SP-1 polypeptide and application of encoding gene thereof in inhibition of tight reaction and antibiosis
By screening and preparing the SP-1 peptide from spider venom, the bacterial strict reaction pathway is interfered with, solving the problem of the decreased effectiveness of traditional antibiotics against drug-resistant bacteria, and achieving highly efficient bactericidal and biofilm inhibition against Escherichia coli and Pseudomonas aeruginosa.
Patent Information
- Application Number
- CN202511709240.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-20
- Publication Date
- 2026-01-13
AI Technical Summary
Traditional antibiotics are less effective against drug-resistant bacteria, especially in chronic infections and biofilm-associated infections where they are difficult to eradicate completely. Inhibitors of severe bacterial response (SR) have not yet been fully developed.
SP-1 peptide and its encoding gene were screened from spider venom. Mature peptides were prepared using genetic engineering techniques to interfere with the tight reaction pathways of bacteria, inhibit ppGpp synthesis, and weaken bacterial tolerance.
SP-1 peptide can significantly inhibit the activity of tight-reacting enzymes in Escherichia coli and Pseudomonas aeruginosa, exhibiting concentration-dependent bactericidal effects, effectively inhibiting biofilm formation, enhancing the bactericidal effect of antibiotics, and reducing the risk of drug resistance mutations.
Smart Images
Figure CN121319145A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of polypeptide technology, and in particular to the application of an SP-1 polypeptide and its encoding gene in inhibiting severe reactions and antibacterial activity. Background Technology
[0002] The increasing prevalence of antibiotic resistance has led to a continuous decline in the effectiveness of traditional antibiotics in clinical treatment, making the discovery of novel antibiotics an urgent priority. Although resistant bacteria do not carry resistance gene mutations, they can survive briefly under antibiotic pressure through metabolic regulation and physiological state adjustments, making complete eradication of infections difficult, especially in chronic infections and biofilm-associated infections. Therefore, finding novel antibacterial strategies requires not only developing new antibiotics targeting resistance mechanisms but also disrupting the survival mechanisms of resistant bacteria to improve the bactericidal efficacy of antibiotics.
[0003] The stringent response (SR) is a crucial survival mechanism initiated by bacteria under adverse conditions. It mediates the synthesis of (p)ppGpp, remodels bacterial metabolism, inhibits growth, and enhances antibiotic resistance. SR activation causes bacteria to prioritize survival over rapid growth when faced with antibiotics, leading to persistent bacteria and reduced antibiotic efficacy. Therefore, SR is not only a core regulatory network for antibiotic resistance but also a key factor in the difficulty of eradicating chronic infections. In recent years, inhibitors targeting SR have been considered potential novel antibiotics. They restore antibiotic sensitivity by interfering with (p)ppGpp synthesis or signaling, thereby causing bacteria to lose resistance. The advantage of these inhibitors is that they not only enhance the bactericidal effect of existing antibiotics and reduce persistent bacteria and biofilm formation but may also reduce the incidence of resistance mutations because they weaken bacterial survival rather than directly killing bacteria. Therefore, the development of SR inhibitors provides new insights into addressing resistance and tolerance, helping to improve the efficacy of existing antibiotics and offering new treatment strategies for refractory infections.
[0004] Venomous animals like spiders possess venom rich in various bioactive peptides with significant antibacterial, immunomodulatory, and metabolic interference capabilities, providing an important resource for the discovery of novel antibiotic resistance inhibitors (SR). Spider peptides, due to their specific sequences and structures, can directly act on the physiological regulatory network of bacteria, potentially interfering with the (p)ppGpp metabolic pathway, weakening bacterial resistance, and thus enhancing the bactericidal effect of antibiotics. The necessity of this strategy lies in the fact that the bactericidal mechanisms of traditional antibiotics are mostly concentrated on cell wall synthesis, protein translation, or DNA replication, while inhibitors targeting the core resistance mechanism of SR are still in the exploratory stage. Spider peptides, as a novel molecular source, hold the promise of filling this gap. Their importance lies in the fact that, compared to small molecule compounds, peptides typically have higher specificity and multi-target action modes, effectively reducing the risk of drug resistance mutations. Furthermore, their novelty lies in the fact that this strategy not only overcomes the target limitations of traditional antibacterial drugs but also combines the evolutionary advantages of natural toxins, providing a more targeted intervention for refractory infections by specifically regulating bacterial survival strategies. Therefore, extracting SR inhibitors from spider venom is not only a new direction for antibiotic resistance research, but also provides innovative ideas for the development of novel antibiotics. Summary of the Invention
[0005] To address the problems existing in the background technology, an application of SP-1 polypeptide and its encoding gene in inhibiting severe reactions and antibacterial activity is proposed.
[0006] This invention proposes an SP-1 polypeptide derived from spiders, and its amino acid sequence is shown in SEQ ID NO:1.
[0007] This invention proposes a gene encoding an SP-1 polypeptide, the nucleotide sequence of which is shown in SEQ ID NO:2.
[0008] This invention proposes a precursor peptide such as SP-1 polypeptide. The amino acid sequence of the precursor peptide is shown in SEQ ID NO:3, and the corresponding encoding gene is shown in SEQ ID NO:4.
[0009] This invention proposes the application of the polypeptide SP-1, the encoding gene, or biological materials containing the encoding gene, prepared by genetic engineering, or the mature peptide formed by processing the SP-1 polypeptide or precursor peptide, in the preparation of antibacterial drugs.
[0010] This invention proposes the application of SP-1 polypeptide, encoding gene, or biological material containing the encoding gene prepared by genetic engineering technology, or the mature peptide formed by processing SP-1 polypeptide or precursor peptide, in the removal of biofilm and resistance to biofouling.
[0011] This invention proposes the application of SP-1 peptides, encoding genes, or biological materials containing said encoding genes prepared using genetic engineering techniques, or mature peptides formed by processing precursor peptides, in the preparation of severe reaction inhibitors.
[0012] Preferably, the biological material containing the coding gene in the above-described applications of the present invention includes at least one of the following biological materials: a recombinant vector containing the coding gene, a recombinant bacterial strain containing the coding gene, a recombinant viral strain containing the coding gene, and a recombinant cell line containing the coding gene.
[0013] Preferably, the medicine used in the above applications of the present invention includes injectable powder and / or injectable solution.
[0014] Compared with existing technologies, this invention has the following beneficial technical effects: This invention screens a polypeptide from spider transcripts and predicts its antibacterial activity through antibacterial screening. This invention utilizes enzyme activity experiments to demonstrate that the polypeptide can inhibit RelA activity, reduce the synthesis of the stress response signaling molecule ppGpp, and thus inhibit the stress response. This invention proposes that the half-inhibition constants (IC50) of this polypeptide against the key stress response enzymes EcRelA and PaRelA in *Escherichia coli* and *Pseudomonas aeruginosa* are 1.11 and 0.74 μM, respectively. Through antibacterial and bactericidal kinetic experiments, it is confirmed that the SP-1 polypeptide exhibits concentration-dependent bactericidal activity, with MICs of 2.4 and 1.5 μM against *Escherichia coli* and *Pseudomonas aeruginosa*, respectively. It also effectively inhibits biofilm formation in *E. coli* and *Pseudomonas aeruginosa*. These research results fully demonstrate that the SP-1 polypeptide in this invention exerts a potent antibacterial effect by targeting the stress response pathway, showing significant clinical application prospects in combating multidrug-resistant bacterial infections and providing a candidate molecule for the development of novel antibiotics. Attached Figure Description
[0015] Figure 1 A shows the inhibition of RelA enzyme activity by SP-1 peptide in Escherichia coli and Pseudomonas aeruginosa; A is a schematic diagram of SP-1 peptide inhibiting the activity of EcRelA, a key enzyme in the acute reaction of Escherichia coli, to generate ppGpp; B is a schematic diagram of SP-1 peptide inhibiting the activity of PaRelA, a key enzyme in the acute reaction of Pseudomonas aeruginosa, to generate ppGpp. Figure 2 This is a schematic diagram illustrating the bactericidal effect of SP-1 polypeptide on Escherichia coli and Pseudomonas aeruginosa. Figure 3 A schematic diagram illustrating the effect of SP-1 peptide on biofilm formation in Escherichia coli and Pseudomonas aeruginosa observed by laser confocal microscopy. Figure 4 This is a schematic diagram illustrating the effect of P-1 polypeptide on biofilm formation in Escherichia coli and Pseudomonas aeruginosa. Detailed Implementation
[0016] The following is a detailed description of a spider-derived SP-1 polypeptide, its encoding gene, and its antibacterial applications provided by the present invention, but these should not be construed as limiting the scope of protection of the present invention.
[0017] I. Screening of SP-1 peptide and its encoding gene A spider-derived tight response inhibitor was identified from the transcript sequence (TRINITY_DN36221_c0_g1) using BLAST annotation and Pfam analysis, and further identified through antimicrobial peptide library AMP3.0 prediction and enzyme activity screening. The result was the screening of an SP-1 peptide with antimicrobial activity. P-1 is a spider-derived polypeptide with the mature peptide sequence shown in SEQ ID NO: 1 (TPPTVCFLSCKIGCECDNGFVLNEKDKTCVKPENCPPS). The corresponding coding gene sequence is shown in SEQ ID NO: 2 (ACACCTCCGACTGTGTGCTTTCTTTCTTGCAAAATAGGATGCGAATGTGACAACGGCTTTGTCCTGAATGAAAAGGACAAAACATGCGTAAAGCCAGAAAATTGTCCACCAAGCTAG). The amino acid sequence of the SP-1 precursor peptide is shown in SEQ ID NO: 3 (TSTPCGLNQHFNDCGTTCPLTCGNHK). The corresponding coding gene is shown in SEQ ID NO: 4 (5'-ACCAGCACACCTTGCGGCCTTAATCAGCATTTTAATGATTGTGGAACCACCTGTCCACTGACATGCGGGAATCACAAG-3').
[0018] II. Effects of SP-1 peptide on the activity of PAO1 tight reaction synthase in E. coli and P. aeruginosa pET-32a-EcRelA and pET-32a-PaRelA vectors were constructed and transformed into BL21 to express EcRelA and PaRelA enzymes from Escherichia coli and Pseudomonas aeruginosa, respectively. Bacteria were collected, and the mixture was re-vortexed using an extraction buffer, sonicated, and the supernatant was purified for EcRelA and PaRelA proteins by nickel affinity chromatography or other methods. In vitro enzyme activity assays were performed in 50 mM HEPE (pH 7.2) buffer, containing 250 mM NaCl, 2 mM EDTA, 1 mM β-mercaptoethanol, 14 mM MgSO4, 8 mM ATP, 6 mM GDP, and 1.0 μg recombinant protein protease and different concentrations (0.125, 0.25, 0.5, 1.0, 2.0, 4.0, 8.0, 16 μM SP-1 peptide). After incubation at 37 ℃ for 30 min, the reaction was terminated by liquid nitrogen freezing. The ppGpp content was detected by UHPLC-MS / MS. The ppGpp produced by the enzyme reaction without SP-1 was taken as 100% enzyme activity. The ratio of ppGpp yield in other inhibitor groups to ppGpp yield in the enzyme-free group was used as an indicator of enzyme activity. The results are as follows Figure 1 As shown, the SP-1 peptide can significantly inhibit the activities of key enzymes (EcRelA and PaRelA) in the tight reaction of two bacterial strains within a certain concentration range, and this inhibition is concentration-dependent. Calculation of the half-maximal inhibitory concentration (IC50) revealed that the IC50 of the SP-1 peptide against E. coli EcRelA activity was 1.11 μM, and the IC50 against Pseudomonas aeruginosa PaRelA enzyme activity was 0.74 μM. This indicates that the peptide described in this invention can effectively interfere with the tight reaction process of bacteria and has good potential for anti-infective applications.
[0019] III. Bactericidal effect of SP-1 peptide on E. coli and P. aeruginosa PAO 3.1 Minimum Inhibitory Concentration (MIC) The minimum inhibitory concentration (MIC) of the antimicrobial peptides described in this invention against *Escherichia coli* and *Pseudomonas aeruginosa* was determined using the microtube dilution method. The specific method is as follows: The test strains were inoculated into the corresponding nutrient medium and cultured at 37°C until the logarithmic growth phase. The bacterial suspension was collected by centrifugation (3500 rpm, 5 min), washed twice with PBS buffer (1.5 mmol / L KH₂PO₄, 2.7 mmol / L Na₂HPO₄, 0.15 mol / L NaCl, pH 7.4), resuspended in RPMI 1640 medium containing 10% fetal bovine serum (FBS), and diluted to 2 × 10⁻⁶. 5CFU / mL. 100 μL of bacterial suspension was added to a 96-well plate and mixed with 100 μL of PBS solution containing the peptide of this invention at different concentrations (1–100 μg / mL), resulting in a final volume of 200 μL. Kanamycin was used as a positive control, and different concentrations were simultaneously applied. After incubating the mixture at 37°C for 18–24 hours, the absorbance was measured at 600 nm using an Epoch Etock microplate reader to assess bacterial growth. MIC was defined as the concentration at which no detectable colony growth was observed. The results showed that the peptide of this invention exhibited significant antibacterial activity against both *Escherichia coli* and *Pseudomonas aeruginosa*, with MICs of 2.4 μM and 1.5 μM, respectively. For comparison, under the same conditions, the MICs of kanamycin against *Escherichia coli* and *Pseudomonas aeruginosa* were 14.5 μM and 12.3 μM, respectively, verifying the reliability of the detection system and the antibacterial effect of the peptide of this invention. 3.2 Bactericidal Kinetics Pseudomonas aeruginosa and Escherichia coli were inoculated separately into beef extract peptone medium and cultured at 37°C until the logarithmic growth phase (OD600 approximately 0.4–0.6). The viable bacterial suspension was then diluted to 1×10⁻⁶. 6 CFU / mL was mixed with peptide solutions of different concentrations (0, 0.5, 1.0, 2.0, and 5.0 μM) at a 1:1 ratio. The mixture was incubated at 37°C with shaking, and samples were taken at 0, 1, 2, 4, 6, and 8 hours. Samples at each time point were serially diluted tenfold and plated on LB agar plates, incubated at 37°C for 18–24 hours, and colony-forming units (CFU) were recorded. The logarithmic CFU values of the bacterial cultures in different treatment groups at each time point were plotted to construct bactericidal kinetic curves to evaluate the bactericidal rate and intensity of the peptides on bacteria. The experiment was conducted in triplicate, with a PBS solvent control group to eliminate the influence of the solvent on bacterial growth. All data were averaged and the standard deviation was calculated. Data reaching or exceeding 3-log were considered. 10 The lowest concentration with the bactericidal threshold was determined to be the minimum bactericidal concentration (MBC). The test results are as follows: Figure 2 As shown, the polypeptide of the present invention can significantly reduce the survival rate of target strains within a certain period of time, and has an MBC of 2.0 μM for both Escherichia coli and Pseudomonas aeruginosa, demonstrating excellent bactericidal activity.
[0020] IV. Confocal observation and comparison of differences in biofilm growth To evaluate the effect of SP-1 peptide on bacterial biofilm formation, confocal laser scanning microscopy (CLSM) was used to observe the biofilm structure. *Escherichia coli* and *Pseudomonas aeruginosa* were inoculated onto sterile 96-well glass plates or slides and cultured in LB medium until the early biofilm formation stage. SP-1 peptide was then added to the culture medium at a final concentration of 5 μM. A control group without SP-1 treatment was also included. After static incubation at 37°C for 24 hours, the culture medium was discarded, and the cells were gently washed to remove unbound cells. The biofilms were stained with green fluorescent dye (SYTO 9) according to the manufacturer's instructions, incubated in the dark, and then gently washed with PBS. Three-dimensional images of the biofilm structure in different groups were acquired using confocal laser scanning microscopy. Image analysis was performed using ImageJ software or other image processing software to qualitatively evaluate the inhibitory effect of SP-1 peptide on biofilm formation. Results are as follows: Figure 3 As shown, compared with the control group, the biofilm formation of the two bacterial strains in the SP-1 treatment group was significantly reduced, manifested as decreased biofilm thickness, sparse structure, and weakened fluorescence signal intensity. The green staining coverage area of the biofilms of *Escherichia coli* and *Pseudomonas aeruginosa* induced by 5 μM SP-1 peptide was significantly lower than that in the control group, suggesting that SP-1 peptide can effectively inhibit the formation and maturation of bacterial biofilms.
[0021] V. Quantitative analysis of biofilm growth using crystal violet staining Bacteria were cultured in a suitable medium with shaking until they reached the logarithmic or saturation growth phase. The diluted bacterial solution was then inoculated into 96-well plates, with 100-200 µL of bacterial solution and SP-1 peptide at final concentrations of 0.0, 2.0, 5.0, and 10.0 μM added to each well. The plates were then incubated statically at 37°C for 24-48 hours to allow bacteria to attach to the well walls and form a biofilm. After incubation, the medium was discarded, and the plates were gently washed 2-3 times with PBS to remove any unattached planktonic cells. Next, 0.1% crystal violet solution was added for staining, and the plates were incubated at room temperature for 15-30 minutes to allow for thorough staining of the biofilm. After staining, the dye was discarded again, and the plates were washed three times with PBS or distilled water to remove any unbound crystal violet. Finally, 95% ethanol or a 30% ethanol-10% acetic acid mixture was added to dissolve the bound dye, and the plates were incubated for 15 minutes. The absorbance at OD570 was then measured using a microplate reader to reflect the intensity of biofilm formation. Results are as follows: Figure 4As shown, the strains were cultured under different concentrations (0, 2, 5, 10 μM) of SP-1. Biofilm quantity was detected using crystal violet staining, and the results are expressed as OD570. Data are expressed as mean ± standard deviation (n=3). Compared with the 0 μM group, *p<0.05, **p<0.01, ***p<0.001. This means that with increasing SP-1 concentration, the biofilm quantity of *Escherichia coli* and *Pseudomonas aeruginosa* decreased in a concentration-dependent manner, showing a significant difference compared to the control group (0 μM) (t-test).
[0022] In summary, the SP-1 polypeptide described in this invention has potential application value in the treatment of Escherichia coli and Pseudomonas aeruginosa infections. Based on the good antibacterial activity of the SP-1 polypeptide, this invention provides an antibacterial drug lead molecule, the active ingredient of which includes the spider-derived SP-1 polypeptide, the SP-1 polypeptide prepared by genetic engineering using the encoding gene or biological material containing the encoding gene, or a mature peptide formed after processing the precursor peptide.
[0023] It should be further noted that the biological material containing the coding gene preferably includes at least one of the following biological materials: a recombinant vector containing the coding gene, a recombinant strain containing the coding gene, a recombinant viral strain containing the coding gene, and a recombinant cell line containing the coding gene.
[0024] It should be further noted that there are no special restrictions on the type of backbone vector in the recombinant vector containing the coding gene. Common backbone vectors known in the art can be used, such as prokaryotic expression vectors, eukaryotic expression vectors, viral vectors, and mammalian cell expression vectors.
[0025] It should be further explained that the recombinant vector containing the coding gene is constructed by selecting a suitable backbone vector according to the type of host, and then entering the host through transformation or transfection methods to obtain recombinant strains containing the coding gene, recombinant viral strains containing the coding gene, and recombinant cell lines containing the coding gene.
[0026] It should be further noted that the host preferably includes prokaryotic expression systems, eukaryotic expression systems, viruses, and mammalian cells. The prokaryotic expression system preferably includes Escherichia coli, lactic acid bacteria, etc.
[0027] It should be further noted that the eukaryotic expression system preferably includes yeast and / or insect cells. The virus is preferably adeno-associated virus and / or lentivirus.
[0028] It should be further noted that the present invention does not impose any special restrictions on the type of mammalian cells used, and any mammalian cells well known in the art can be used, such as Chinese hamster ovary cells (CHO cells).
[0029] It should be further noted that the present invention does not impose any special restrictions on the preparation method of the biological material containing the coding gene, and any genetic engineering method well known in the art can be used for preparation.
[0030] It should be further explained that the mature peptide formed after processing the precursor peptide is the spider-derived SP-1 polypeptide converted into an active precursor peptide by enzymatic hydrolysis of the precursor peptide under the action of a specific protease. The hydrolysis sites are after CVRR and before CDCN.
[0031] Based on the SP-1 polypeptide's ability to inhibit bacterial ppGpp synthesis, this invention provides a tight reaction inhibitor, the active ingredient of which includes the spider-derived SP-1 polypeptide, the SP-1 polypeptide prepared by genetic engineering using the coding gene or biological material containing the coding gene, or a mature peptide formed by processing the precursor peptide.
[0032] It should be further noted that the present invention does not impose any special restrictions on the effective content of the active ingredient in the inhibitor, and the effective concentration of a strict reaction inhibitor well known in the art can be used.
[0033] This invention proposes the application of spider-derived SP-1 polypeptide, SP-1 polypeptide prepared by genetic engineering technology using encoding genes or biological materials containing encoding genes, or mature peptides formed by processing the precursor peptides, in the preparation of antibacterial drugs.
[0034] This invention proposes the application of SP-1 polypeptides, encoding genes, or biological materials containing the encoding gene prepared by genetic engineering technology, or mature peptides formed by processing SP-1 polypeptides or precursor peptides, in the removal of biofilms and resistance to biofouling.
[0035] This invention further proposes the application of SP-1 peptides, encoding genes, or biological materials containing said encoding genes prepared using genetic engineering techniques, or mature peptides formed by processing precursor peptides, in the preparation of strict reaction inhibitors.
[0036] The embodiments of the present invention have been described in detail above with reference to the accompanying drawings. However, the present invention is not limited thereto. Various changes can be made within the scope of knowledge possessed by those skilled in the art without departing from the spirit of the present invention.
Claims
1. An SP-1 polypeptide, characterized in that, The SP-1 polypeptide is derived from spiders, and its amino acid sequence is shown in SEQ ID NO:
1.
2. A gene encoding the SP-1 polypeptide as described in claim 1, characterized in that, The nucleotide sequence encoding the gene is shown in SEQ ID NO:
2.
3. A precursor peptide of the SP-1 polypeptide as described in claim 1, characterized in that, The amino acid sequence of the precursor peptide is shown in SEQ ID NO:3, and the corresponding encoding gene is shown in SEQ ID NO:
4.
4. The application of the SP-1 polypeptide as described in claim 1, the SP-1 polypeptide prepared by genetic engineering based on the encoding gene as described in claim 2 or biological materials containing the encoding gene as described in claim 2, or the mature peptide formed by processing the precursor peptide as described in claim 3, in the preparation of antibacterial drugs.
5. The application of the SP-1 polypeptide as described in claim 1, the SP-1 polypeptide prepared by genetic engineering technology from the encoding gene as described in claim 2 or biological materials containing the encoding gene, or the mature peptide formed by processing the precursor peptide as described in claim 3, in the removal of biofilms and resistance to biofouling.
6. The use of the SP-1 polypeptide of the spider as described in claim 1, the SP-1 polypeptide prepared by genetic engineering technology from the encoding gene as described in claim 2 or biological material containing the encoding gene, or the mature peptide formed by processing the precursor peptide as described in claim 3, in the preparation of a severe reaction inhibitor.
7. The application according to any one of claims 4-6, characterized in that, Biological materials containing the coding gene include at least one of the following: a recombinant vector containing the coding gene, a recombinant bacterial strain containing the coding gene, a recombinant viral strain containing the coding gene, and a recombinant cell line containing the coding gene.
8. The application according to claim 4, characterized in that, The drugs include injectable powders and / or injectable solutions.