A biosensor for detecting AKI based on urine synthetic DNA and application thereof
By constructing a biosensor loaded with bioorthogonal DNA on molybdenum-doped tungsten oxide nanosheets and using it in conjunction with blank liposomes, the problems of renal filtration and reticuloendothelial system uptake of AKI sensors were solved, enabling early, highly sensitive, and specific urine detection, which is suitable for AKI screening in resource-scarce areas.
Patent Information
- Application Number
- CN202511795176.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-02
- Publication Date
- 2026-03-31
- Estimated Expiration
- 2045-12-02
AI Technical Summary
Existing AKI sensors have shortcomings in terms of convenience, versatility, and sensitivity, especially in the problem of non-specific uptake by the renal filtration and reticuloendothelial system, resulting in insufficient diagnostic sensitivity and specificity.
A biosensor based on molybdenum-doped tungsten oxide nanosheets loaded with orthogonal DNA was constructed and used in conjunction with blank liposomes to inhibit the uptake of the reticuloendothelial system. The orthogonal DNA was released by renal responsive degradation in a high ROS environment and excreted in urine, enabling early diagnosis.
It achieves early, highly sensitive, and specific detection of AKI, with detection within 6 hours using a fluorescent reagent kit and within 24 hours using a colloidal gold reagent kit, making it suitable for screening in resource-scarce areas.
Smart Images

Figure CN121276065B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedical technology, and in particular to a biosensor for detecting AKI based on urine-synthesized DNA and its application. Background Technology
[0002] Currently, diagnostic strategies for acute kidney injury (AKI) can be broadly categorized into in vitro diagnostics and imaging diagnostics. In vitro diagnostics offers the advantage of high detection sensitivity through in vitro signal amplification strategies, but lacks specific biomarkers. In vivo imaging, on the other hand, utilizes microenvironment-responsive probes for real-time, in-situ analysis with good specificity, but its sensitivity is insufficient, or the equipment is expensive. Against this backdrop, Professor Sangeeta Bhatia of MIT proposed a synthetic biomarker strategy. This involves designing biosensors and utilizing their response to the tumor microenvironment to release synthetic biomarkers with good specificity and high concentrations, thereby improving the accuracy of early diagnosis.
[0003] However, sensors targeting the kidneys differ from tumor-targeting probes for other sites. When synthetic biomarker strategies are applied to tumors in other locations, the sensor only needs to target and respond to tumor tissue, releasing a small, water-soluble probe that is excreted in urine. However, sensors targeting the kidneys require good renal filtration, and the responded probe must also be filtered by the kidneys. For example, a recent work by Professor Kan-Yi Pu of Nanyang Technological University (Nat. Biomed. Eng 2025, 9, 686-699). Furthermore, all types of sensors face the challenge of non-specific uptake by the reticuloendothelial system (RES). Therefore, current sensors targeting the AKI still have significant shortcomings in terms of convenience, versatility, and sensitivity. Summary of the Invention
[0004] The purpose of this invention is to provide a biosensor and its application for detecting AKI based on urinary synthetic DNA, thereby addressing the problems existing in the prior art. This invention constructs a nanosheet-bioorthogonal DNA biosensor by loading DNA onto molybdenum-doped tungsten oxide nanosheets that exhibit ROS-responsive degradation. This biosensor is combined with blank liposomes for AKI detection. The blank liposomes inhibit the reticuloendothelial system, allowing the biosensor to enter the renal metabolic pathway in greater quantities. In the high ROS environment of AKI, the biosensor structure is disrupted, releasing the bioorthogonal DNA, which is ultimately excreted in the urine. By enriching the bioorthogonal DNA in the urine, early diagnosis of AKI can be achieved. This invention solves the sensitivity and specificity problems in AKI detection. A fluorescent reagent kit can detect urine samples with AKI occurring 6 hours prior, and a colloidal gold reagent kit can detect urine samples with AKI occurring 24 hours prior, providing a new technology for early AKI screening in resource-scarce regions or countries.
[0005] To achieve the above objectives, the present invention provides the following solution:
[0006] This invention provides a biosensor for detecting AKI based on urinary synthetic DNA, wherein the biosensor is obtained by loading bioorthogonal DNA onto molybdenum-doped tungsten oxide nanosheets;
[0007] The orthogonal DNA is DNA modified with azide and biotin.
[0008] Furthermore, the sequence of the biological orthogonal DNA is shown in SEQ ID NO.1. The inventors, through research on DNA molecule length and base sequence, discovered that the biological orthogonal DNA shown in SEQ ID NO.1 exhibits the best performance in detecting AKI.
[0009] The present invention also provides a method for preparing the above-mentioned biosensor, comprising the following steps:
[0010] S1. Molybdenum-doped tungsten oxide nanosheets were synthesized using a hydrothermal reaction method.
[0011] S2. The molybdenum-doped tungsten oxide nanosheets are reduced to obtain WO3. x Mo nanosheets;
[0012] S3. Load the orthogonal DNA of the organism onto the WO x The biosensor was obtained on Mo nanosheets.
[0013] Furthermore, in step S1, the method for synthesizing the molybdenum-doped tungsten oxide nanosheets includes the following steps:
[0014] Na2WO4·2H2O, Na2MoO4·2H2O, citric acid, glucose and water were mixed evenly to obtain a mixture; the mixture was then subjected to acid treatment and followed by a thermal reaction to obtain the molybdenum-doped tungsten oxide nanosheets.
[0015] Furthermore, the molar ratio of Na₂WO₄·2H₂O, Na₂MoO₄·2H₂O, citric acid, and glucose is 1:0.2:1.5:5; the concentration of citric acid in the mixture is 0.05 mol / L; the acid treatment method is 5-7 M hydrochloric acid treatment; the volume ratio of hydrochloric acid to the mixture is 1:8-12; the temperature of the thermal reaction is 95-110℃, and the time is 5-7 h.
[0016] Optionally, the reduction treatment method is to reduce the molybdenum-doped tungsten oxide nanosheets with ascorbic acid.
[0017] The present invention also provides the application of the above-described biosensor or the biosensor prepared by the above-described method in the preparation of products for detecting acute kidney injury.
[0018] The present invention also provides a fluorescent detection kit for acute kidney injury, wherein the fluorescent detection kit comprises the above-mentioned biosensor, streptavidin magnetic beads, blank liposomes and functionalized quantum dots;
[0019] The functionalized quantum dots include quantum dots connected to dibenzocyclooctylene.
[0020] In this invention, the streptavidin magnetic beads can enrich biological orthogonal DNA; the functionalized quantum dots, after being activated by dibenzocyclooctylene (DBCO), can capture biological orthogonal DNA.
[0021] The present invention also provides a colloidal gold detection kit for acute kidney injury, wherein the colloidal gold detection kit comprises the above-mentioned biosensor, blank liposome, GNPs-DNA and colloidal gold test strip;
[0022] The SH-DNA on the GNPs-DNA is linked to a dibenzocyclooctylene;
[0023] The colloidal gold test strip has streptavidin and C-DNA complementary to the SH-DNA coated on the C-line, and streptavidin coated on the T-line.
[0024] In this invention, N3 at one end of the bioorthogonal DNA on the biosensor can bind to DBCO on GNPs-DNA through a click chemical reaction, and biotin at the other end can bind to streptavidin on the T line, thereby generating a colorimetric signal.
[0025] Furthermore, the sequence of the SH-DNA is shown in SEQ ID NO.2; the sequence of the C-DNA is shown in SEQ ID NO.3.
[0026] The present invention discloses the following technical effects:
[0027] This invention develops a synthetic biomarker strategy for early and convenient screening of acute kidney injury (AKI). It involves preparing molybdenum-doped tungsten oxide nanosheets with kidney-targeting and ROS-responsive degradation capabilities. These nanosheets possess abundant binding sites, allowing for the loading of orthogonal DNA, thus constructing a nanosheet-orthogonal DNA biosensor. This invention combines this biosensor with blank liposomes for AKI detection. The blank liposomes inhibit the reticuloendothelial system (RES), allowing the liposomes to preferentially reach the liver, thus enabling the biosensor to enter the renal metabolic pathway. Due to the high ROS expression in AKI mice, the reducing biosensor's structure is disrupted upon interaction, releasing the orthogonal DNA, which is ultimately excreted in the urine. By enriching the orthogonal DNA in the urine, performing a series of modifications and signal amplification, AKI can be detected using fluorescence and lateral flow chromatography test strips.
[0028] The reduced tungsten oxide nanosheets and biosensor of this invention, due to the high loading capacity of the nanosheets, the labelability of DNA, and the highly efficient targeting resulting from RES inhibition, enable the rapid detection of orthogonal DNA biomarkers in urine via fluorescence and test strips. Early diagnosis of AKI can be achieved within 6 hours of onset using only a 25 pmol / kg dose of the biosensor, and detection within 24 hours of onset can be achieved using test strips. This invention is beneficial for AKI screening in resource-scarce areas, solving the sensitivity and specificity problems in AKI detection, and providing a new strategy and diagnostic method for early and accurate diagnosis of AKI. Attached Figure Description
[0029] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0030] Figure 1 This is a flowchart illustrating the technical principle of the present invention.
[0031] Figure 2 For WO x Transmission electron microscope image of Mo nanosheets; scale bar is 200 nm;
[0032] Figure 3 For WO x XPS spectra of Mo nanosheets before and after reduction by VC; where a is WO3 x XPS spectrum of W element before reduction by Mo nanosheets; b represents WO. x XPS spectrum of Mo before reduction by Mo nanosheets; c represents WO3. x XPS spectra of W element after reduction of Mo nanosheets; d represents W. x XPS spectrum of Mo element after reduction of Mo nanosheets;
[0033] Figure 4 For different concentrations of WO x :Graph showing the results of the antioxidant capacity determination of Mo nanosheets;
[0034] Figure 5 For WO x :Graph showing the degradation ability of Mo nanosheets in H2O2 environment; where a represents WO x : Transmission electron microscopy image of Mo nanosheets degrading in H2O2 for 1 h, scale bar is 200 nm; b is WO x :Hydrated particle size of Mo nanosheets before and after degradation in H2O2;
[0035] Figure 6 For WO x :Graph showing the quenching and release effects of Mo nanosheets on DNA at different times in H2O2;
[0036] Figure 7 The graph shows the results of detecting urinary fluorescence intensity, serum biomarkers sCr and BUN in mice at different times of AKI occurrence.
[0037] Figure 8 The image shows the test strip results for mice 24 hours after AKI infection; where a is the test strip after testing, the left side is the test strip for AKI mice, and the right side is the test strip for healthy mice; b is the signal values of the C and T lines of the test strip after testing. Detailed Implementation
[0038] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0039] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0040] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0041] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0042] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0043] The technical principle of this invention is as follows:
[0044] like Figure 1 As shown, this invention constructs a WO x The :Mo@DNA sensing system utilizes blank liposomes to block the RES system, enabling WO x The :Mo@DNA sensor can quickly and efficiently reach the kidneys, where damaged kidneys highly express ROS and WO. x Mo nanosheets degrade to release azide- and biotin-modified (or other commercially available, commonly biomodified) DNA. The released DNA is rapidly labeled and captured via an azide-alkynyl Click reaction and a biotin-streptavidin covalent reaction, enabling highly sensitive and convenient early diagnosis of AKI using fluorescence or test strips. A flowchart illustrating the technical principle is shown below. Figure 1 As shown.
[0045] Example 1
[0046] 1. Synthesis of Nanosheets
[0047] 1 mmol Na₂WO₄·2H₂O and 0.2 mmol Na₂MoO₄·2H₂O were added to 30 mL of H₂O and stirred until transparent. Then, 1.5 mmol citric acid and 5 mmol glucose were added sequentially, and the mixture was stirred vigorously for 10 min. 3 mL of HCl solution (6 M) was added to the mixture, and the mixture was stirred for 30 min. The mixture was transferred to a 50 mL polytetrafluoroethylene-lined hydrothermal reactor and heated to 100 °C for 6 h. After naturally cooling to room temperature, the product was collected by centrifugation and washed repeatedly with water and anhydrous ethanol until all organic matter was removed. Finally, the product was dried in a vacuum oven at 60 °C for 24 h to obtain nanosheets.
[0048] 2. WO x Synthesis of Mo nanosheets
[0049] To further enhance the reducing power of the nanosheets, the synthesized nanosheets were reduced with ascorbic acid (VC) to convert more hexavalent molybdenum into pentavalent molybdenum. The specific steps were as follows: 20 mg of nanosheets were added to 10 mL of H₂O and stirred until homogeneous. Then, 6 mL of VC was added and stirred for 30-40 min. After the reaction was complete, the nanosheets were centrifuged with water and ethanol at 8000 rpm for 8 min, and washed twice to obtain WO₂. x Mo nanosheets. The synthesized nanosheets were observed under a transmission electron microscope, as shown... Figure 2 As shown, the nanosheets have a size of 60-100 nm and a thickness of about 11 nm.
[0050] 3. WO x Structural characterization of Mo nanosheets
[0051] X-ray photoelectron spectroscopy analysis was performed on the nanosheets before and after reduction, and the results are as follows: Figure 3 As shown, a and b are the XPS spectra of W and Mo elements before reduction of the nanosheets, respectively, and c and d are the XPS spectra of WO. x XPS spectra of W and Mo after Mo reduction. It can be seen that Mo before and after reduction... 6+ Mo 5+ The doping amount changed from 3.63 to 1.5, indicating that the amount of pentavalent molybdenum increased after reduction with VC.
[0052] 4. WO x Determination of the antioxidant capacity of Mo nanosheets
[0053] To verify WO xThe reducing effect of WO3 nanosheets on ABTS+• free radicals was investigated using a total antioxidant capacity assay kit (Beyotime, CN). The free radical scavenging ability of the nanosheets was assessed using an ABTS free radical cation decolorization assay. The specific steps were as follows: First, 10 μL of WO3 at different concentrations was... x Mo nanosheets (0, 10, 20, 40, 80 μg / mL) were mixed with 20 μL of peroxidase working solution, and 170 μL of ABTS working solution was added to each well. After incubation at room temperature for 6 min, the absorbance at 414 nm was measured using a microplate reader.
[0054] The results are as follows Figure 4 As shown, it can be seen that in WO x Mo nanosheets at a concentration of 80 μg / mL can eliminate more than 70% of free radicals. This indicates that WO3... x Mo has a certain ROS scavenging ability, possibly due to WO3. x :Mo surface part Mo 5+ It is oxidized to Mo during ROS removal. 6+ state.
[0055] 5. WO x Determination of the degradation ability of Mo nanosheets in H2O2 environment
[0056] To verify WO x The degradation of Mo nanosheets in H2O2 environment, and the degradation of WO3 x Mo nanosheets were treated with 5 mM H₂O₂ for 1 h, and their structure was observed under a transmission electron microscope, followed by DLS testing. The results are as follows: Figure 5 As shown, WO x After Mo nanosheets reacted in 5 mM H2O2 for 1 h, WO x The Mo nanosheets showed significant degradation and structural damage, demonstrating that they possess certain antioxidant capabilities. Figure 5 (a). Hydrated particle size indicates the WO4 before and after treatment. x The size difference of Mo nanosheets further confirms the reducibility of WO3. x Degradation ability of Mo nanosheets ( Figure 5 (b).
[0057] Example 2
[0058] 1. WO x Fabrication of Mo@DNA Sensor
[0059] Take 40 μg of WO prepared in Example 1 xMo nanosheets were mixed with 20 μL of 100 mM PBS, 10 μL of 1 μM orthogonal DNA (SEQ ID NO.1), and the remainder was brought to a final volume of 200 μL with H2O. The mixture was then incubated with shaking for 10 min to obtain WO3. x :Mo@DNA sensor.
[0060] SEQ ID NO.1 (5'-3'):
[0061] AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA. Its 5' end is connected to FAM or biotin, and its 3' end is connected to N3.
[0062] 2. WO x :Mo@DNA sensor target DNA release capacity determination
[0063] To detect WO x The ability of the :Mo@DNA sensor to release target DNA was demonstrated in the following experiments:
[0064] Prepared WO x The :Mo@DNA sensor (with FAM) was treated with 10 mM H2O2 for 0 min (without H2O2, only observing the quenching effect), 10 min, 30 min, 60 min, 90 min, and 120 min. The target DNA release effect was observed at these time points.
[0065] Nanosheets possess abundant binding sites; when nanosheets bind to orthogonal DNA containing FAM, the fluorescence of the DNA is quenched; when exposed to H2O2, the reducing WO3... x The Mo@DNA sensor structure is disrupted, DNA is released, and the fluorescence signal is restored. By detecting the fluorescence signal of FAM-DNA, the WO3 can be effectively reflected. x Degradation of the Mo@DNA sensor. Results are as follows: Figure 6 As shown, 0 min represents no H2O2 added, which is WO3. x The quenching effect of the WO@DNA sensor showed a continuous increase in fluorescence signal at 10 min, 30 min, 60 min, 90 min, and 120 min, indicating that WO x The :Mo@DNA sensor, in the presence of H2O2, releases DNA through structural degradation over time, demonstrating its potential to detect acute kidney injury (AKI).
[0066] Example 3
[0067] 1. Construction of animal models
[0068] An acute kidney injury (AKI) mouse model was established by tail vein injection of cisplatin at a dose of 20 mg / kg. At 4, 6, 8, 12, 24, and 48 h after cisplatin injection, each mouse was first injected via tail vein with 1500 μg of blank liposomes (20 mg / mL), followed by an injection of 75 μg of WO3. x :Mo@DNA sensor (1 mg / mL, containing 1 μM bioorthogonal DNA). Four mice were treated at each time point. A healthy control group of mice was also included, receiving the same WO@DNA sensor via tail vein injection. x The Mo@DNA sensor and blank liposomes were injected in the same manner as above.
[0069] 2. AKI fluorescence detection
[0070] 2.1 Preparation of the fluorescence detection system
[0071] 50 mM EDC / NHs and 4 mM dibenzocyclooctyne (DBCO) were incubated at 37 °C for 2 h, followed by the addition of 20 nM quantum dots (QD) and incubation for another 2 h. After incubation, the mixture was centrifuged at 8000 rpm for 8 min to remove any unlinked precipitates, and the supernatant was collected. QD-DBCO was thus prepared.
[0072] 2.2 Urine testing
[0073] WO x Three hours after injection of the :Mo@DNA sensor, urine was collected, with 50 μL collected from each mouse. Streptavidin magnetic beads were added to the collected urine to enrich the target DNA. The mixture was incubated at room temperature for 30 min, then magnetically separated using a magnetic rack. The urine was washed three times with PBS, and 200 μL of 10 mM PBS was added for storage. QD-DBCO was ligated to the 200 μL of magnetically bead-enriched DNA. After incubation with shaking at room temperature for 40 min, magnetic separation was performed, followed by washing three times with PBS. Finally, 200 μL of 10 mM PBS was added for fluorescence detection.
[0074] 2.3 Test Results
[0075] The principle of fluorescence detection is as follows: Urine contains orthogonal DNA with biotin linked to its 5' end and N3 linked to its 3' end. After incubating the collected urine with streptavidin magnetic beads, the orthogonal DNA was magnetically separated using a magnetic rack, then ligated with QD-DBCO, and finally the fluorescence signal was measured using a fluorescence spectrophotometer. Simultaneously with fluorescence detection, serum was collected from each group of mice to detect serum biomarkers serum creatinine (sCr) and blood urea nitrogen (BUN), and subsequently, AKI was detected. Results are as follows... Figure 7As shown, statistically significant fluorescence enhancement was observed in urine at 6 h, and the fluorescence signal continued to increase at subsequent time points; however, statistically significant increases in serum sCr (4.75-fold) and BUN (2.51-fold) were only observed at 48 h. These results confirm that WO x The :Mo@DNA sensor can detect AKI as early as 6 h after cisplatin induction, which is 42 h earlier than the detection time point of serum biomarker elevation, demonstrating superior detection performance.
[0076] 3. Test strip testing
[0077] 3.1 Preparation of the test strip detection system
[0078] (1) Synthesis of GNPs:
[0079] Add 120 μL of 12.5% chloroauric acid to 150 mL of H₂O, adjust the temperature to 180 °C, and when the liquid begins to boil and the water in the condenser begins to reflux, quickly add 5 mL of 38.8 mM sodium citrate. Continue stirring and heating for 20 min, then stop heating and remove the heating mantle. Continue stirring and allow the reaction system to cool naturally to room temperature. Concentrate the synthesized gold nanoclusters (GNPs) using an ultrafiltration tube for later use.
[0080] (2) GNPs-DNA modification:
[0081] Add 15 μL of 100 μM SH-DNA (SEQ ID NO.2) and 15 μL of 100 μM cysteine to 1 mL of GNPs, mix well, and freeze at -20 ℃ for 2 h, then thaw at 4 ℃. After the reaction is complete, centrifuge at 12000 rpm for 15 min at room temperature. Remove the centrifuge tube; the supernatant should be clear at this point, with nanoparticles deposited at the bottom. If red color still appears in the supernatant, centrifuge for another 5 min. Gently aspirate the supernatant. Wash the GNPs-DNA twice with 4% BSA dissolved in 10 mM PBS, disperse in 1×PBS buffer (10% sucrose, 5% BSA, 0.8% Tween-20), and store at 4 ℃ for later use.
[0082] SEQ ID NO.2 (5'-3'):
[0083] TTTTTTTTTTTCTCTCCCAGGACAGGCACAGACAC, its 5' end is connected to DBCO, and its 3' end is connected to SH.
[0084] (3) The test strip consists of a sample pad, a nitrocellulose membrane (NC membrane), an absorbent pad, and a sample pad. First, cut the sample pad and absorbent pad to a width of 2.3 mm and 1.7 mm, respectively. After cutting, soak the sample pad in a buffer solution (0.02 M, pH 7.4 Tris-HCl, 0.25% TritionX-100, 0.15 M NaCl) for 30 min and then air dry for later use. Take 60 μL of 30 μM biotinylated Control DNA (C-DNA, SEQ ID NO.3) and mix it with 10 μL of 2 mg / mL streptavidin. Incubate at room temperature for 2 h to prepare the C-line solution. Take 30 μL of 2 mg / mL streptavidin and 30 μL of 10 mg / mL BSA for blocking. Incubate at room temperature for 2 h to prepare the T-line solution. Using an HM3030 3D planar dot sputtering gold spectrometer, 60 μL of solution was back-pumped and sprayed onto the NC membrane (25 mm wide) at a rate of 1 μL / mm, with a 0.85 mm gap between the C-line and T-line. Finally, the NC membrane was first fixed onto the substrate, then the sample pad was fixed to the lower end of the T-line and the absorbent pad to the upper end of the C-line. After assembly, the membrane was cut into 3.8 mm wide strips using a CTD300P programmed automated strip cutter, then sealed in airtight bags and stored at 4 ℃ for later use.
[0085] SEQ ID NO.3 (5'-3'):
[0086] GTGTCTGTGCCTGTCCTGGGAGAGATTTTTTTTTT, with biotin (bio) attached to its 3' end.
[0087] 3.2 Urine testing
[0088] Urine was collected from AKI mice and normal mice 24 h after cisplatin induction. 5 μL of urine was added to 55 μL of GNPs-DNA and incubated at room temperature for 5 min. 60 μL of the mixture was then spotted twice onto the sample pad of the test strip. After the reaction, the background was rinsed with rinsing agent (2×SSC, 1% Tween-20). The colorimetric signal peaks were analyzed using ImageJ software.
[0089] 3.3 Test Results
[0090] The principle of the test strip detection is as follows: Urine contains orthogonal DNA, with biotin linked to the 5' end and N3 linked to the 3' end. The GNPs-DNA signal probe, due to complementary base pairing, remains at the C line, displaying a signal. The orthogonal DNA in urine rapidly binds to the GNPs-DNA via a click reaction, and then binds to streptavidin on the T line, displaying a colorimetric signal. Results are as follows... Figure 8As shown, the T-line signal in the urine of AKI mice was significantly higher than that in normal mice. After signal processing, it can be seen more intuitively that the signal in the urine of AKI mice was 5.8 times higher than that in normal mice.
[0091] The above results show that, based on WO x The :Mo@DNA sensor for urine analysis is compatible with both fluorescence detection and test strip detection, demonstrating great translational potential in nursing diagnostics and home testing.
[0092] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. A biosensor for detecting AKI based on synthesis of DNA from urine, characterized by, The biosensor is obtained by loading biological orthogonal DNA on molybdenum-doped tungsten oxide nanosheets; The biological orthogonal DNA is DNA modified by azide and biotin; The sequence of the biological orthogonal DNA is shown in SEQ ID NO.
1.
2. A method of producing the biosensor according to claim 1, characterized by, The method comprises the following steps: S1, molybdenum-doped tungsten oxide nanosheets are synthesized by a hydrothermal reaction method; S2, subjecting the molybdenum-doped tungsten oxide nanosheets to reduction treatment to obtain WO x :Mo nanosheets; S3, loading the biorthogonal DNA onto the WO x :Mo nanosheets to obtain the biosensor.
3. The preparation method according to claim 2, characterized in that, In step S1, the synthesis method of the molybdenum-doped tungsten oxide nanosheets comprises the following steps: Na2WO4·2H2O, Na2MoO4·2H2O, citric acid, glucose and water are uniformly mixed to obtain a mixed solution; after the mixed solution is acid-treated, a thermal reaction is performed to obtain the molybdenum-doped tungsten oxide nanosheets.
4. The production method according to claim 3, characterized by, The molar ratio of Na2WO4·2H2O, Na2MoO4·2H2O, citric acid and glucose is 1:0.2:1.5:5; the concentration of citric acid in the mixed solution is 0.05 mol / L; the acid treatment method is 5-7 M hydrochloric acid treatment; the volume ratio of hydrochloric acid to the mixed solution is 1:8-12; the thermal reaction temperature is 95-110℃, and the time is 5-7h.
5. The preparation method according to claim 2, characterized in that, The reduction treatment method is to reduce the molybdenum-doped tungsten oxide nanosheets with ascorbic acid.
6. The use of the biosensor of claim 1 or the biosensor prepared by the preparation method of any one of claims 2-5 in the preparation of a product for detecting acute kidney injury.
7. A fluorescent detection kit for acute kidney injury, characterized by, The fluorescent detection kit comprises the biosensor of claim 1, streptavidin magnetic beads, blank liposomes and functionalized quantum dots; The functionalized quantum dots comprise quantum dots connected with dibenzocyclooctyne.
8. A colloidal gold test kit for acute kidney injury, characterized by, The colloidal gold detection kit comprises the biosensor of claim 1, blank liposomes, GNPs-DNA and a colloidal gold detection test strip; The SH-DNA on the GNPs-DNA is connected with dibenzocyclooctyne; The C line of the colloidal gold detection test strip is coated with streptavidin and C-DNA complementary to the SH-DNA, and the T line is coated with streptavidin.
9. The colloidal gold detection kit according to claim 8, characterized in that, The sequence of the SH-DNA is shown in SEQ ID NO. 2; and the sequence of the C-DNA is shown in SEQ ID NO. 3.
Citation Information
Patent Citations
Display screen with icon
WO200581
Composition and method for diagnosis and treatment of renal dysfunctions in felid
CN105886649A
Magnetic particle-based immunoassay and methods of using the same
CN110462383A