EsPLS1 gene and uses thereof

By overexpressing the EsPLS1 gene in monocotyledonous plants to regulate leaf size, the problem of leaf area regulation in existing technologies has been solved, resulting in increased leaf size and yield of wheat.

CN121294464BActive Publication Date: 2026-03-27INSTITUTE OF ANIMAL SCIENCES OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511884634.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-12-15
Publication Date
2026-03-27
Estimated Expiration
2045-12-15

Smart Images

  • Figure CN121294464B_ABST
    Figure CN121294464B_ABST
Patent Text Reader

Abstract

The application relates to the field of biotechnology, in particular to a gene for regulating leaf size of elymus nutans and application thereof. EsPLS1 The nucleotide sequence of the gene is shown as SEQ ID NO. 1, and the gene can be used for positively regulating leaf size of plants by overexpressing the gene in plants. EsPLS1 The nucleotide sequence of the gene is shown as SEQ ID NO. 1, and the gene can be used for positively regulating leaf size of plants by overexpressing the gene in plants. EsPLS1 The gene can be used for increasing leaf size of elymus nutans, and provides a theoretical basis for the idea of increasing leaf size and improving biomass by using the gene. EsPLS1 The gene can be used for increasing leaf size of elymus nutans, and provides a theoretical basis for the idea of increasing leaf size and improving biomass by using the gene.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to a gene and its application for regulating the size of leaves of monocotyledonous plants, especially Elymus nutans or rice. EsPLS1 BACKGROUND

[0002] Elymus nutans Griseb. (Poaceae) is a perennial grass with strong stress resistance and wide adaptability, which has broad application prospects in the sustainable development of agriculture and ecological safety construction in China in the future. Its prospects mainly lie in two directions: diversification development and ecological-economic synergistic effect. On the one hand, through variety selection and cultivation management optimization, Elymus nutans will continue to be a backbone forage grass in grassland production in arid and high-cold regions, providing reliable high-quality roughage for livestock. On the other hand, its strong water and soil conservation and soil protection ability makes it an irreplaceable pioneer plant and ecological guard in ecological restoration of degraded grassland, water and soil loss control and mine land reclamation and other ecological engineering. Elymmus sibiricus . With the development of molecular breeding technology, breeding new varieties of Elymus nutans with higher yield, better quality and stronger resistance will become the core driving force to promote the upgrading of its industry. From the ecological perspective, scientific planting and utilization of forage grasses such as Elymus nutans can effectively curb grassland degradation and restore fragile ecology. From the industrial perspective, stable and efficient supply of forage grasses is the basis for cost reduction and efficiency improvement of animal husbandry and the promotion of competitiveness, which is directly related to the livelihood of farmers and herdsmen and the prosperity of regional economy.

[0003] Leaf size (i.e. leaf area) is one of the key traits that determine the accumulation of aboveground biomass of plants, and there is a close but complex relationship between them. The core of this relationship lies in the function of leaves as the main organ of photosynthesis: in theory, a larger single leaf area means a stronger light energy capture capacity, thus providing more photosynthetic products for plant growth, directly promoting the increase of aboveground biomass. In the case of sufficient light and other conditions (such as water, CO2) not being limited, a larger light-receiving area can directly intercept and absorb more light quanta, thus driving stronger photosynthesis and synthesizing more carbohydrates (such as sugars and starches). These carbohydrates are the basic substances for building plant bodies (stems, leaves, branches, etc.), which are directly converted into aboveground biomass. In the breeding and cultivation practices of many crops (such as rice, wheat, corn, soybean), cultivating and maintaining a larger leaf area of the canopy has always been the core goal of improving economic yield (usually a part of aboveground biomass). Therefore, the increase of leaf area can improve the photosynthetic capacity and resource capture efficiency of plants, thus having a significant positive impact on the accumulation of aboveground biomass. SUMMARY

[0004]

[0005] ​​​To solve the above-mentioned technical problems, the present invention provides a EsPLS1 Genes that participate in regulating leaf area in monocotyledonous plants, especially in regulating the leaf area of ​​*Triticum aestivum*. This invention is the first to discover, through regulation... EsPLS1 Gene expression can significantly increase rice leaf area, which may effectively optimize the leaf type of wheat, thereby increasing the yield of wheat per plant and achieving efficient accumulation of aboveground biomass. This provides an innovative molecular breeding technology solution for solving the problem of insufficient forage supply and reducing dependence on foreign sources.

[0006] To achieve the technical objective of this invention, the first aspect of this invention provides a... EsPLS1 The gene, characterized by overexpression of the gene... EsPLS1 Genes are used to increase the leaf area of ​​monocotyledonous plants, and their nucleotide sequences are shown in SEQ ID NO.1.

[0007] In particular, the monocotyledonous plant is wheat or rice.

[0008] This invention has found that, compared to the wild type, after overexpression... EsPLS1 The leaf area of ​​the rice variety with the overexpression gene is much larger than that of wild-type rice, a result that confirms the effectiveness of overexpression. EsPLS1 Genes can regulate leaf size. Therefore, it can be concluded that… EsPLS1 Genes can be used to increase the leaf area of ​​old wheat, providing a basis for utilization. EsPLS1 Genetic breeding provides a theoretical basis for high-yield old wheat varieties.

[0009] In particular, quantitative amplification of the above EsPLS1 The sequence of the quantitative PCR primers for the gene, EsPLS1-RT, is ATCATGGAGGTTCTCGGGGA, and the sequence of EsPLS1-RT-R is CTCGAGGGTCTTC ATGTCGG.

[0010] In particular, cloning the above EsPLS1 The CDS-F sequence of the PCR primers for the gene is ATGGTGCAGCCGGTGTTCGA, and the CDS-R sequence is TCATGTCCTGGCGGCGGGCT.

[0011] The amplification program is as follows: 97℃ for 3 min, 97℃ for 15 s, 58℃ for 30 s, 72℃ for 1 min 30 s, 35 cycles, 72℃ for 5 min.

[0012] To achieve the technical objective of this invention, a second aspect of this invention provides a recombinant expression vector comprising the above-described... EsPLS1 Genes that regulate the leaf size of monocotyledonous plants, especially the leaf size of old wheat or rice plants.

[0013] In particular, the recombinant expression vector is obtained by inserting the EsPLS1 gene into the P1300-35S-C-Myc overexpression vector plasmid Xba I and Kpn I sites.

[0014] To achieve the technical purpose of the present application, the third aspect of the present application provides a recombinant engineering bacterium comprising the above-mentioned recombinant expression vector.

[0015] In particular, the recombinant engineering bacterium is obtained by transforming the recombinant expression vector into an E. coli competent cell.

[0016] To achieve the technical purpose of the present application, the fourth aspect of the present application provides the above-mentioned EsPLS1 gene for use in regulating the leaf area of a monocotyledonous plant, which is achieved by overexpressing the EsPLS1 gene in the plant.

[0017] To achieve the technical purpose of the present application, the fifth aspect of the present application provides the above-mentioned recombinant expression vector for use in regulating the leaf area of a monocotyledonous plant, which is achieved by overexpressing the EsPLS1 gene in the plant.

[0018] To achieve the technical purpose of the present application, the sixth aspect of the present application provides the above-mentioned recombinant engineering bacterium for use in regulating the leaf size of a monocotyledonous plant, which is achieved by overexpressing the EsPLS1 gene in the plant.

[0019] The monocotyledonous plant is Elymus sinensis or rice.

[0020] Beneficial effects:

[0021] The EsPLS1 gene provided by the present application can be used to regulate the size of the leaves of a monocotyledonous plant, especially Elymus sinensis, which is conducive to improving the forage yield of Elymus sinensis and can be used for improving the forage varieties of Elymus sinensis. BRIEF DESCRIPTION OF DRAWINGS

[0022] Figure 1 The EsPLS1 gene in different tissues of Elymus sinensis at different periods;

[0023] Figure 2 The cloning results of the EsPLS1 gene of Elymus sinensis;

[0024] Figure 3 The structure diagram of the EsPLS1 gene overexpression vector;

[0025] Figure 4 TheEsPLS1 Figure of RNA level identification result of gene overexpression plant;

[0026] Figure 5 For EsPLS1 Figure of phenotype result of gene overexpression transgenic rice plant. DETAILED DESCRIPTION

[0027] The technical solutions in the embodiments of the present application will be clearly and completely described below. Obviously, the described embodiments are only some of the embodiments of the present application, but not all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative work fall within the scope of protection of the present application. The bioinformatics software and products used in the present application are commercially available. The various processes and methods not described in detail all use conventional methods known to those skilled in the art. The sources of the materials used, the trade names, and the components thereof, if necessary, are indicated at the first occurrence, and the same reagents are used thereafter unless otherwise specified.

[0028] The present application studies a new gene EsPLS1 Through analyzing the leaf size data collected and saved in the old wild Elymus nutans germplasm resource population, two extreme materials YS-92 (small leaf) and YS-137 (large leaf) were found, and the flag leaf parts of the two extreme materials at the heading stage were taken for transcriptome. After data quality control analysis, DEGs and DEPs screening, GO enrichment and KEGG pathway analysis, it was found that 12 genes had significant expression difference, and were significantly related to growth and development, cell elongation and cell division. Finally, the EsPLS1 gene with the most significant expression difference was screened.

[0029] The EsPLS1 nucleotide sequence of the gene is shown as SEQ ID NO. 1, and the specific sequence is as follows:

[0030]

[0031] The inventors have carried out various analysis experiments and research on the genes with the most significant expression differences obtained by screening EsPLS1 which can clearly demonstrate the key role of the genes in the growth of Elymus sibiricus L. EsPLS1 in the growth of Elymus sibiricus L.

[0032] Example 1: Analysis of the spatiotemporal expression pattern of Elymus sibiricus L. genes

[0033] 1. Obtaining cDNA of different tissue samples of Elymus sibiricus L.

[0034] YS-137 seeds were sown in pots and cultured in a greenhouse. Multiple tissue samples of Elymus sibiricus L. were collected from the seedling stage to the milk stage, including the seedling stage, the early, middle and late tillering stage, the early and late jointing stage, the booting stage, the heading stage, the flowering stage and the milk stage. The multiple tissue samples included roots, stems, leaves and spikes. All the collected tissue samples were rapidly frozen in liquid nitrogen and stored at -80°C for later use. The RNA of the above-mentioned tissues was extracted using an AFT Spin Universal Plant Fast RNA Extraction Kit (Wuhan Aibote Biological Technology Co., Ltd.). The quality of the RNA was detected by agarose gel electrophoresis, and the quantity of the RNA was detected by Nanodrop. The cDNA was synthesized using an EX RT kit reverse transcription kit (Wuhan Aibote Biological Technology Co., Ltd.). The reverse transcription cDNA system is shown in Table 1. The reverse transcription conditions were 45°C for 2 min, 50°C for 15 min and 85°C for 2 min. The reverse transcriptase was inactivated. The cDNA was diluted 2-fold to serve as a template to obtain the cDNA of each tissue sample at the above-mentioned two stages.

[0035] Table 1 Reverse transcription cDNA system

[0036]

[0037] 2. Analysis of the tissue expression pattern of Elymus sibiricus L. EsPLS1 genes

[0038] According to the obtained Elymus sibiricus L. EsPLS1Gene sequence information, using AlleleID 6.0 to design fluorescent quantitative primers EsPLS1-RT and EsPLS1-RT-R, using the cDNA of different tissues of Elymus sibiricus obtained in step 1 as a template, using 2x HQ SYBR qPCR Mix (LoW ROX) reagent, and using an ABI Q7 type fluorescent quantitative PCR instrument to perform qRT-PCR amplification. The amplification procedure of the fluorescent quantitative PCR is as follows: 95°C, 30s, 40 cycles, each cycle including 95°C, 10s, 60°C, 30s, and 72°C, 30s, and each test including three biological repeats. The relative expression amount of the gene was calculated by using the 2 -∆∆Ct method. The relative expression amount of the gene in different tissues of Elymus sibiricus was calculated by using the 2 -ΔΔCt method, and the analysis result is shown in EsPLS1 Table 2. The fluorescent quantitative system is shown in Table 2. The sequence of EsPLS1-RT is ATCATGGAGGTTCTCGGGGA, and the sequence of EsPLS1-RT-R is CTCGAGGGTCTTCATGTCGG. Figure 1

[0039] According to the analysis result in Figure 1 , it can be seen that EsPLS1 there is significant tissue expression specificity at different development stages. From the seedling stage to the flowering stage of the growth and development process, EsPLS1 the expression of the gene in the leaf tissue is significantly higher than that in other tissues, in addition, EsPLS1 the expression amount in the leaf tissue gradually increases from the seedling stage to the jointing stage, and the expression amount gradually decreases after the plant begins to bear spikes. It is shown that EsPLS1 the gene may play a key regulatory role in the leaf development of Elymus sibiricus. The leaf is an important component of aboveground biomass, and during the plant growth and development stage, the leaf manufactures a large amount of carbohydrates (such as sucrose) through photosynthesis, is a key "source" organ, and assimilates nitrogen, phosphorus, and other mineral nutrients into more complex organic matter and directionally transports to the developing organs. This close association determines how the total biomass of the plant accumulates and distributes in the process of vegetative growth.

[0040] Table 2: Fluorescent quantitative system

[0041]

[0042] Example 2: Cloning of the Elymus sibiricus Es PLS1 gene

[0043] According to the obtained Elymus sibiricus EsPLS1 ​Sequence information of the gene was used to design amplification primers CDS-F and CDS-R. RNA of Elymus sibiricus material "YS-137" was extracted, and cDNA obtained by reverse transcription was used as a template to perform PCR amplification. The PCR reaction system is shown in Table 3. After amplification, agarose gel electrophoresis was performed, the amplification product was recovered and sequenced, and the obtained Elymus sibiricus EsPLS1 Genomic sequence and cDNA sequence of the gene. The sequence of CDS-F is ATGGTGCAGCCGGTGTTCGA, and the sequence of CDS-R is TCATGTCCTGGCGGCGGGCT.

[0044] PCR amplification procedure: 97℃, 3 min; 97℃, 15 s, 58℃, 30 s, 72℃, 1 min 30 s, 35 cycles; 72℃, 5 min.

[0045] The PCR product was subjected to 1% agarose gel electrophoresis at a voltage of 180 V for 10 min. Based on the whole genome data of Elymus sibiricus, the EsPLS1 gene sequence was obtained, and gene-specific primers were designed. Elymus sibiricus cDNA was used as a template, and high-fidelity enzyme was used for PCR amplification. After TA cloning and colony PCR detection, it was found that two colony PCR bands were consistent with the expected size, as shown in Figure 2 The above positive colonies were sequenced, and the results showed that the CDS region was 1080 bp in length, and the sequence was correct, indicating that the correct EsPLS1 TA plasmid was obtained. EsPLS1

[0046] Table 3 PCR reaction system

[0047]

[0048] Example 3、 EsPLS1 obtained by overexpressing a transgene in rice

[0049] 1. Overexpression EsPLS1 of a transgene vector.

[0050] The plant overexpression vector P1300-35S-C-Myc was double-digested with restriction endonucleases Xba I and Kpn I, and primers P1300-35S-C-Myc-F and P1300-35S-C-Myc-R were used to amplify the EsPLS1- TA plasmid obtained in Example 2 to obtain a EsPLS1 ​The CDS region of the gene was extracted, and the vector and fragment were recombined using the SE Seamless Cloning and Assembly Kit. The recombinant product was transformed into DH5α competent E. coli cells, and overexpression was confirmed by sequencing. EsPLS1 The transgenic vector P1300-35S-C-Myc::EsPLS1 has the following structure: Figure 3 As shown.

[0051] The sequence of P1300-35S-C-Myc-F is gagaacacgggggatctagaATGGTGCAGCCGGTGTTCGA, and the sequence of P1300-35S-C-Myc-R is acaggcctttcgaaggtaccTGTCCTGGCGGCGGGCTGCT.

[0052] 2. Overexpression EsPLS1 Construction of transgenic lines

[0053] The above-mentioned carrier P1300-35S::EsPLS1-C-MYC was electroporated to convert EHA105 competent states, and then coated onto a substrate containing 25

[0054] Incubate on LB medium containing 50 mg / L Rifampicin and 50 mg / L Kanamycin at 28°C for 2 days; clones positive by colony PCR are stored in glycerol at −80°C. Mature rice seeds (Nipponbare) Oryza sativa L. spp. japonica After dehulling, the callus was soaked in 70% ethanol for 1 min, then in 30% NaClO + 2 drops of Tween-20 solution for 20 min. It was then rinsed with sterile water and inoculated onto N6 medium (Beijing Cooler Master Technology Co., Ltd.) containing 2 mg / L 2,4-dichlorophenoxyacetic acid (2,4-D). The callus was incubated in the dark at 28°C for 21 days. Naturally dividing callus tissue was transferred to fresh induction medium and subcultured for 14 days before transformation. Agrobacterium was resuspended in a solution containing 100 μM acetosyringone (AS). AAM Liquid culture medium (Beijing Cooler Master Technology Co., Ltd.), adjusted OD600 = 0.08-0.1. After soaking the callus tissue in the bacterial suspension for 15 min, the suspension was discarded. The callus tissue was placed on sterile filter paper to absorb excess suspension, and then transferred to N6D-2 solid co-culture medium containing 100 μM AS on a layer of sterile filter paper. Incubation was carried out in the dark at 25°C for 3 days. After 3 days of co-culture, the callus tissue was rinsed at least 5 times with water, then rinsed once with sterile water containing 400 mg / L carbenicillin. After the callus was dried, it was transferred to… containing50 mg / L Hyg (Hygromycin) and 200 mg / L Timentin (Timentin) on N6D-2 medium, 28°C light culture (16h / 8h light cycle, light intensity of 2000lx) for 4-5 weeks, and the medium was replaced every two weeks. The resistant callus was selected and placed on N6 differentiation medium containing 0.5 mg / L NAA (NAA) α- Naphthaleneacetic acid, α-naphthalene acetic acid), 28°C light culture (16h / 8h light cycle, light intensity of 2000lx) for 2-3 weeks until green shoots were generated, and then transferred to 1 / 2 MS medium containing 10 mg / L Hyg for rooting (7-10 days). After 3 days of opening and hardening, the seedlings were transplanted to the greenhouse for further culture, and the overexpression EsPLS1 transgenic lines were obtained.

[0055] 3. Transgenic rice EsPLS1 expression analysis.

[0056] The leaf tissue of the seedling stage of the transgenic rice plants obtained in step 2 was collected, and the AFT Spin Universal Plant Fast RNA Extraction Kit was used to extract the tissue RNA. After detecting the RNA quality by agarose gel electrophoresis and detecting the RNA quantity by Nanodrop ultramicro ultraviolet spectrophotometer (Thermo Fisher Scientific, MA, USA), the cDNA was synthesized by EX RT kit reverse transcription kit. The cDNA was diluted 2 times as a template, and qRT-PCR amplification was performed by using primers EsPLS1-RT-F and EsPLS1-RT-R, quantitative reagent Hieff UNICON qPCR SYBR GREEN Master Mix, and ABI Q7 type fluorescent quantitative PCR instrument. The expression level of EsPLS1 in the positive plants was detected, and the relative expression level of the target gene was calculated by 2 -ΔΔCt method. Among them, the sequence of EsPLS1-RT-F is ATCATGGAGGTTCTCGGGGA, and the sequence of EsPLS1-RT-R is CTCGAGGGTCTTC ATGTCGG. EsPLS1 The results are shown in Table 1.

[0057] The expression level of Figure 4 in the transgenic plants was 1.0-2052.74 times that of the control plants, and the expression levels of EsPLS1 in the three transgenic lines OE-4, OE-5 and OE-7 were 2052.74 times, 1546.72 times and 1335.66 times that of the control, respectively, and the differences reached a very significant level. EsPLS1 ​P <0.001. Based on this, the three transgenic lines OE-4, OE-5, and OE-7 were selected as the subjects of subsequent phenotypic analysis.

[0058] Example 4: Transgenic Rice EsPLS1 Phenotypic analysis

[0059] Transplanted wild-type (WT) and overexpression EsPLS1 Transgenic rice lines with consistent growth stages were selected for phenotypic observation. Results showed that overexpression... EsPLS1 The leaves of the plant were 1.27 to 2.06 times larger than those of the wild type. Figure 5 This result confirms... EsPLS1 Genes play an important role in the yield trait of old awn wheat by positively regulating leaf area.

[0060] In summary, it can be concluded that the [source] comes from the old mango plant. EsPLS1 After the gene was overexpressed in monocotyledonous rice model plants, the leaf area increased significantly. Based on the theory of biological genetics, it can be inferred that the gene provided by this invention... EsPLS1 Overexpression of the gene in *Leymus chinensis* can regulate the size of *Leymus chinensis* leaves, increase the yield of *Leymus chinensis* forage, and achieve efficient accumulation of aboveground biomass.

[0061] The above description represents the preferred embodiments of the present invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principles of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. EsPLS1 A gene characterized in that, capable of regulating leaf area of monocot plants; The nucleotide sequence of the gene is shown as SEQ ID NO.

1. EsPLS1 The nucleotide sequence of the gene is shown as SEQ ID NO.

1. The nucleotide sequence of the gene is shown as SEQ ID NO.

1. The nucle wherein the monocot plant is Echinochloa crus-galli or Oryza sativa.

2. A recombinant expression vector, characterized in that, comprising the claim 1 EsPLS1 a gene, the recombinant expression vector being capable of modulating leaf size in a monocotyledonous plant, the monocotyledonous plant being Elymus sinensis or Oryza sativa.

3. A recombinant engineering bacteria comprising the recombinant expression vector of claim 2.

4. The recombineering bacteria of claim 3, wherein, is obtained by transforming the recombinant expression vector into an E. coli competent cell.

5. The method of claim 1 EsPLS1 Use of the gene in regulating leaf area in monocot plants, characterized in that, By overexpressing in said plants EsPLS1 genes are achieved; wherein the monocot plant is Echinochloa crus-galli or Oryza sativa.

6. Use of the recombinant expression vector of claim 2 for modulating leaf area in monocot plants, characterized in that, By overexpressing in said plants EsPLS1 genes are achieved; wherein the monocot plant is Echinochloa crus-galli or Oryza sativa.

7. Use of the recombinant engineered bacteria of claim 3 for regulating leaf blade size in monocot plants, characterized in that, By overexpressing in said plants EsPLS1 genes are achieved; wherein the monocot plant is Echinochloa crus-galli or Oryza sativa.

8. A method of increasing leaf area of a target plant, the method comprising contacting the target plant with a composition comprising a polynucleotide of any one of claims 1-5. The specific steps include: Using cloning methods to replicate the product described in claim 1 EsPLS1 Gene insertion into an expression vector, wherein the expression vector is introduced into a target plant via a transformation method to achieve the effect described in claim 1. EsPLS1 Overexpression of the gene ultimately increases the leaf area of ​​the target plant; the target plant is wheat or rice.

Citation Information

Patent Citations

  • Plant development related protein GA20ox, and encoding gene and application thereof

    CN102757486A

  • White birch GA20o*1 gene BpGA20o*1 and application thereof

    CN103014031A