Digenome-seq at 100 nM, is zero or approximately zero.
[0204] In some embodiments, quantitative methods for assessing target and off-target sites include integrating exogenous double-stranded oligonucleotide (dsODN) tags into the genome. For example, GUIDE-Seq (Tsai et al., 2016; Tsai et al., 2014; Tycko et al., 2016, incorporated herein by reference in its entirety) describes compositions and methods that allow for the quantitative analysis of off-target and target gene editing outcomes by integrating dsODNs into RNA-directed nuclease (RGN)-induced double-strand breaks (DSBs). In some embodiments, the dsODN tag is a 34 bp blunt-ended, 5' phosphorylated, phosphate-thioester-linked polynucleotide incorporated into the double-strand break. The dsODN tag contains initiation sites that allow for the amplification, sequencing, and discovery of RGN-induced double-strand breaks. Non-limiting examples of dsODN tags and primers are listed in Table 9.
[0205] Table 9: Exemplary primer and amplicon sequences for off-target cleavage site analysis
[0206]
[0207] Implementation of genome editing systems: delivery, formulation, and administration pathways
[0208] As discussed above, the genome editing system disclosed herein can be implemented in any suitable manner, meaning that the components of such a system (including, but not limited to, RNA-directed nucleases, gRNAs, and optional donor template nucleic acids) can be delivered, formulated, or administered in any suitable form or combination thereof, thereby causing transduction, expression, or introduction of the genome editing system in cells, tissues, or subjects and / or eliciting the desired repair outcome. The genome editing system disclosed herein can incorporate multiple gRNAs, multiple RNA-directed nucleases, and other components, such as proteins, and various implementations will be understood by those skilled in the art based on the principles illustrated in the system disclosed herein. In some embodiments, the genome editing system disclosed herein is delivered to cells as a ribonucleoprotein (RNP) complex. In some embodiments, one or more RNP complexes are delivered to cells sequentially or simultaneously in any order. Tables 10 and 11 illustrate several non-limiting examples of implementations of the genome editing system. However, those skilled in the art will understand that these lists are not exhaustive, and other implementations are possible. Reference is made in particular to Table 10, which lists several exemplary implementations of a genome editing system comprising a single gRNA and an optional donor template. However, the genome editing system disclosed herein can incorporate various gRNAs, various RNA-guided nucleases, and other components, such as proteins, and based on the principles shown in the table, various implementations are readily apparent to those skilled in the art. In the table, [N / A] indicates that the genome editing system does not include the indicated components.
[0209] Table 10
[0210]
[0211] Table 10 summarizes the various delivery methods used for components of genome editing systems as described herein. Again, the list is intended to be illustrative and not restrictive.
[0212] Table 11
[0213]
[0214] Nucleic acid-based delivery of genome editing systems
[0215] Nucleic acids encoding various elements of the genome editing system disclosed herein can be administered to a subject or delivered to cells using methods known in the art or as described herein. For example, DNA encoding RNA-directed nucleases and / or DNA encoding gRNA, along with donor template nucleic acids, can be delivered via vectors (e.g., viral or non-viral vectors), vector-based methods (e.g., using naked DNA or DNA complexes), or combinations thereof. In some embodiments, the genome editing system disclosed herein is delivered by an AAV.
[0216] Nucleic acids encoding a genome editing system or its components can be delivered directly to cells as naked DNA or RNA, for example by transfection or electroporation, or can be conjugated to molecules that promote uptake by target cells (e.g., N-acetylgalactosamine). Nucleic acid vectors, such as those summarized in Table 11, can also be used. In some embodiments, the genome editing system disclosed herein is delivered to cells via electroporation.
[0217] One approach to cell therapy involves the direct delivery of an active protein into human cells. The protein delivery agent Feldan Shuttle is a protein-based delivery agent specifically designed for cell therapy (Del'guidice et al., PLoSOne. [PLOS ONE]. April 4, 2018; 13(4):e0195558; incorporated herein by reference in its entirety). In some embodiments, the genome editing system disclosed herein is delivered into cells via Feldan Shuttle.
[0218] Nucleic acid vectors may contain one or more sequences encoding components of a genome editing system, such as RNA-directed nucleases, gRNAs, and / or donor templates. Vectors may also contain sequences encoding signal peptides (e.g., for nuclear, nucleolar, or mitochondrial localization) that associate (e.g., are inserted into or fused with) sequences encoding proteins. As an example, a nucleic acid vector may include RNA-directed nuclease (e.g., Cas9 or Cas12a) encoding sequences that include one or more nuclear localization sequences (e.g., nuclear localization sequences from SV40).
[0219] Nucleic acid vectors may also include any suitable number of regulatory / control elements, such as promoters, enhancers, introns, polyadenylation signals, Kozak concordant sequences, or internal ribosome entry sites (IRES). These elements are well known in the art and are described in Cotta-Ramusino.
[0220] Nucleic acid vectors disclosed herein include recombinant viral vectors. Exemplary viral vectors are shown in Table 11, and other suitable viral vectors, their use, and generation are described in Cotta-Ramusino. Other viral vectors known in the art may also be used. Additionally, viral particles may be used to deliver components of a genome editing system in the form of nucleic acids and / or peptides. For example, “empty” viral particles may be assembled to contain any suitable load. Viral vectors and viral particles may also be engineered to incorporate targeting ligands, thereby altering target tissue specificity.
[0221] In addition to viral vectors, non-viral vectors can be used to deliver nucleic acids encoding the genome editing system according to this disclosure. An important category of non-viral nucleic acid vectors is nanoparticles, which can be organic or inorganic. Nanoparticles are well known in the art and are outlined in Cotta-Ramusino. Any suitable nanoparticle design can be used to deliver components of a genome editing system or nucleic acids encoding such components. For example, in some embodiments of this disclosure, organic (e.g., lipids and / or polymers) nanoparticles may be suitable as delivery media. Exemplary lipids for nanoparticle formulations and / or gene transfer are shown in Table 12, and Table 13 lists exemplary polymers for gene transfer and / or nanoparticle formulations.
[0222] Table 12: Lipids used for gene transfer
[0223]
[0224] Table 13: Polymers used for gene transfer
[0225]
[0226] Nonviral vectors optionally include targeting modifications to improve uptake and / or selectively target certain cell types. These targeting modifications may include, for example, cell-specific antigens, monoclonal antibodies, single-chain antibodies, aptamers, polymers, sugars (e.g., N-acetylgalactosamine (GalNAc)), and cell-penetrating peptides. Such vectors also optionally employ solubilizing and endosome-destabilizing peptides / polymers, undergo acid-triggered conformational changes (e.g., accelerating endosome escape from the load), and / or incorporate stimuli-cleavable polymers, for example, for release within cellular compartments. For example, disulfide-based cationic polymers that cleave in a reducing cellular environment can be used.
[0227] In some embodiments, one or more nucleic acid molecules (e.g., DNA molecules) are delivered in addition to components of the genome editing system (e.g., RNA-guided nuclease components and / or gRNA components as described herein). In some embodiments, the nucleic acid molecules are delivered simultaneously with one or more components of the genome editing system. In some embodiments, the nucleic acid molecules are delivered before or after the delivery of one or more components of the genome editing system (e.g., less than about 30 minutes, 1 hour, 2 hours, 3 hours, 6 hours, 9 hours, 12 hours, 1 day, 2 days, 3 days, 1 week, 2 weeks, or 4 weeks). In some embodiments, the nucleic acid molecules are delivered in a manner different from that used for delivering one or more components of the genome editing system (e.g., RNA-guided nuclease components and / or gRNA components). Nucleic acid molecules can be delivered by any of the delivery methods described herein. For example, nucleic acid molecules can be delivered by a viral vector (e.g., an integration-deficient lentivirus), and RNA-guided nuclease molecule components and / or gRNA components can be delivered by electroporation, for example, to reduce toxicity caused by nucleic acids (e.g., DNA). In some embodiments, the nucleic acid molecules encode therapeutic proteins, such as those described herein. In some embodiments, nucleic acid molecules encode RNA molecules, such as the RNA molecules described herein.
[0228] Delivery of RNPs and / or RNAs encoding components of genome editing systems
[0229] RNPs (complexes of gRNA and RNA-directed nucleases) and / or RNA encoding RNA-directed nucleases and / or gRNAs can be delivered into cells or administered to subjects using methods known in the art, some of which are described in Cotta-Ramusino. In vitro, RNA encoding RNA-directed nucleases and / or gRNAs can be delivered, for example, by microinjection, electroporation, transient cell compression, or extrusion (see, for example, Lee 2012). In vitro and in vivo delivery can also be achieved using lipid-mediated transfection, peptide-mediated delivery, GalNAc or other conjugate-mediated delivery, and combinations thereof.
[0230] In vitro, delivery via electroporation involves mixing cells with RNA (with or without a donor template nucleic acid molecule) encoded by RNA-directed nucleases and / or gRNA in a cassette, chamber, or cuvette, and applying one or more electrical pulses of defined duration and amplitude. Systems and protocols for electroporation are known in the art, and any suitable electroporation tools and / or protocols may be used in conjunction with the various embodiments disclosed herein.
[0231] In some embodiments, the ribonucleoprotein (RNP) complex comprises a guide RNA, a Cas12a protein, including a modified Cas12a protein (AsCas12a variant). Non-limiting examples of Cas12a (Cpf1) proteins are listed in SEQ ID NO: 164-172 and SEQ ID NO: 182. In some embodiments, the RNP complex may comprise a guide RNA (gRNA) complexed with the Cas12a protein or a modified Cas12a protein. In some embodiments, the gRNA may comprise the sequences shown in SEQ ID NO: 67-109 or SEQ ID NO: 110-161. In some embodiments, the RNP complex may comprise the RNP complexes shown in Table 14. For example, the RNP complex may comprise gRNA (containing the sequences shown in SEQ ID NO: 90, 133, or 163), a modified Cas12a protein shown in SEQ ID NO: 168 or SEQ ID NO: 182, and target the FLI-1 gene at the sequence shown in SEQ ID NO: 47 or SEQ ID NO: 181.
[0232] Table 14: Exemplary Ribonucleoprotein (RNP) Conformations
[0233]
[0234] target cells
[0235] The genome editing system disclosed herein can be used to manipulate or alter target cells, for example, to edit or alter target nucleic acids. In various embodiments, the manipulation can be performed in vivo or ex vivo.
[0236] In some embodiments, the target cells contain edits to the target sequence of the FLI-1 gene. In some embodiments, the target cells contain insertions or deletions to the target sequence of the FLI-1 gene. In some embodiments, the target cells contain all or part of the deletion of the target sequence of the FLI-1 gene. In some embodiments, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or at least 100% of the target cells in contact with the genome editing system contain insertions or deletions to the FLI-1 gene. Insertions or deletions can be detected by any method known in the art, such as Illumina amplicon-based sequencing as described in Example 1 herein.
[0237] In some embodiments, the percentage of target cells containing insertional deletions increases in a concentration-dependent manner as the concentration of the RNP complex increases.
[0238] In some embodiments, the RNP complex induces insertions or deletions at or near the target site of the FLI-1 gene with EC50 values less than about 60 nM, less than about 70 nM, less than about 80 nM, less than about 90 nM, less than about 100 nM, less than about 110 nM, less than about 120 nM, less than about 130 nM, less than about 140 nM, less than about 150 nM, less than about 160 nM, less than about 170 nM, less than about 180 nM, less than about 200 nM, less than about 210 nM, less than about 220 nM, less than about 230 nM, less than about 240 nM, less than about 250 nM, less than about 260 nM, less than about 270 nM, less than about 280 nM, less than about 290 nM, less than about 300 nM, less than about 310 nM, less than about 320 nM, less than about 330 nM, and less than about 340 nM. nM or less than about 350 nM.
[0239] In some embodiments, the level of the FLI-1 gene product is reduced in target cells relative to cells not exposed to the genome editing system. In some embodiments, the FLI-1 gene product is mRNA. In some embodiments, the FLI-1 gene product is protein. In some embodiments, the FLI-1 protein level is reduced by at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 99%, or at least about 100% in target cells exposed to the genome editing system, relative to cells not exposed to the system. The amount of FLI-1 protein can be measured by any method known in the art, such as by Western blotting as described in Example 1 herein.
[0240] In some embodiments, the relative FLI-1 gene product decreases in a concentration-dependent manner as the RNP complex concentration increases. In some embodiments, the level of the FLI-1 gene product is reduced relative to the concentration of the RNP complex, with EC50 values less than about 30 nM, less than about 35 nM, less than about 40 nM, less than about 45 nM, less than about 50 nM, less than about 55 nM, less than about 60 nM, less than about 65 nM, less than about 70 nM, less than about 75 nM, less than about 80 nM, less than about 85 nM, less than about 90 nM, less than about 95 nM, less than about 100 nM, less than about 105 nM, less than about 110 nM, less than about 115 nM, less than about 120 nM, less than about 125 nM, less than about 130 nM, less than about 135 nM, less than about 140 nM, less than about 145 nM, less than about 150 nM, less than about 155 nM, less than about 160 nM, or less than about 170 nM.
[0241] In some embodiments, the target cells are immune-active cells, such as T cells, CD8+ T cells (e.g., CD8+ natural T cells, central memory T cells, or effector memory T cells), CD4+ T cells, α / β T cells, γ / δ T cells, natural killer T cells (NKT cells), regulatory T cells (Tregs), stem cell memory T cells, lymphoid progenitor cells, hematopoietic stem cells, natural killer cells (NK cells), or dendritic cells. In some embodiments, the target cells are induced pluripotent stem (iPS) cells or cells derived from iPS cells (e.g., iPS cells generated from a subject), which are manipulated to alter one or more target genes (e.g., induce mutations therein) or manipulate the expression of these genes, and differentiate into, for example, T cells (e.g., CD8+ T cells (e.g., CD8+ natural T cells, central memory T cells, or effector memory T cells), CD4+ T cells, stem cell memory T cells), lymphoid progenitor cells, or hematopoietic stem cells.
[0242] In some embodiments, the target cells have been modified to contain specific T-cell receptor (TCR) genes (e.g., TRAC and TRBC genes). In another embodiment, the TCR has binding specificity to tumor-associated antigens. In some embodiments, the TCR is an engineered TCR.
[0243] In some embodiments, the target cells have been modified to contain a specific chimeric antigen receptor (CAR). In these embodiments, the CAR exhibits binding specificity for tumor-associated antigens.
[0244] In another embodiment, the target cells have been modified to bind tumor antigens, for example, via TCR or CAR.
[0245] In some embodiments, the target cells contain genome editing that results in partial or complete loss of FLI-1 function. While not wishing to be bound by any particular theory, it is conceivable that partial or complete loss of FLI-1 function in targeted T cells relative to wild-type FLI-1 T cells provides an effective strategy to reduce and / or eliminate T cell-mediated graft-versus-host disease (GVHD). In some embodiments, achieving such T cell-mediated GVHD reduction does not impair the efficacy that targeted T cells should exert in hematopoietic cell therapy.
[0246] In some embodiments, target cells are used to treat diseases, disorders, or conditions, such as tumors and / or cancer.
[0247] This document provides methods for administering the cells and compositions described herein, and the use of such cells and compositions to treat or prevent diseases, conditions, and disorders, including cancer. In some embodiments, the cells and compositions are administered to a subject or patient suffering from a specific disease or condition to be treated, for example via adoptive cell therapy, such as adoptive T-cell therapy. In some embodiments, cells and compositions prepared by the methods provided (e.g., engineered compositions and manufacturing end compositions following incubation and / or other processing steps) are administered to a subject, such as a subject suffering from or at risk of a disease or condition. In some aspects, these methods thereby treat (e.g., improve) one or more symptoms of a disease or condition, such as by reducing the tumor burden in cancers expressing antigens recognized by engineered T cells.
[0248] In some embodiments, cell therapy (e.g., adoptive T-cell therapy) is performed via autologous transplantation, wherein cells are isolated and / or otherwise prepared from a subject receiving cell therapy or from a sample derived from such a subject. Thus, in some aspects, cells are derived from a subject requiring treatment (e.g., a patient), and after isolation and processing, the cells are administered to the same subject.
[0249] In some embodiments, cell therapy (e.g., adoptive T-cell therapy) is performed via allogeneic transplantation, wherein the cells are isolated and / or otherwise prepared from a subject other than the subject who will receive or will eventually receive the cell therapy (e.g., the first subject). In such embodiments, the cells are then administered to a different subject of the same species, such as a second subject. In some embodiments, the first and second subjects are genetically similar. In some embodiments, the second subject expresses the same HLA class or supertype as the first subject.
[0250] The diseases, conditions, and disorders treated by the provided compositions, cells, methods, and uses are tumors, including solid tumors, hematologic malignancies, and melanomas, as well as infectious diseases such as infections with viruses or other pathogens (e.g., HIV, HCV, HBV, CMV) and parasitic diseases. In some embodiments, the disease or condition is a tumor, cancer, malignant tumor, growth, or other proliferative disease or disorder. Such diseases include, but are not limited to, leukemia, lymphoma, such as chronic lymphocytic leukemia (CLL), acute lymphoblastic leukemia (ALL), non-Hodgkin's lymphoma, acute myeloid leukemia, multiple myeloma, refractory follicular lymphoma, mantle cell lymphoma, indolent B-cell lymphoma, B-cell malignancies, colon cancer, lung cancer, liver cancer, breast cancer, prostate cancer, ovarian cancer, skin cancer, melanoma, bone cancer and brain cancer, ovarian cancer, epithelial cancer, renal cell carcinoma, pancreatic adenocarcinoma, Hodgkin's lymphoma, cervical cancer, colorectal cancer, glioblastoma, neuroblastoma, Ewing's sarcoma, medulloblastoma, osteosarcoma, synovial sarcoma and / or mesothelioma.
[0251] Cells can be administered by any suitable method, such as by bolus infusion, by injection (e.g., intravenous or subcutaneous), intraocular, periocular, subretinal, intravitreal, transseptal, subscleral, choroidal, anterior chamber, subconjuntival, subfascial, retroocular, periocular, or posterior parascleral delivery. In some embodiments, they are administered parenterally, intrapulmonaryly, and intranasally, and, if local treatment is required, intralesionally. Parenterally infusion includes intramuscular, intravenous, intraarterial, intraperitoneal, or subcutaneous administration. In some embodiments, a given dose is administered by a single bolus of cells. In some embodiments, it is administered by multiple boluses of cells (e.g., over a period not exceeding 3 days) or by continuous infusion of cells. Exemplary embodiments
[0252] A1. The subject of this disclosure provides a genome editing system comprising: (a) a gRNA molecule containing a target domain that targets a target sequence of the FLI-1 gene, and (b) an RNA-directed nuclease, or a nucleic acid encoding the RNA-directed nuclease.
[0253] A2. The genome editing system as described in A1, wherein the target sequence of the FLI-1 gene is in exon 5 of FLI-1.
[0254] A3. The genome editing system as described in A1, wherein (a) the target sequence of the FLI-1 gene comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 24-66; and / or (b) the target domain comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 67-109.
[0255] A4. The genome editing system as described in A2, wherein (a) the target sequence of the FLI-1 gene comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 25, SEQ ID NO: 36, and SEQ ID NO: 47; and / or (b) the target domain comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 68, SEQ ID NO: 79, and SEQ ID NO: 90.
[0256] A5. The genome editing system as described in any one of A1-A4, wherein (a) the target sequence of the FLI-1 gene comprises the nucleotide sequence shown in SEQ ID NO: 47; and / or (b) the target domain comprises the nucleotide sequence shown in SEQ ID NO: 90.
[0257] A6. A genome editing system as described in any one of A1-A5, wherein the RNA-guided nuclease is selected from the group consisting of: Cas9 (e.g., SpCas9, SaCas9, (KKH)SaCas9, eSpCas9, Cas9-HF1, HypaCas9, dCas9-Fokl, Sniper-Cas9, xCas9, evoCas9, SpCas9-NG, VRQR, VRER, NmeCas9, CjCas9), Cas12, Cas12a (also known as Cpf1; e.g., AsCas12a, LbCas12a), Cas12b (e.g., AaCas12b, BhCas12b, BhCas12b V4), Cas12cl, Cas12c2, Cas12hl, Cas12il, CasX, CasY, and CasΦ.
[0258] A7. The genome editing system as described in any one of A1-A6, wherein the RNA-directed nuclease is the Cas12a protein.
[0259] A8. The genome editing system as described in any one of A1-A7, wherein the Cas12a protein is a modified Cas12a protein.
[0260] A9. The genome editing system as described in any one of A1-A8, wherein the modified Cas12a protein is an enhanced Cas12a protein.
[0261] A10. The genome editing system of any one of A1-A9, wherein the RNA-directed nuclease comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 164-172 and SEQ ID NO: 182.
[0262] A11. The genome editing system of any one of A1-A10, wherein the RNA-directed nuclease comprises the amino acid sequence shown in SEQ ID NO: 168 or SEQ ID NO: 182.
[0263] A12. The genome editing system as described in any one of A1-A11, wherein the gRNA molecule further comprises a Cas12a stem-loop.
[0264] A13. The genome editing system of any one of A1-A12, wherein the gRNA molecule further comprises a nucleotide extension, wherein the nucleotide extension is a 5' extension, a 3' extension, or a combination thereof.
[0265] A14. The genome editing system of any one of A1-A13, wherein the nucleotide extension comprises one or more RNA bases, one or more DNA bases, or a combination thereof.
[0266] A15. The genome editing system as described in any one of A1-A14, wherein the gRNA molecule contains one or more modified bases.
[0267] A16. The genome editing system of any one of A13-A15, wherein the nucleotide extension is a 5' extension of a nucleotide sequence comprising the group consisting of SEQ ID NO: 1-23.
[0268] A17. The genome editing system as described in any one of A1-A16, wherein the extension is a 5' extension comprising the nucleotide sequence shown in SEQ ID NO: 7.
[0269] A18. The genome editing system of any one of A1-A17, wherein the gRNA molecule comprises a DNA / RNA oligonucleotide, the DNA / RNA oligonucleotide comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 110-161.
[0270] A19. The genome editing system as described in any one of A1-A18, wherein the gRNA molecule comprises the nucleotide sequence shown in SEQ ID NO: 90, SEQ ID NO: 133 or SEQ ID NO: 163.
[0271] B1. The subject of this disclosure provides a ribonucleoprotein (RNP) complex comprising a genome editing system as described in any one of A1-A19.
[0272] C1. The subject matter of this disclosure provides a vector for delivering a genome editing system as described in any one of A1-A19, wherein the vector comprises DNA encoding the gRNA molecule and / or an RNA-directed nuclease, RNA encoding the gRNA molecule and / or an RNA-directed nuclease, or a combination thereof.
[0273] D1. The subject matter of this disclosure provides a method for editing the FLI-1 gene in a target cell, the method comprising contacting the target cell with a genome editing system as described in any one of A1-A19, an RNP complex as described in B1, or a vector as described in C1.
[0274] E1. The subject of this disclosure provides a cell comprising a genome editing system as described in any one of A1-A19, an RNP complex as described in B1, or a vector as described in C1.
[0275] E2. Cells as described in E1, wherein, relative to cells lacking any of the genome editing systems described in any of A1-A19, the RNP complex described in B1, or the vector described in C1, the level of the FLI-1 gene product in the cells is reduced.
[0276] E3. A cell as described in any one of E1-E2, wherein the cell contains an insertion or deletion in the target sequence of FLI-1.
[0277] F1. The subject of this disclosure provides a cell containing one or more genome edits in the FLI-1 gene, wherein the cell is edited by a method as described in D1.
[0278] F2. The cell as described in F1, wherein the one or more genome edits comprise the insertion or deletion in the target sequence of the FLI-1 gene.
[0279] F3. The cell as described in F2, wherein the insertion deletion comprises all or part of the target sequence of the FLI-1 gene.
[0280] F4. Cells as described in F1-F3, wherein the cells are T cells.
[0281] F5. Cells as described in F4, wherein the T cells are α / β T cells.
[0282] F6. The cell as described in any one of F1-F4, wherein the cell further comprises a chimeric antigen receptor (CAR).
[0283] F7. Cells as described in F6, wherein the CAR binds to tumor antigens.
[0284] G1. The subject of this disclosure provides a composition comprising an engineered cell population containing an insertion or deletion at a target sequence of the FLI-1 gene, wherein the target sequence comprises a nucleotide sequence selected from the group consisting of SEQ ID NO:24-66 and SEQ ID NO:181.
[0285] G2. The composition as described in G1, wherein the level of the FLI-1 gene product in the cell population is reduced relative to the unengineered cell population.
[0286] G3. The composition as described in G1 or G2, wherein the engineered cell is a T cell.
[0287] G4. The composition as described in G3, wherein the T cells are α / β T cells.
[0288] H1. The subject matter of this disclosure provides a method for treating a disease or disorder, the method comprising administering to a subject in need a genome editing system as described in any one of A1-A19, an RNP as described in B1, a vector as described in C1, a cell as described in any one of E1-E3, a cell as described in any one of F1-F7, or a composition as described in any one of G1-G4.
[0289] H2. The method as described in H1, wherein the disease or disorder is a tumor, cancer, malignant tumor, growth, or other proliferative disease or disorder.
[0290] H3. The method as described in H1 or H2, wherein the disease or disorder is selected from the group consisting of: leukemia, lymphoma, such as chronic lymphocytic leukemia (CLL), acute lymphoblastic leukemia (ALL), non-Hodgkin's lymphoma, acute myeloid leukemia, multiple myeloma, refractory follicular lymphoma, mantle cell lymphoma, indolent B-cell lymphoma, B-cell malignancies, colon cancer, lung cancer, liver cancer, breast cancer, prostate cancer, ovarian cancer, skin cancer, melanoma, bone cancer and brain cancer, ovarian cancer, epithelial cancer, renal cell carcinoma, pancreatic adenocarcinoma, Hodgkin's lymphoma, cervical cancer, colorectal cancer, glioblastoma, neuroblastoma, Ewing's sarcoma, medulloblastoma, osteosarcoma, synovial sarcoma and / or mesothelioma.
[0291] I1. The subject of this disclosure provides a gRNA molecule containing a targeting domain that targets a target sequence of the FLI-1 gene.
[0292] I2. The gRNA molecule as described in I1, wherein the target sequence of the FLI-1 gene is in exon 5 of FLI-1.
[0293] I3. The gRNA molecule as described in I1 or I2, wherein (a) the target sequence of the FLI-1 gene comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 24-66; and / or (b) the target domain comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 67-109.
[0294] I4. The gRNA molecule as described in I1, wherein (a) the target sequence of the FLI-1 gene comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 25, SEQ ID NO: 36, and SEQ ID NO: 47; and / or (b) the target domain comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 68, SEQ ID NO: 79, and SEQ ID NO: 90.
[0295] I5. The gRNA molecule as described in any one of I1-I4, wherein (a) the target sequence of the FLI-1 gene comprises the nucleotide sequence shown in SEQ ID NO: 47; and / or (b) the target domain comprises the nucleotide sequence shown in SEQ ID NO: 90. Example
[0296] The following examples are merely illustrative and are not intended to limit the scope or content of the invention in any way.
[0297] Example 1: RNP complex targeting FLI-1
[0298] Internal bioinformatics tools were used to identify guide RNAs (gRNAs) targeting the FLI-1 gene on chromosome 11. Briefly, CALITAS (CRISPR-Cas-aware Aligner for computer simulation of off-target searches; Fennell et al., 2021) was used to identify AsCas12a-compatible, T-rich prototypical spacer neighbor motif (PAM) sites within the FLI-1 gene. This procedure identified each 21-nucleotide-long target sequence and its corresponding PAM site, filtering out sequences that comprised only exons 1–9 of the FLI-1 transcript (ENST00000527786.7). Sequences were also selected based on the uniqueness of a single exact match site within the genome, excluding sequences with one base mismatch and a vacancy. A list of identified target sites (N = 43) is presented in Table 4.
[0299] Targeting domains targeting 43 identified target sites were assembled into gRNAs with an added AsCas12a 5' stem-loop. The resulting 41-nucleotide crRNA oligonucleotide was then complexed with the AsCas12a protein (SEQ ID NO: 168). The resulting ribonucleoprotein complex (RNP) was prepared at 88 μM with a gRNA:AsCas12a ratio of 2:1 and transfected into CD4+ T cells via electroporation (Lonza). After 96 hours of incubation, genomic DNA was extracted and evaluated by next-generation sequencing (NGS). Genomic DNA was isolated using the Agencourt DNAdvance kit (Beckman Coulter, Inc.) and quantified using the Quant-IT Pico Green dsDNA assay kit (Thermo Fisher Scientific), each according to the manufacturer's instructions. The editing efficiency of each target sequence is determined by assessing the percentage of sequencing reads that contain insertions or deletions (edits) occurring within + / - 15 bases of the expected cleavage site in the corresponding target sequence. Figure 1 ).like Figure 1 As shown, the RNP preparation (RNP24) containing the crRNA shown in [SEQ ID NO: 133] and targeting the FLI-1 site shown in [SEQ ID NO: 47] is one of the best candidates for generating insertions and deletions in approximately 80% of sequencing reads.
[0300] The crRNA oligonucleotide shown in [SEQ ID NO: 133] has a 25-nucleotide DNA extension shown in [SEQ ID NO: 7] attached to its 5' end. The resulting 66-nucleotide DNA / RNA oligonucleotide shown in [SEQ ID NO: 163] is combined with the AsCas12a nuclease shown in [SEQ ID NO: 168] to produce RNP44 shown in Table 14.
[0301] RNP44 was functionally validated in various cell types from different subjects and at different doses. RNP30 was serially diluted in an equal volume mixture of buffer 1 (10 mM HEPES pH 7.5, 150 mM NaCl) and buffer 2 (10 mM HEPES pH 7.5, 300 mM NaCl, 20% glycerol, 10 mM TCEP). CD4+ and CD8+ T cells from multiple donors were electroporated via nuclear transfection (Lonza) with different concentrations of RNP44, and then incubated at 37°C and 5% CO2 for 96 hours. Cell donors and cell types are shown in Table 15.
[0302] After 96 hours of incubation, genomic DNA was extracted as described above, and the genome editing rate was determined by NGS analysis of PCR amplicones containing the expected cleavage sites. Amplicon libraries were prepared using a two-step PCR amplification method for sequencing; the PCR primers and amplification sites are shown in Table 8. Figure 2A The relationship between editing and concentration, as measured by Illumina amplicon-based sequencing, is shown. The percentage of editing was determined using the percentage of sequencing reads with insertions or deletions within + / - 15 bases of the expected cleavage site.
[0303] Seventy-two hours post-nuclear transfection, concentration-dependent knockout of FLI-1 was evaluated at the protein level using an automated capillary-based Western blot system (JESS, Proteinsimple) that determines protein size and abundance via chemiluminescence. Total protein was quantified using a quinolinic acid (BCA) kit (Thermo Fisher Scientific) according to the manufacturer's instructions. FLI-1 protein expression was quantified using an anti-FLI-1 antibody and a loaded control antibody. FLI-1 protein levels were determined using the normalized ratio of the FLI-1 protein chemiluminescence signal peak to the non-targeted control protein signal peak. Rendered blots of protein abundance are shown as follows: Figure 2C As shown, the relationship between the reduction of FLI-1 protein and RNP concentration is as follows: Figure 2B As shown.
[0304] Table 15 shows the EC50 values for editing percentage and protein inhibition. Figure 2A The concentration-response curves shown in -C were fitted using a four-parameter logistic regression equation. The geometric mean EC50 for editing was 152.11 nM, while the geometric mean EC50 for FLI-1 knockdown was 75.57 nM. These results indicate that the editing activity of RNP44 increases in a concentration-dependent manner, and that editing leads to a decrease in FLI-1 protein levels. Furthermore, this response was consistent in CD4+ and CD8+ T cells from the same donor as well as from three different donors. Therefore, RNP44 targeting the FLI-1 site shown in [SEQ ID NO: 47] can edit and knock out the FLI-1 gene in human cells.
[0305] Table 15: Cell lines and corresponding EC50 values for RNP44 characterization
[0306] By incorporating via reference
[0307] All publications, patents, and patent applications mentioned herein are incorporated herein by reference in their entirety, as each individual publication, patent, or patent application specifically and individually indicates its inclusion by reference. In case of conflict, this application (including any definitions herein) shall prevail. equivalent
[0308] Those skilled in the art will recognize or be able to identify many equivalents of the particular embodiments described herein using only conventional experiments. Such equivalents are intended to be covered by the following claims.
Claims
1. A genome editing system comprising: (a) A gRNA molecule containing a targeting domain that targets the Freund's virus leukemia integration 1 transcription factor (FLI-1) gene, and (b) An RNA-directed nuclease, or a nucleic acid encoding the RNA-directed nuclease.
2. The genome editing system of claim 1, wherein the target sequence of the FLI-1 gene is in exon 5 of FLI-1.
3. The genome editing system of claim 1, wherein... (a) The target sequence of the FLI-1 gene contains a nucleotide sequence selected from the group consisting of SEQ ID NO: 24-66; and / or (b) The targeting domain comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 67-109.
4. The genome editing system of claim 2, wherein... (a) The target sequence of the FLI-1 gene comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 25, SEQ ID NO: 36, and SEQ ID NO: 47, and / or (b) The targeting domain comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 68, SEQ ID NO: 79, and SEQ ID NO:
90.
5. The genome editing system according to any one of claims 1-4, wherein (a) The target sequence of the FLI-1 gene contains the nucleotide sequence shown in SEQ ID NO: 47; and / or (b) The target domain comprises the nucleotide sequence shown in SEQ ID NO:
90.
6. The genome editing system according to any one of claims 1-5, wherein the RNA-guided nuclease is selected from the group consisting of: Cas9 (e.g., SpCas9, SaCas9, (KKH)SaCas9, eSpCas9, Cas9-HF1, HypaCas9, dCas9-Fokl, Sniper-Cas9, xCas9, evoCas9, SpCas9-NG, VRQR, VRER, NmeCas9, CjCas9), Cas12, Cas12a (also known as Cpf1; e.g., AsCas12a, LbCas12a), Cas12b (e.g., AaCas12b, BhCas12b, BhCas12b V4), Cas12cl, Cas12c2, Cas12hl, Cas12il, CasX, CasY, and CasΦ.
7. The genome editing system of any one of claims 1-6, wherein the RNA-directed nuclease is the Cas12a protein.
8. The genome editing system according to any one of claims 1-7, wherein the Cas12a protein is a modified Cas12a protein.
9. The genome editing system of any one of claims 1-7, wherein the modified Cas12a protein is an enhanced Cas12a protein.
10. The genome editing system of any one of claims 1-9, wherein the RNA-directed nuclease comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 164-172 and SEQ ID NO:
182.
11. The genome editing system of any one of claims 1-9, wherein the RNA-directed nuclease comprises the amino acid sequence shown in SEQ ID NO: 168 or SEQ ID NO:
182.
12. The genome editing system of any one of claims 1-11, wherein the gRNA molecule further comprises a Cas12a stem-loop.
13. The genome editing system of any one of claims 1-12, wherein the gRNA molecule further comprises a nucleotide extension, wherein the nucleotide extension is a 5' extension, a 3' extension, or a combination thereof.
14. The genome editing system of claim 13, wherein the nucleotide extension comprises one or more RNA bases, one or more DNA bases, or a combination thereof.
15. The genome editing system of any one of claims 1-14, wherein the gRNA molecule contains one or more modified bases.
16. The genome editing system of any one of claims 13-15, wherein the nucleotide extension is a 5' extension of a nucleotide sequence comprising the group consisting of SEQ ID NO: 1-23.
17. The genome editing system of any one of claims 13-16, wherein the extension is a 5' extension comprising the nucleotide sequence shown in SEQ ID NO:
7.
18. The genome editing system of any one of claims 1-17, wherein the gRNA molecule comprises a DNA / RNA oligonucleotide, the DNA / RNA oligonucleotide comprising a sequence selected from the group consisting of SEQ ID NO: 110-161.
19. The genome editing system of any one of claims 1-16, wherein the gRNA molecule comprises the nucleotide sequence shown in SEQ ID NO: 90, SEQ ID NO: 133 or SEQ ID NO:
163.
20. A ribonucleoprotein (RNP) complex comprising the genome editing system as described in any one of claims 1-19.
21. A vector for delivering a genome editing system as described in any one of claims 1-19, wherein the vector comprises DNA encoding the gRNA molecule and / or an RNA-directed nuclease, RNA encoding the gRNA molecule and / or an RNA-directed nuclease, or a combination thereof.
22. A method for editing the FLI-1 gene in a target cell, the method comprising contacting the target cell with a genome editing system as described in any one of claims 1-19, an RNP complex as described in claim 20, or a vector as described in claim 21.
23. A cell comprising the genome editing system of any one of claims 1-19, the RNP complex of claim 20, or the vector of claim 21.
24. The cell of claim 23, wherein the level of the FLI-1 gene product in the cell is reduced relative to a cell lacking any of the genome editing systems of claims 1-19, the RNP complex of claim 20, or the vector of claim 21.
25. The cell of claim 23 or 24, wherein the cell comprises an insertion or deletion in the target sequence of the FLI-1 gene.
26. A cell comprising one or more genome edits of the FLI-1 gene, wherein the cell is edited by the method of claim 22.
27. The cell of claim 25, wherein the one or more genome edits comprise insertions or deletions in the target sequence of the FLI-1 gene.
28. The cell of claim 27, wherein the insertion deletion comprises all or part of the target sequence of the FLI-1 gene.
29. The cell of any one of claims 26-28, wherein the cell is a T cell.
30. The cell of claim 29, wherein the T cell is an α / β T cell.
31. The cell of claim 29 or 30, wherein the cell further comprises a chimeric antigen receptor (CAR).
32. The cell of claim 31, wherein the CAR binds to the tumor antigen.
33. A composition comprising an engineered cell population containing an insertion or deletion at a target sequence of the FLI-1 gene, wherein the target sequence comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 24-66 and SEQ ID NO:
181.
34. The composition of claim 33, wherein the level of the FLI-1 gene product in the population is reduced relative to the unengineered cell population.
35. The composition of claim 33 or 34, wherein the engineered cell is a T cell.
36. The composition of claim 35, wherein the T cells are α / β T cells.
37. A method of treating a disease or disorder, the method comprising administering to a subject in need a genome editing system as described in any one of claims 1-19, an RNP as described in claim 20, a vector as described in claim 21, a cell as described in any one of claims 23-25, a cell as described in any one of claims 26-32, or a composition as described in any one of claims 33-36.
38. The method of claim 37, wherein the disease or disorder is a tumor, cancer, malignant tumor, growth or other proliferative disease or disorder.
39. The method of claim 37 or 38, wherein the disease or disorder is selected from the group consisting of: leukemia, lymphoma, such as chronic lymphocytic leukemia (CLL), acute lymphoblastic leukemia (ALL), non-Hodgkin's lymphoma, acute myeloid leukemia, multiple myeloma, refractory follicular lymphoma, mantle cell lymphoma, indolent B-cell lymphoma, B-cell malignancy, colon cancer, lung cancer, liver cancer, breast cancer, prostate cancer, ovarian cancer, skin cancer, melanoma, bone cancer and brain cancer, ovarian cancer, epithelial cancer, renal cell carcinoma, pancreatic adenocarcinoma, Hodgkin's lymphoma, cervical cancer, colorectal cancer, glioblastoma, neuroblastoma, Ewing's sarcoma, medulloblastoma, osteosarcoma, synovial sarcoma and / or mesothelioma.
40. A gRNA molecule comprising a targeting domain that targets a target sequence of the FLI-1 gene.
41. The gRNA molecule of claim 40, wherein the target sequence of the FLI-1 gene is in exon 5 of FLI-1.
42. The gRNA molecule of claim 40, wherein... (a) The target sequence of the FLI-1 gene contains a nucleotide sequence selected from the group consisting of SEQ ID NO: 24-66; and / or (b) The targeting domain comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 67-109.
43. The gRNA as described in claim 40 or 41, wherein (a) The target sequence of the FLI-1 gene comprises a nucleotide sequence selected from the group consisting of SEQ ID: 25, SEQ ID NO: 36, and SEQ ID NO: 47, and / or (b) The targeting domain comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 68, SEQ ID NO: 79, and SEQ ID NO:
90.
44. The gRNA according to any one of claims 40-43, wherein (a) The target sequence of the FLI-1 gene contains the nucleotide sequence shown in SEQ ID NO: 47; and / or (b) The target domain comprises the nucleotide sequence shown in SEQ ID NO: 90.
Citation Information
Patent Citations
Crispr / CAS-related methods and compositions for treating leber's congenital amaurosis 10 (LCA10)
WO2015138510A1
Crispr-CAS-related methods, compositions and components for cancer immunotherapy
WO2015161276A2
CPF1-related methods and compositions for gene editing
WO2019118516A1
Systems and methods for modulating chromosomal rearrangements
WO2019152519A1
Methods and compositions for editing nucleotide sequences
WO2020191233A1