Method for detecting escherichia coli O157 based on CRISPR technology

Abstract

The invention provides a method for detecting escherichia coli O157 based on a CRISPR (clustered regularly interspaced short palindromic repeats) technology. The method comprises the following steps: S1, amplifying a sample to be detected to obtain an amplification product; amplification of the to-be-detected sample is to amplify the to-be-detected sample by using the RPA amplification primer group; s2, contacting the amplification product with Cas protein, sgRNA and a single-stranded nucleic acid detector, and detecting a detectable signal generated by cutting the single-stranded nucleic acid detector by the Cas protein, so as to detect the escherichia coli O157, the sequences of the RPA amplification primer group are as shown in SEQ ID No.2 and SEQ ID No.7, and the sequence of a target region hybridized with target nucleic acid in the sgRNA is as shown in SEQ ID No.9. The method disclosed by the invention has the advantages of good inclusiveness, strong specificity, high sensitivity and the like, and has a wide application prospect.

Description

Technical Field

[0001] This invention belongs to the field of nucleic acid detection, specifically relating to a method for detecting Escherichia coli O157 based on CRISPR technology. Background Technology

[0002] Escherichia coli O157 (also known as Escherichia coli O157:H7) is a type of Escherichia coli, a Gram-negative bacillus that commonly resides in the digestive tract of humans and animals and is excreted in feces. It is widely distributed in water and soil. Escherichia coli O157:H7 is the representative serotype of enterohemorrhagic Escherichia coli (EHEC), a Gram-negative bacillus with flagella and acid resistance. It can survive for extended periods at low temperatures but is inactivated by heating at 75°C for one minute. Its pathogenic factor is Shiga toxin, with an infectious dose as low as 10 bacterial cells. It is transmitted through contaminated food (such as undercooked beef or raw milk) or water sources, primarily causing hemorrhagic diarrhea, hemolytic uremic syndrome, and other diseases. The elderly and children are the most susceptible populations.

[0003] This invention provides a novel method for detecting Escherichia coli O157, which is based on RPA-CRISPR technology, especially based on RPA recombinase polymerase amplification technology and Cas12b trans activity, providing a detection method with high specificity and high detection sensitivity. Summary of the Invention

[0004] In view of this, the main objective of the present invention is to provide a method for detecting Escherichia coli O157.

[0005] To achieve the above objectives, the technical solution of the present invention is implemented as follows:

[0006] On one hand, the present invention provides a method for detecting Escherichia coli O157, the method comprising the following steps:

[0007] S1. Amplify the sample to be tested to obtain the amplification product;

[0008] The sample to be tested was amplified using an RPA amplification primer set, the sequences of which are shown in SEQ ID No. 2 and SEQ ID No. 7.

[0009] S2. The amplification product is contacted with Cas protein, sgRNA and a single-stranded nucleic acid detector to detect the detectable signal generated by the Cas protein cleaving the single-stranded nucleic acid detector, thereby detecting Escherichia coli O157. The sgRNA includes a region that binds to the Cas protein and a guide sequence for hybridization with the target nucleic acid. The target nucleic acid is a nucleic acid derived from Escherichia coli O157. The target region sequence of the sgRNA that hybridizes with the target nucleic acid is shown in SEQ ID No. 9.

[0010] In one embodiment, the method is an RPA-CRISPR detection method.

[0011] In one embodiment, the Escherichia coli O157 is Escherichia coli O157:H7.

[0012] In one embodiment, the amplification product is as shown in SEQ ID No. 1 or is a partial sequence of the sequence shown in SEQ ID No. 1.

[0013] In one embodiment, the RPA amplification primer set sequence is shown in any one of SEQ ID No. 2-7 and SEQ ID No. 12-13. Preferably, the RPA amplification primer set sequence is shown in SEQ ID No. 2 and SEQ ID No. 7.

[0014] In this invention, the region that binds to the CRISPR / CAS effector protein (Cas protein) is also called the backbone region. This region interacts with the Cas protein, thereby binding the Cas protein.

[0015] In one embodiment, the gRNA includes, from the 5' end to the 3' end, a region that binds to the Cas protein and a targeting region that hybridizes with the target nucleic acid.

[0016] In one embodiment, the target region sequence that hybridizes with the target nucleic acid comprises any of the sequences shown in SEQ ID No. 8-10; preferably, the target region sequence that hybridizes with the target nucleic acid is shown in SEQ ID No. 9.

[0017] In one embodiment, the region that binds to the Cas protein is shown in SEQ ID No. 11.

[0018] In one embodiment, the Cas protein is selected from type V Cas proteins, such as Cas12, Cas14 family proteins or mutants thereof.

[0019] In one embodiment, the Cas protein is Cas12b. Preferably, the amino acid sequence of the Cas protein is shown in SEQ ID No. 14.

[0020] Preferably, the sequence of the region that binds to the Cas protein is shown in SEQ ID No. 11.

[0021] Furthermore, the method also includes the step of obtaining the nucleic acid to be tested from the sample to be tested; preferably, the nucleic acid to be tested is obtained from the sample to be tested by an amplification method.

[0022] The amplification method described in this invention is selected from one or more of the following: PCR, sequencing-based amplification (NASBA), recombinase polymerase amplification (RPA), loop-mediated isothermal amplification (LAMP), strand displacement amplification (SDA), helicase-dependent amplification (HDA), or nicking enzyme amplification reaction (NEAR), multiple displacement amplification (MDA), rolling circle amplification (RCA), ligase chain reaction (LCR), or derivative amplification method (RAM). Preferably, the amplification method is LAMP amplification.

[0023] In this invention, the sample can be an animal sample, such as a human, cow, sheep, pig, horse, or donkey.

[0024] In one embodiment, the sample may be a blood, excrement (feces, urine), milk, meat, viscera, fur, abortion products, secretions, or bone marrow sample.

[0025] In other embodiments, the sample may also be derived from environmental samples, such as air, water, soil, farm equipment, etc.

[0026] In this invention, the detectable signal is achieved through the following methods: vision-based detection, sensor-based detection, color detection, gold nanoparticle-based detection, fluorescence polarization, fluorescence signal, colloidal phase transition / dispersion, electrochemical detection, and semiconductor-based detection.

[0027] In some embodiments, the method of the present invention further includes the step of measuring a detectable signal generated by the Cas protein. The Cas protein, upon recognizing or hybridizing with the target nucleic acid, can activate the cleavage activity of any single-stranded nucleic acid, thereby cleaving the single-stranded nucleic acid detector and generating a detectable signal.

[0028] In one embodiment, the detectable signal can also be achieved by setting different labeling molecules, such as a fluorescent group and a quenching group, at the 5' and 3' ends of the single-stranded nucleic acid detector, respectively. The fluorescent group is selected from one or any of FAM, FITC, VIC, JOE, TET, CY3, CY5, ROX, Texas Red, or LC RED460; the quenching group is selected from one or any of BHQ1, BHQ2, BHQ3, Dabcy1, or Tamra.

[0029] In one embodiment, the single-stranded nucleic acid detector is FAM-TTTTTTT-BHQ1.

[0030] In one implementation, the two ends of the single-stranded nucleic acid detector are configured with tags that can be detected by colloidal gold.

[0031] In one embodiment, steps S1 and S2 can be in one reaction system or in different systems.

[0032] In one embodiment, step S1 is an RPA amplification method; preferably, the amplification system in step S1 includes a basic RPA premix, an RPA amplification primer set, magnesium acetate, template DNA, and polyethylene glycol 35000. More preferably, the amplification system in step S1 includes 1× basic RPA premix, a 37.5 nM RPA amplification primer set, 10.5 mM magnesium acetate, 20-200 ng template DNA, and 0.9% polyethylene glycol 35000, and the RPA reaction parameters are 43℃ / 20 min.

[0033] In one embodiment, step S2 is a CRISPR detection method; preferably, the detection system in step S2 includes a CRISPR buffer, Cas12b protein, sgRNA, and a single-stranded nucleic acid detector; more preferably, the detection system in step S2 includes 1×CRISPR buffer, 0.2μM Cas12b protein, 0.25μM sgRNA, and a 3.3μM single-stranded nucleic acid detector; the CRISPR reaction parameters are 43℃ / 30min.

[0034] In one embodiment, the method exhibits good inclusiveness, high specificity, and high sensitivity. The method can detect *E. coli* O157 from multiple sources; the method can detect nucleic acids at the fg level.

[0035] On the other hand, the present invention also provides a system or composition for detecting Escherichia coli O157, said system or composition comprising the above-described RPA amplification primer set, Cas protein, and sgRNA. Further, said system or composition also includes the above-described single-stranded nucleic acid detector.

[0036] On the other hand, the present invention also provides the application of the above-described system or composition in the detection of Escherichia coli O157.

[0037] On the other hand, the present invention also provides the use of the above-described system or composition in the preparation of reagents or kits for detecting Escherichia coli O157.

[0038] Beneficial effects of the invention:

[0039] This invention provides a method for detecting Escherichia coli O157, which is an RPA-CRISPR detection method. It uses RPA amplification primers and sgRNA with high detection efficiency and has the advantages of good inclusiveness, high specificity and high sensitivity.

[0040] Sequence information

[0041] The sequence information involved in this invention is provided as follows:

[0042]

[0043]

[0044]

[0045] The following figures and embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Various objects and advantages of the invention will become apparent to those skilled in the art from the following detailed description of the figures and preferred embodiments. Attached Figure Description

[0046] Figure 1 This is a schematic diagram showing the location of the sgRNA target sequences (sgRNA-1, sgRNA-2, sgRNA-3) on the target sequence.

[0047] Figure 2 The detection efficiency of sgRNA-1.

[0048] Figure 3 The detection efficiency of sgRNA-2.

[0049] Figure 4 The detection efficiency of sgRNA-3.

[0050] Figure 5 This diagram illustrates the detection efficiency of RPA-F1 / R1 when detecting target nucleic acids.

[0051] Figure 6 This diagram illustrates the detection efficiency of RPA-F1 / R2 when detecting target nucleic acids.

[0052] Figure 7 This diagram illustrates the detection efficiency of RPA-F1 / R3 when detecting target nucleic acids.

[0053] Figure 8 This diagram illustrates the detection efficiency of RPA-F2 / R1 when detecting target nucleic acids.

[0054] Figure 9 This diagram illustrates the detection efficiency of RPA-F2 / R2 when detecting target nucleic acids.

[0055] Figure 10 A schematic diagram illustrating the detection efficiency of RPA-F2 / R3 when detecting target nucleic acids.

[0056] Figure 11 This diagram illustrates the detection efficiency of RPA-F3 / R1 when detecting target nucleic acids.

[0057] Figure 12This diagram illustrates the detection efficiency of RPA-F3 / R2 when detecting target nucleic acids.

[0058] Figure 13 This diagram illustrates the detection efficiency of RPA-F3 / R3 when detecting target nucleic acids.

[0059] Figure 14 This is the result of the inclusiveness verification of the RPA-CRISPR detection system.

[0060] Figure 15 The results validated the exclusivity of the RPA-CRISPR detection system against 65 common cross-strains.

[0061] Figure 16 Schematic diagram of sensitivity verification results for the RPA-CRISPR detection system Figure 1 .

[0062] Figure 17 Schematic diagram of sensitivity verification results for the RPA-CRISPR detection system Figure 2 .

[0063] Figure 18 Schematic diagram of sensitivity verification results for the RPA-CRISPR detection system Figure 3 .

[0064] Figure 19 Schematic diagram of sensitivity verification results for the RPA-CRISPR detection system Figure 4 .

[0065] Figure 20 Schematic diagram of sensitivity verification results for the RPA-CRISPR detection system Figure 5 .

[0066] Figure 21 Schematic diagram of sensitivity verification results for the RPA-CRISPR detection system Figure 6 . Detailed Implementation

[0067] The present invention will be further described below with reference to embodiments. The following description is merely a preferred embodiment of the present invention and is not intended to limit the invention in any other way. Any person skilled in the art may make equivalent modifications to the disclosed technical content to create equivalent embodiments. Any simple modifications or equivalent changes made to the following embodiments based on the technical essence of the present invention without departing from the scope of the invention are all within the protection scope of the present invention.

[0068] This invention combines RPA amplification with CRISPR technology, offering the advantages of speed, sensitivity, specificity, and high efficiency. Given the presence of specific nucleic acids of the target pathogen in the sample, specific primers bind to the target sequence. RPA amplification enriches the target sequence, and the Cas enzyme (Cas protein Cas12b, amino sequence as shown in SEQ ID No. 14) binds to the amplification product under the guidance of sgRNA, activating the trans-cleavage activity of the Cas protein. This trans-cleavage activity cleaves the Reporter (one end of which is connected to a fluorescent group, and the other end to a quencher group). The Reporter releases fluorescence after being cleaved by the Cas protein, thus presenting the detection result. In other embodiments, the two ends of the single-stranded nucleic acid detector (Reporter) can also be labeled with colloidal gold.

[0069] Example 1: Screening of target-specific sgRNA and RPA primers

[0070] In this embodiment, sgRNA is designed and target nucleic acid is amplified for the specific nucleic acid of Escherichia coli O157 (i.e., Escherichia coli O157:H7).

[0071] Based on the genome sequence of *E. coli* O157, we targeted the rfbE fragment, whose nucleic acid sequence is shown in SEQ ID No. 1. We then designed and validated the sgRNA. First, we used PCR primers (sequences shown in SEQ ID Nos. 12-13) to amplify the double-stranded fragment. The PCR primer sequences are shown in the table below.

[0072]

[0073] The amplicon sequences of the above PCR primers are: GCCAAGGATTAGCTGTACATAGGCAATATTGGCATGACGTTATAGGCTACAATTATAGGATGACAAATATCTGCGCTGCTATAGGATTAGCCCAGTTAGAACAAGCTGATGATTTTATATCACGAAAACGTGAAATTGCTGATATTTATAAAAAAAATATCAACAGTCTTGTACAAGTCCACAAGGAAAGTAAAGATGTTTTTCACACTTATTGGATGGTC.

[0074] The sequences of the designed sgRNAs are shown in the table below:

[0075]

[0076] The target regions of O157-sgRNA-1, O157-sgRNA-2, and O157-sgRNA-3 are shown in SEQ ID No. 8-10, respectively, and the backbone sequences of O157-sgRNA-1, O157-sgRNA-2, and O157-sgRNA-3 are all shown in SEQ ID No. 11.

[0077] Location of E. coli O157 target sgRNA as follows Figure 1 The filtering results are as follows Figure 2-4 As shown, in Figure 2-4 In this context, 1 cycle = 1 minute, and the fewer the number of cycles reaching the plateau, the higher the sgRNA cleavage efficiency. According to... Figure 2-4 It was found that O157-sgRNA-1 required 15 cycles to amplify the target product, O157-sgRNA-2 required 9 cycles, and O157-sgRNA-3 required 21 cycles to reach the fluorescence platform. Therefore, O157-sgRNA-2 has a higher cleavage efficiency, and will be used in subsequent experiments.

[0078] Based on the improved cleavage efficiency of O157-sgRNA-2, three upstream and three downstream RPA primers were designed and combined (RPA-F1 / R1, RPA-F1 / R2, RPA-F1 / R3, RPA-F2 / R1, RPA-F2 / R2, RPA-F2 / R3, RPA-F3 / R1, RPA-F3 / R2, RPA-F3 / R3) for amplification and screening. The sequences of RPA-F1, RPA-F2, RPA-F3, RPA-R1, RPA-R2, and RPA-R3 are shown in SEQ ID No. 2-7, and their sequences are shown in the table below:

[0079]

[0080] The results of validation with different primer combinations are shown in Figure 5-13 Based on the fluorescence growth rate and the time to reach the plateau value, O157-RPA-F1 / R3 is the best, so the O157-RPA-F1 / R3 combination was selected for subsequent testing.

[0081] Example 2: RPA-CRISPR reaction system

[0082] Based on the results of RPA and CRISPR, we ultimately chose O157-RPA-F1 / R3 paired with O157-sgRNA-2 for further performance validation.

[0083] Prepare the RPA and CRISPR reaction systems according to the final concentrations and volumes of the components in Tables 1 and 2.

[0084] Table 1. Reaction system for RPA fluorescence method

[0085]

[0086] Table 2. CRISPR Reaction System

[0087]

[0088] The fluorescent probe (or single-stranded nucleic acid detector) is FAM-TTTTTTT-BHQ1.

[0089] Note 1: To avoid premature start of the reaction, magnesium acetate should not be mixed with other components in advance when preparing the RPA reaction system. It is recommended to add it dropwise on the tube wall or tube cap separately, and mix all components after all components have been prepared.

[0090] Note 2: CRISPR components should be mixed with RPA components after the RPA process is completed. It is recommended that after the RPA and CRISPR reaction systems are prepared, the CRISPR reaction system be added to a new tube cap, and the cap should be carefully closed to prevent the CRISPR reaction system from falling out during the RPA process. After the RPA reaction process is completed, the tube should be thoroughly centrifuged and mixed, and then placed in a fluorescence PCR instrument for the CRISPR reaction. Alternatively, after the RPA process is completed, the RPA system can be allowed to slowly cool to room temperature before opening the cap and adding the CRISPR components.

[0091] Note 3: It is recommended to use commercially available RPA and CRISPR systems for experiments, and adjust the composition and final volume of the reaction system according to the instructions for different raw materials, and ensure that the final concentration of the components listed in the table remains unchanged.

[0092] The RPA reaction parameters are: 43℃ / 20min;

[0093] The CRISPR reaction parameters were: 43℃ / 30min, with fluorescence signals acquired every minute.

[0094] Example 3: Validation of the inclusiveness and exclusivity of RPA-CRISPR in detecting Escherichia coli O157

[0095] The RPA primers and sgRNAs screened in Example 2 were used to verify their inclusiveness and exclusivity in *E. coli* O157 strains from different sources and common cross-strains. The inclusive experimental strains and results are shown in the table below. Figure 14 As shown:

[0096]

[0097] The exclusion test strains and experimental results are shown in the table below. Figure 15 As shown:

[0098]

[0099]

[0100] The inclusion assay results showed that the CRISPR results of 18 E. coli O157 standard strains and sample isolates were consistent with the traditional biochemical results, with no false negatives. The exclusion assay results showed that the CRISPR results of 64 non-E. coli O157 standard strains and sample isolates were consistent with the traditional biochemical results, with no false negatives, indicating high specificity.

[0101] Example 4: Sensitivity Testing of the RPA-CRISPR Detection System

[0102] The sample to be tested was diluted with water and then extracted using the magnetic bead method to a final concentration of 10 ng / uL. The template was then serially diluted to determine the lowest concentration of target nucleic acid that the RPA-CRISPR detection system could detect in the sample.

[0103] The RPA amplification system and Cas enzyme digestion detection system were referenced in Example 3, and the reaction procedure was referenced in Example 2. The template, with a final concentration of 10 ng / µL, was sequentially diluted 10-fold, 100-fold, 1000-fold, 10^4-fold, 10^5-fold, and 10^6-fold, with three replicates for each dilution gradient. The results are shown below. Figure 16-21 As shown.

[0104] The results showed that the template at a concentration of 10 ng / µL could be stably detected by the three replicates of the RPA-CRISPR detection system at dilutions of 10-fold, 100-fold, 1000-fold, 10^4-fold, and 10^5-fold. However, it could not be detected by any of the three replicates at a dilution of 10^6-fold. Based on the above results, the 10 ng / µL strain can be detected at a dilution of 10^5-fold. Therefore, the RPA-CRISPR detection system in this application can detect nucleic acids at the fg level.

[0105] Although specific embodiments of the invention have been described in detail, those skilled in the art will understand that various modifications and variations can be made to the details based on all the published teachings, and all such changes are within the scope of protection of the invention. The entire scope of the invention is given by the appended claims and any equivalents thereof.

Claims

1. A method for detecting Escherichia coli O157 based on CRISPR technology, characterized in that, The method includes the following steps: S1. Amplify the sample to be tested to obtain the amplification product; The sample to be tested was amplified using an RPA amplification primer set, the sequences of which are shown in SEQ ID No. 2 and SEQ ID No.

7. S2. The amplification product is contacted with Cas protein, sgRNA and a single-stranded nucleic acid detector to detect the detectable signal generated by the Cas protein cleaving the single-stranded nucleic acid detector, thereby detecting Escherichia coli O157. The sgRNA includes a region that binds to the Cas protein and a target region that hybridizes with the target nucleic acid. The target nucleic acid is a nucleic acid derived from Escherichia coli O157. The sequence of the target region that hybridizes with the target nucleic acid in the sgRNA is shown in SEQ ID No.

9.

2. The method according to claim 1, characterized in that, The Cas protein is Cas12b.

3. The method according to claim 2, characterized in that, The backbone region of the sgRNA is shown in SEQ ID No.

11.

4. The method according to claim 1, characterized in that, The amplification product is as shown in SEQ ID No. 1 or is a partial sequence of the sequence shown in SEQ ID No.

1.

5. The method according to claim 1, characterized in that, The detectable signal can be achieved through any of the following methods: vision-based detection, sensor-based detection, color detection, gold nanoparticle-based detection, fluorescence polarization, fluorescence signal, colloidal phase transition, electrochemical detection, or semiconductor-based detection.

6. The method according to claim 1, characterized in that, Step S1 is an RPA amplification method; preferably, the amplification system in step S1 includes basic RPA premix, RPA amplification primer set, magnesium acetate, template DNA and polyethylene glycol 35000.

7. The method according to claim 1, characterized in that, Step S2 is a CRISPR detection method, and the detection system in step S2 includes CRISPR buffer, Cas12b protein, sgRNA and single-stranded nucleic acid detector.

8. A system or composition for detecting Escherichia coli O157, said system or composition comprising the RPA amplification primer set of claim 1, Cas protein, sgRNA of claim 1, and single-stranded nucleic acid detector.

9. Use of the system or composition of claim 8 in the preparation of reagents or kits for detecting Escherichia coli O157.

10. The use according to claim 9, characterized in that, The test samples were derived from animals.

Images