Genetically engineered bacterium for producing (-)-limonene, (-)-carvol and (-)-carvone and application of genetically engineered bacterium

By constructing a genetically engineered red yeast strain, introducing specific enzyme systems, and regulating metabolic flux, the efficient microbial synthesis of (-)-limonene, (-)-carvone, and (-)-carvone was achieved, solving the problems of environmental pollution and high cost of traditional production methods and providing a green and sustainable production solution.

CN121343789APending Publication Date: 2026-01-16NORTHWEST A & F UNIV +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511303413.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-12
Publication Date
2026-01-16

AI Technical Summary

Technical Problem

In the existing technology, the production of (-)-limonene and its derivatives (-)-carvone and (-)-carvone mainly relies on plant extraction or chemical synthesis, which has problems such as strong dependence on raw materials, low extraction rate, high cost and environmental pollution. There are no reports of de novo synthesis by microorganism.

Method used

By constructing a genetically engineered red yeast strain, exogenous limonene synthase, key enzymes of the mevalonate pathway, cytochrome P450-limonene-6-hydroxylase, and carvacrol dehydrogenase were introduced to regulate metabolic flux and construct synthetic pathways for (-)-limonene, (-)-carvacrol, and (-)-carvacrol, which were then synthesized by microorganisms using glucose as a substrate.

Benefits of technology

It has achieved efficient and green production of (-)-limonene, (-)-carvone and (-)-carvone, improved conversion rate, reduced production cost, and the fermentation process is simple and controllable, with good potential for industrial application.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121343789A_ABST
    Figure CN121343789A_ABST
Patent Text Reader

Abstract

The invention relates to a genetically engineered bacterium for producing (-)-limonene, (-)-carvol and (-)-carvone and application of the genetically engineered bacterium. According to the method, endogenous ATP-citrate lyase genes ACL and CarYB genes are knocked out, endogenous mevalonic acid pathway key genes HMGR, ACCT and IDI are overexpressed, a mevalonic acid kinase gene MmMK sourced from methanosarcina martensii and mevalonic acid pathway key genes EfMvaS and EfMvaE sourced from enterococcus faecalis are introduced, and the (-)-limonene, (-)-carvol and (-)-carvone are synthesized into the genetically engineered strain. The method is realized in a platform strain for regulating and controlling the balance of the cofactor NADPHP. And the yield of the (-)-limonene in a bioreactor of 500-mL reaches 608.5 mg / L. The yield of the (-)-carveol reaches 667.6 mg / L when the (-)-carveol is fermented in a 500-mL bioreactor. The fermentation yield of the recombinant strain for producing the (-)-carvone in a 500-mL bioreactor reaches 67.1 mg / L.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of metabolic engineering and synthetic biology, specifically to a genetically engineered bacterium that produces (-)-limonene, (-)-carvacrol and (-)-carvacrol, and its applications. Background Technology

[0002] (-)-Limonene and its derivatives (-)-carvone and (-)-carvone are important monocyclic monoterpenoid compounds with various pharmacological activities (antibacterial, anti-inflammatory, antioxidant, anticancer, and anticonvulsant) and pleasant aromas, and are widely used in the food, daily chemical, agricultural, and pharmaceutical industries. Among them, (-)-carvone has a sweet spearmint aroma, and its market size is projected to reach 437 million yuan in 2028 (2023 Carvone Industry Development Trend Analysis Report). Traditionally, the production of limonene and its derivatives mainly relies on plant extraction, which is limited by strong dependence on raw materials, low extraction rates, and high costs. Chemical synthesis methods suffer from environmental pollution, low configuration selectivity, and the presence of toxic byproducts. Microbial synthesis holds promise for providing a new option for the green and sustainable production of (-)-carvone and (-)-carvone.

[0003] Currently, de novo biosynthesis of (-)-limonene has been achieved in *Escherichia coli*, *Yersinia esteroglossa*, and *Saccharomyces cerevisiae*, with the highest yield reaching 3.63 g / L (Molecules. 2020, 25(8), 1881). The microbial synthesis of (-)-carvone and (-)-carvone mainly employs whole-cell catalytic conversion of (-)-limonene. For example, plant cells or *E. coli* are used to convert (-)-limonene into (-)-carvone. However, de novo microbial synthesis of these two compounds has not yet been reported.

[0004] Unconventional yeasts, particularly those in the genus *Rhodotorula*, are typically capable of efficiently utilizing the complex mixture of C5 and C6 monosaccharides in lignocellulose hydrolysates and exhibit a degree of tolerance and utilization for numerous byproducts in the hydrolysate. These yeasts are Crabtree-negative, do not produce ethanol, and possess high-density fermentation characteristics. They are tolerant of low pH and high osmotic pressure, making them potential hosts for many biopharmaceutical industrial production processes. Multi-omics studies of this genus, including genomics, transcriptomics, and proteomics, are becoming increasingly comprehensive, laying the foundation for rationally modifying their metabolic networks to achieve the microbial synthesis of high-value compounds. Furthermore, these yeasts can naturally synthesize and accumulate carotenoids and intracellular lipids—both precursors of acetyl-CoA and reducing agents of NADPH. Acetyl-CoA and NADPH are also precursors and reducing agents for limonene synthesis via the mevalonate pathway. Previously, limonene synthesis has been achieved using *Rhodotorula rubrum*, but the de novo synthesis of (-)-carvone and (-)-carvone has not been achieved.

[0005] This invention first constructs a platform strain for (-)-limonene through a systematic metabolic regulation strategy, such as enhancing the supply of precursors (acetyl-CoA, malonyl-CoA), multi-compartment co-regulation of the cytoplasm-mitochondria-peroxisomal, weakening competing pathways (carotenoids, lipids), and regulating the balance of cofactors NADPHP to enhance the synthesis efficiency of (-)-limonene; furthermore, it synthesizes carvacrol by introducing limonene-6-hydroxylase and P450 reductase; and further still, it synthesizes carvacrol by introducing carvacrol dehydrogenase. Summary of the Invention

[0006] The technical problem to be solved by the present invention is to synthesize (-)-limonene and its derivatives (-)-carvacrol and (-)-carvacrol from glucose as a substrate by de novo microbial synthesis.

[0007] This invention first provides a genetically engineered bacterium for producing (-)-limonene. The genetically engineered bacterium is constructed using *Rhodotorula rubra* as the host and employs the following strategy: 1. Introducing the exogenous (-)-limonene synthase gene (-)-LS; 2. Overexpressing one or more of the key enzymes in the endogenous mevalonate pathway, ACCT, HMGR, and IDI, and introducing one or more exogenous genes, NphT7, EfMvaE, EfMvaS, and MmMK; 3. Knocking out the ATP-citrate lyase ACL and the 2-acylglycerol O-acyltransferase DGAT gene and introducing the “ACCT-RIDD-ACL-RIAD” complex. The NCBI accession numbers corresponding to the ACCT, HMGR, IDI, and FPPS genes are XM_016416572.1, XM_016417713.1, XM_016418800.1, and XM_016415341.1, respectively. The amino acid sequences of NphT7, EfMvaE, EfMvaS, MmMK and (-)-LS are shown in the sequence listings SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6, respectively.

[0008] Furthermore, this invention provides a genetically engineered bacterium for producing (-)-carvacrol. The engineered bacterium uses a limonene-synthetic strain as a chassis and constructs a carvacrol-synthetic engineered strain by introducing the cytochrome P450-limonene-6-hydroxylase gene L6H and the cytochrome P450 reductase gene CPR, and regulating the copy number and ratio of L6H and CPR. The amino acid sequences of L6H and CPR are shown in SEQ ID NO.7 and SEQ ID NO.8 of the sequence listing.

[0009] Furthermore, this invention provides a genetically engineered bacterium for producing (-)-carvone. The engineered bacterium uses a carvone-synthetic strain as a chassis and constructs a (-)-carvone biosynthetic pathway by introducing the carvone dehydrogenase gene CDH. Simultaneously, overexpression of key genes enhances the metabolic flux of the biosynthetic pathway, thereby increasing the yield of (-)-carvone. The amino acid sequence of CDH is shown in SEQ ID NO.9 of the sequence listing.

[0010] Furthermore, the platform strain for the de novo genetic engineering demonstration example of (-)-limonene, (-)-carvone and (-)-carvone is Rhodotorula toruloides NP11.

[0011] Furthermore, the genetically engineered bacteria for producing (-)-limonene, (-)-carvacrol, and / or (-)-carvone are characterized in that the (-)-limonene synthase (-)-LS is derived from, but not limited to, peppermint (Mentha spicata); the cytochrome P450 limonene-6-hydroxylase (L6H) is derived from, but not limited to, ginger mint (Mentha x gracilis); the cytochrome P450 reductase (CPR) is derived from, but not limited to, Arabidopsis thaliana; and the carvacrol dehydrogenase (CDH) is derived from, but not limited to, Rhodococcus erythropolis.

[0012] Furthermore, the engineered bacterial substrate is a type of Rhodotorula, including but not limited to Rhodotorula toruxinus, Rhodotorula glutinis, Rhodotorula acheniorum, Rhodotorula graminis, Rhodotorula marina, Rhodotorula mucilaginosa, Rhodotorula rubra, Rhodotorula lactosus, Rhodotorula sphaerocarpum, and Rhodotorula bogoriensis.

[0013] Furthermore, the acetyl-CoA synthase gene (NphT7) contained in the de novo engineered microorganisms that synthesize (-)-carvyl alcohol and (-)-carvone comes from the genus Streptomyces; the bifunctional enzymes acetyl-CoA synthase / 3-hydroxy-3-methylglutaryl-CoA synthase reductase (EfMavE) and 3-hydroxy-3-methylglutaryl-CoA synthase (EfMvaS) come from Enterococcus faecalis; and the mevalonate kinase gene (MmMK) comes from Methanosarcina mazei.

[0014] Furthermore, the mevalonate pathway genes contained in the engineered bacteria are all endogenous genes of Rhodotorula rubra or corresponding gene mutants. Specifically, the conversion of isopentenyl pyrophosphate (IPP) to geranyl pyrophosphate (GPP) is accomplished by the endogenous farnesyl pyrophosphate synthase mutant (FPPS). K197G / F96W / N127W )catalytic.

[0015] Furthermore, the "ACCT-RIDD-ACL-RIAD" complex, consisting of acetyl-CoA acyltransferase (ACCT) and ATP-citrate lyase (ACL), is constructed using the RIDD and RIAD polypeptide scaffolds. The amino acid sequence of the scaffold protein RIDD is SEQ ID NO.10. The amino acid sequence of the scaffold protein RIAD is SEQ ID NO.11; both scaffolds have been publicly reported in the literature (Wei Kang, Tian Ma, Min Liu, et al. Modular enzyme assembly for enhanced cascade biocatalysis and metabolic flux. Nat. Commun. 2019, 10, 4248).

[0016] Furthermore, the acetyl-CoA synthase (NphT7) is any one of the following:

[0017] The amino acid sequence of M1-1 is the same as that of SEQ ID NO.2.

[0018] M1-2) is a protein derived from M1-1) or having more than 80% identity with the protein shown in M1-1) by substituting and / or deleting and / or adding amino acid residues of the amino acid sequence of the protein consisting of SEQ ID NO.2.

[0019] M1-3) is a fusion protein with the same function obtained by attaching a tag to the N-terminus and / or C-terminus of M1-1) or M1-2);

[0020] Furthermore, the farnesyl pyrophosphate synthase triple mutant (FPPS***) is any one of the following:

[0021] The amino acid sequence of M2-1 is that of a protein consisting of SEQ ID NO.1;

[0022] M2-2) is a protein derived from M2-1) or having more than 80% identity with the protein shown in M2-1) by substituting and / or deleting and / or adding amino acid residues of the amino acid sequence of the protein consisting of SEQ ID NO.1.

[0023] M2-3) is a fusion protein with the same function obtained by attaching a tag to the N-terminus and / or C-terminus of M2-1) or M2-2);

[0024] Furthermore, the cytochrome P450 limonene-6-hydroxylase (L6H) is any one of the following:

[0025] The amino acid sequence of M3-1 is that of a protein consisting of SEQ ID NO.7;

[0026] M3-2) is a protein derived from M3-1) or with more than 80% identity to the protein shown in M3-1) by substituting and / or deleting and / or adding amino acid residues of the amino acid sequence of the protein consisting of SEQ ID NO.7.

[0027] M3-3) is a fusion protein with the same function obtained by attaching a tag to the N-terminus and / or C-terminus of M3-1) or M3-2);

[0028] Furthermore, the cytochrome P450 reductase (CPR) is any one of the following:

[0029] The amino acid sequence of M4-1 is that of a protein consisting of SEQ ID NO. 8;

[0030] M4-2) is a protein derived from M4-1) or having more than 80% identity with the protein shown in M4-1) by substituting and / or deleting and / or adding amino acid residues of the amino acid sequence of the protein consisting of SEQ ID NO.8.

[0031] M4-3) is a fusion protein with the same function obtained by attaching a tag to the N-terminus and / or C-terminus of M4-1) or M4-2);

[0032] Furthermore, the carvacrol dehydrogenase (CDH) is any one of the following:

[0033] The amino acid sequence of M5-1 is that of a protein consisting of SEQ ID NO.9;

[0034] M5-2) is a protein derived from M5-1) or with more than 80% identity to the protein shown in M5-1) by substituting and / or deleting and / or adding amino acid residues of the amino acid sequence of the protein consisting of SEQ ID NO.9.

[0035] M5-3) is a fusion protein with the same function obtained by attaching a tag to the N-terminus and / or C-terminus of M5-1) or M5-2);

[0036] The use of the aforementioned recombinant bacteria in the preparation of (-)-limonene, (-)-carvacrol and (-)-carvacrol using glucose is within the scope of protection of this invention.

[0037] The present invention provides a method for preparing (-)-limonene, (-)-carvacrol and (-)-carvacrol, the method comprising using the aforementioned recombinant bacteria as a fermentation strain and glucose as a raw material to prepare (-)-limonene, (-)-carvacrol and (-)-carvacrol.

[0038] The gene deletion method described in this invention employs CRISPR-Cas9 technology, which is within the capabilities of those skilled in the art.

[0039] This invention uses *Rhizopus circotensis* as the chassis strain. By knocking out the endogenous CarYB gene and the endogenous ATP-citrate lyase gene ACL, and introducing the “ACCT-RIDD-ACL-RIAD” complex, and overexpressing the exogenous genes NphT7, EfMvaS, and MmMK to increase the metabolic flux of the mevalonate pathway, a platform strain suitable for terpene synthesis is constructed. Subsequently, the peppermint-derived (-)-limonene synthase gene (-)-LS is integrated into the genome of *Rhizopus circotensis*, and key endogenous mevalonate pathway genes HMGR, ACCT, PMK, PDC, IDI, and FPPS are overexpressed. K197G / F96W / N127W A recombinant strain of Rhodotorula circophylla that produces (-)-limonene was constructed using the glyceraldehyde-3-phosphate dehydrogenase gene GAP DH derived from Clostridium perfringens.

[0040] Furthermore, the cytochrome P450-limonene-6-hydroxylase gene L6H and the cytochrome P450 reductase gene CPR were introduced to obtain a recombinant Rhizopus circinus strain that produces (-)-carvacrol.

[0041] Furthermore, by introducing the carvacrol dehydrogenase gene CDH, a recombinant strain of *Rhodotorula circoides* producing (-)-carvone was obtained. The production method for synthesizing (-)-limonene, (-)-carvrolol, and (-)-carvone by modifying *Rhodotorula circoides* disclosed in this invention will lay the foundation for the industrial production of (-)-limonene and its derivatives (-)-carvrolol and (-)-carvone.

[0042] Compared with existing technologies, the beneficial effects of this invention are mainly reflected in the following aspects: 1) It shifts the metabolic flow from lipid synthesis to terpene synthesis at the source, weakening the competitive pathways of (-)-limonene, (-)-carvone, and (-)-carvone, and improving the conversion rate of glucose to the target products (-)-limonene, (-)-carvone, and (-)-carvone. 2) The application of the genetically engineered bacteria for producing (-)-limonene, (-)-carvone, and (-)-carvone provided by this invention requires fewer genetic operations and is simple and efficient, with a short strain modification cycle. 3) The engineered bacteria for (-)-limonene, (-)-carvone, and (-)-carvone provided by this invention have stable heterologous gene expression, and fermentation does not require the addition of antibiotics and inducers, reducing production costs. The fermentation process is simple and controllable, and it is highly economical. 4) The engineered bacteria for (-)-limonene and (-)-carvacrol provided by this invention, using glucose as a substrate, are fermented in a 500mL fermenter with batch feeding. The yield of the engineered bacteria for (-)-limonene is the highest at 156h, reaching 608.5mg / L, with a yield of 0.04g / g glucose; the yield of the engineered bacteria for (-)-carvacrol is the highest at 240h, reaching 667.6mg / L, with a yield of 0.04g / g glucose, showing good potential for industrial application. Attached Figure Description

[0043] Figure 1 A schematic diagram illustrating the reorientation of the source carbon metabolic flux in the mevalonate pathway of Rhodotorula circulatory system;

[0044] Figure 2 A schematic diagram of the de novo synthetic pathways for (-)-limonene, (-)-carvone and (-)-carvone;

[0045] Figure 3 A schematic diagram illustrating the construction of expression vectors for engineered strains;

[0046] Figure 4 The gas chromatography (GC) and gas chromatography-mass spectrometry (GC-MS) spectra of the fermentation products of (-)-limonene engineered strain SL4.

[0047] Figure 5The images show the gas chromatography (GC) and gas chromatography-mass spectrometry (GC-MS) detection of fermentation products from the (-)-carvone engineered strain SC1.

[0048] Figure 6 The images show the gas chromatography (GC) and gas chromatography-mass spectrometry (GC-MS) results of the fermentation products of the (-)-carvone engineered strain SE1. Detailed Implementation

[0049] To facilitate understanding of the present invention, it will be described in detail below with reference to the accompanying drawings and embodiments. However, before describing the present invention in detail, it should be understood that the present invention is not limited to the specific embodiments described. It should also be understood that the terminology used herein is for describing specific embodiments only and is not intended to be restrictive.

[0050] Unless otherwise specified, all experimental materials and reagents used in the following examples are commercially available.

[0051] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods.

[0052] The strains used in this invention are shown in Table 1, the primers used are shown in Table 2, and the plasmids involved are shown in Table 3.

[0053] The starting strain of Rhodosporidium toruloides in the examples was obtained from the Dalian Institute of Chemical Physics. It is the conventional Rhodosporidium toruloides NP11 in the field, which has been published in Fems Yeast Research (Lin X, Wang Y, Zhang S, et al. Functional integration of multiple genes into the genome of theoleaginous yeast Rhodosporidium toruloides. Fems Yeast Research, 2014(4):547-555.).

[0054] In this invention, multiple genes expressed by plasmids are linked by 2A peptides (P2A, T2A), and the reverse insertion expression cassette described in this invention has been verified to have high expression efficiency. Because the resistance selection markers for *Rhodotorula glutinis* are limited in this invention, a large number of genes can be inserted into a single vector.

[0055] This invention employs an in-fusion cloning method for plasmid construction. First, the reaction system for in-fusion cloning is prepared, with the DNA fragment added at a molar ratio of 1:2 to the vector, totaling 5 μl, along with 5 μl of MULassembly mix. The reaction program is: 50℃, 30 min. After the reaction, *E. coli* transformation is performed, and the plasmid is extracted and sequenced.

[0056] In this invention, all yeast strains were constructed using Agrobacterium-mediated transformation. The transformation steps are as follows:

[0057] Pre-aliquoted Agrobacterium competent cells were removed from -80℃ for electroporation. First, 50 μL of competent cells in a 2 mL centrifuge tube was thawed at hand temperature. 1 μL of the correctly sequenced plasmid to be transformed was added, and the mixture was gently mixed and placed on ice for 10 min. Then, the mixture was transferred to an electroporation cuvette and transformed using the AGL mode. Immediately afterward, 1 mL of sterile LB medium was added. Finally, the mixture with medium was incubated at 28℃ in a shaker for 4-6 h, then plated onto antibiotic-resistant LBK plates and incubated at 28℃ for 1.5 days. Transformant colonies were then collected for PCR verification. The verified Agrobacterium transformants and the yeast to be transformed were incubated at 28℃ for 16-20 h. After the strain reached the logarithmic growth phase, the cells were washed with sterile water and the OD was adjusted. 600 Adjust the concentration to 0.4-0.6. Take 100 μL of Agrobacterium and yeast dilutions respectively, mix them in sterile centrifuge tubes, and then spot them evenly onto IM culture plates with filter paper. Incubate the IM induction plates upside down in a 25°C incubator for 1.5 days. Then, use sterile forceps to transfer the filter paper to the corresponding antibiotic YPD plates and continue incubating at 28°C for 2-3 days. Finally, perform stability verification of the transformants through passage.

[0058] The preparation method for IM medium is as follows: Add 10mM K₂HPO₄, 10mM KH₂PO₄, 2.5mM NaCl, 2mM MgSO₄·7H₂O, 4mM (NH₄)₂SO₄, 10mM glucose, 0.5% (w / v) glycerol, and 20g / L agar powder to 800mL of deionized water, adjust the pH to 7.0, and add water to a final volume of 900mL. Sterilize at 121℃ for 15min. Then dissolve 0.7mM CaCl₂·2H₂O, 9μm FeSO₄·7H₂O, and 40mM 4-morpholine ethanesulfonic acid (MES) in 100mL of deionized water, adjust the pH to 5.3, filter through a 0.22μm aqueous filter membrane for sterilization, and add the resulting solution to the above sterile solution to form the IM salt solution. 100 mM acetylsuccine was dissolved in DMSO and sterilized by filtration through a 0.22 μm organic phase filter membrane, resulting in a final concentration of 200 μM when added to MM salt solution. 20 g / L agarose was added to solid plates.

[0059] The culture medium used for culturing and screening the strains in this invention was nitrogen-limiting (NL) medium (carbon-nitrogen ratio 8 / 1), with the following composition (g / L): glucose 20, yeast extract 0.5, NH4Cl 0.33, Mg2SO4·7H2O 1.5, KH2PO4 1 g / L, Na2HPO4·12H2O 1 g / L, pH 6.0. The fermentation conditions were: 28℃, 180 rpm, 120 h.

[0060] The culture medium composition (g / L) for the 500mL bioreactor fed-batch fermentation in this invention is as follows: glucose 20, yeast extract 1g / L, MgSO4·7H2O 1.5, KH2PO4 1, Na2HPO4·12H2O 1, (NH4)2SO4 1.54; trace metals 1mL / L, vitamins 1mL / L. The fed-batch culture medium (g / L) consists of: glucose 400, (NH4)2SO4 37, KH2PO4 9, K2SO4 3.5, Na2SO4 0.28, MgSO2·7H2O 2.5; trace metals 10mL / L, vitamins 12mL / L. The fermentation conditions are: pH 5.6, temperature 28℃, dissolved oxygen 10%, aeration maintained at 0.5-1.0L / min, and stirring rate 400-800rpm.

[0061] Primers were synthesized by Yangling Tianrun Aoke Biotechnology Co., Ltd. PCR products were sequenced by Yangling Tianrun Aoke Biotechnology Co., Ltd.

[0062] In this invention, the extraction and detection methods for (-)-limonene, (-)-carvacrol, and (-)-carvone are as follows:

[0063] Product extraction: After fermentation, 1 mL of the organic phase was placed in a 2 mL centrifuge tube, anhydrous sodium sulfate was added to remove water, and then the product was filtered through a 0.22 μm organic filter membrane and detected by gas chromatography.

[0064] Qualitative analysis: The products were detected and analyzed using headspace solid-phase microextraction combined with gas chromatography-mass spectrometry (H-SPME-GC-MS). A 50 / 30μm DVB / CAR / PDMS coated SPME fiber was used, and analysis was performed on a GCMS-QP2010 Ultra (Shimadzu, Japan). The instrument was equipped with an FID detector and an HP-5MS capillary column (30m × 0.25mm × 0.25μm). The sample was equilibrated at 40℃ and 300rpm for 15 min, then extracted for 30 min, followed by desorption at a 230℃ injection port for 10 min. He was used as the carrier gas at a flow rate of 1.5 mL / min. Mass spectrometry conditions: transfer line 280℃, ion source 230℃, EI source 70 eV, scan range 29-350 u. Column temperature program: initial temperature 50℃, increased to 115℃ at 2℃ / min, then increased to 150℃ at 5℃ / min.

[0065] Quantitative detection: Gas chromatography (GC-2014, Shimadzu, Japan) was used, employing an HP-5 capillary column (30m × 0.32mm × 0.25μm) and an FID detector. N2 was used as the carrier gas at a flow rate of 1.0 mL / min, with an injection volume of 1 μL. The injection port and detector were set at 250℃ and 280℃, respectively. The split ratio was 30:1. The initial column oven temperature was 50℃, increased to 150℃ at a rate of 5℃ / min, and held for 5 min.

[0066] Prepare product standards with different concentration gradients, and obtain a standard curve showing the relationship between peak area and concentration according to the sample detection procedure. Substitute the values ​​into the standard curve to calculate the product concentration in each sample.

[0067] Table 1. Strains used in this invention

[0068]

[0069] Table 2. Primers used in this invention

[0070]

[0071]

[0072]

[0073] Table 3. Plasmids constructed and transformed in this invention

[0074]

[0075] The present invention will be specifically described below through specific embodiments.

[0076] Example 1: Enhancement of carbon metabolism flux via the mevalonate pathway

[0077] The chassis cells used in this embodiment include, but are not limited to, Rhodotorula buergerianum. All other proteins that can be expressed using bacterial, yeast, or cell expression systems are included within the scope of this invention.

[0078] Using Rhizopus cylindrica NP11 as the chassis cell, the following steps were performed: (1) knocking out ATP-citrate lyase ACL and the bifunctional enzyme phytoene synthase / lycopene cyclase CARYB; (2) introducing the “ACCT-RIDD-ACL-RIAD” complex with NphT7, EfMvaS, and MmMK. A platform strain suitable for terpene compound synthesis was constructed, and a cell factory for producing (-)-limonene and its derivatives (-)-carvone and (-)-carvone was constructed using this strain as the chassis.

[0079] E1.1 Knockout of the ATP-citrate lyase gene ACL and the phytoene synthase / lycopene cyclase gene CarYB

[0080] Using Rhodosporidium toruloides NP11 as the chassis cell, the genes ACL and CARYB were knocked out using CRISPR-Cas9 technology to obtain strain ΔACL-ΔCAR-NP11. The gene knockout method is referenced in (Jiao X, Zhang Y, Liu X, et al. 2019. Developing a CRISPR / Cas9 system for genome editing in the basidiomycetous yeast Rhodosporidium toruloides[J]. Biotechnology Journal, 14(7): 1900036).

[0081] The sgRNA sequence used for ACL knockout is: ATGCCGCGTTCCAGACGGCCC

[0082] The sgRNA sequence used for CarYB knockout is: TACCTCGCGTTGATTGTTGG

[0083] The obtained strain was then introduced into the "ACCT-RIDD-ACL-RIAD" complex, which shortened the spatial distance between ACL and ACCT. Ac-CoA generated by ACL catalysis could be preferentially captured by ACCT, thus entering the MVA pathway to generate acetoacetyl-CoA. Knocking out the CARYB gene could block the endogenous carotenoid competition pathway in Rhodotorula buergerianum, which was beneficial to the synthesis of (-)-limonene.

[0084] E1.2 introduces the “ACCT-RIDD-ACL-RIAD” complex with NphT7, EfMvaS, and MmMK.

[0085] E1.2.1 Using ΔACL-ΔCAR-NP11 as the chassis cell, and plasmid Puc57-Amp-ACCT-RIDD-ACL-RIAD as the template, a 5937bp target gene fragment was amplified using primers XYL-fu-EV-RtACCT-F / Thsp-fu-HpaI-RIAD-R. Plasmid PZPK-Ntc-ACCT-RIDD-ACL-RIAD was constructed using EcoRV and SpeI double-digested plasmid PZPK-Ntc-XYL as the vector via in-fusion cloning.

[0086] The E1.2.2 genes NphT7, EfMvaS, and MmMK were synthesized by a gene company and constructed on the vector Puc57-Amp. Target gene fragments of 1030bp, 1251bp, and 1016bp, respectively, were amplified using primers T2A-fu-NphT7-F / Thsp-fu-SpeI-NphT7-R, XYL-fu-EV-MK-F / EfMvaS-fu-P2A-R, and P2A-fu-EfMvas-F / NphT7-fu-T2A-R. Using the EcoRV and SpeI double-digested plasmid PZPK-Ntc-XYL as a vector, the three target gene fragments were ligated into the vector using in-fusion cloning to construct the plasmid PZPK-Ntc-XYL-MmMK-EfMvaS-NphT7-Thsp.

[0087] Using this plasmid as a template, the expression cassette XYL-MmMK-EfMvaS-NphT7-Thsp was amplified using primers LB-fu-EcoRI-Thsp-F / PGK-fu-XYL-R. The EcoRI-digested plasmid PZPK-Ntc-XYL-ACCT-RIDD-ACL-RIAD-Thsp was used as a vector. The expression cassette XYL-MmMK-EfMvaS-NphT7-Thsp was inserted in reverse before the resistance expression cassette of the vector. The plasmid PZPK-Thsp-NphT7-EfMvaS-MmMK-Ntc-ACCT-RIDD-ACL-RIAD was constructed by in-fusion cloning. The plasmid was transformed into Agrobacterium via electroporation, and then introduced into the genome of *Rhodotorula buergerianum* NP11 using Agrobacterium-mediated transformation. Transformants were selected using resistance selection markers, and the transformant that recovered growth activity was designated as the target strain and named ACL1-NP11. Thus, a platform strain for terpene compound production was constructed.

[0088] Example 2: Construction of an engineered strain for the biosynthesis of (-)-limonene in cytoplasm

[0089] The chassis cells used in this embodiment include, but are not limited to, Rhodotorula buergerianum. All other proteins that can be expressed using bacterial, yeast, or cell expression systems are included within the scope of this invention.

[0090] In this embodiment, Rhodotorula circophylla ACL1-NP11 was used as the chassis cell to construct a heterologous biosynthetic pathway of (-)-limonene in Rhodotorula circophylla, mainly including the following steps: (1) Introducing peppermint-derived (-)-limonene synthase (MstLS) and farnesyl pyrophosphate synthase triple mutant (FPPS) K197G F96W ,N127W (hereinafter referred to as FPPS***), expressed in the form of fusion protein (hereinafter referred to as FPPS***::(-)-LS), and overexpressed the key rate-limiting enzyme gene tHMGR in the MVA pathway; (2) further introduced or overexpressed ACCT, IDI, MmMK, PM K, PDC genes to increase the metabolic flux of the mevalonate pathway; increased the copy of FPPS***::(-)-LS to improve the conversion efficiency of GPP to (-)-limonene.

[0091] Construction of the E2.1(-)-limonene cytoplasmic heterologous synthesis pathway

[0092] E2.1.1 Using ACL1-NP11 as the chassis cell, FPPS*** and MstLS were expressed as fusion proteins to promote the conversion of GPP to (-)-limonene. MstLS was synthesized by a gene company and existed in the form of plasmid Puc57-Amp. FPPS*** was derived from endogenous FPPS mutation. The 1690bp target gene fragment (-)-LS was amplified using primers FPPS***-fu-GGGS-(-)-LS-F / Thsp-fu-HpaI-(-)-LS-R.

[0093] E2.1.2 Using the SpeI-digested plasmid PZPK-Hyg-sgRNA-CAR-FPPS*** as a vector, the plasmid PZPK-Hyg-FPPS***-GGGS-MstLS was constructed via in-fusion cloning. HMGR is a key rate-limiting enzyme in the MVA pathway. Using the genome of Rhodotorula glutinis NP11 as a template, the target gene fragment tHMGR was amplified using primers LDP-fu-EV-tHMGR-F / and FPPS***-fu-P2A-R.

[0094] E2.1.3 Using the EcoRV single-enzyme digested plasmid PZPK-Hyg-LDP-FPPS***-GGGS-MstLS as a vector, the plasmid PZPK-Hyg-LDP-tHMGR-FPPS***-GGGS-MstLS-Thsp was constructed by in-fusi-on-cloning.

[0095] E2.1.4 The plasmid PZPK-Hyg-LDP-tHMGR-FPPS***-GGGS-MstLS-Thsp was transformed into Agrobacterium by electroporation, and then introduced into the genome of strain ACL1-NP11 by Agrobacterium-mediated transformation to obtain (-)-limonene engineered strain SL1.

[0096] Example 3: Construction of an engineered strain for peroxisome biosynthesis of (-)-limonene

[0097] E3.1 The PTS2-FPPS***::(-)-LS fusion protein was obtained by adding the peroxisome signal peptide PTS2 to the N-terminus of FPPS***::(-)-LS. The amino acid sequence of the PTS2 signal peptide is shown in SEQ ID NO.12 of the sequence listing.

[0098] E3.2 used primers P2A-fu-PTS2-FPPS***-F and Thsp-fu-SpeI-(-)-LS-R to clone the gene fragment in E2.1, obtaining the PTS 2-FPPS***::(-)-LS gene fragment.

[0099] Similar to Example 2E2.1.3, plasmid PZPK-Hyg-LDP-tHMGR-PTS2-FPPS***-GGGS-MstLS-Thsp was obtained in E3.3.

[0100] Similar to Example 2 E2.1.4, E3.4 transforms the plasmid into Agrobacterium via electroporation, and then introduces it into the genome of strain ACL1-NP11 using Agrobacterium-mediated transformation to obtain (-)-limonene engineered strain SL2.

[0101] Example 4: Construction of an engineered strain for cytoplasmic-peroxisome dual-regulated biosynthesis (-)-limonene

[0102] Using plasmid PZPK-Hyg-LDP-tHMGR-FPPS***::(-)-LS-Thsp as a template, a 2808 bp target gene fragment was amplified using primers EnoI-fu-KpnI-FPPS-F / Thsp-fu-SpeI-(-)-LS-R. The plasmid PZPK-G418-EnoI-FPPS***::(-)-LS-Thsp was constructed using KpnI digestion plasmid PZPK-G418-EnoI as a vector via in-fusion cloning.

[0103] Using plasmid PZPK-G418-EnoI-FPPS***::(-)-LS-Thsp as a template, the expression cassette EnoI-FPPS***::(-)-LS-Thsp was amplified using primers LB-fu-EcoRI-Thsp-F / PGK-fu-EnoIR. The plasmid PZPK-Hyg-LDP-tHMGR-PTS2-FPPS***::(-)-LS-Thsp, which was digested with EcoRI, was used as a vector to construct the plasmid PZPK-Thsp-FPPS***::(-)-LS-EnoI-Hyg-LDP-tHMGR-PTS2-FPPS***::(-)-LS-Thsp.

[0104] Similar to Example 2E2.1.4, in E4.3, the plasmid PZPK-Thsp-FPPS***::(-)-LS-EnoI-Hyg-LDP-tHMGR-PTS2-FPPS***::(-)-LS-Thsp was transformed into Agrobacterium by electroporation, and then introduced into the genome of strain ACL1-NP11 by Agrobacterium-mediated transformation to obtain the (-)-limonene engineered strain SL3.

[0105] Example 5: Enhancement of metabolic flux in the cytoplasmic heterologous synthesis (-)-limonene pathway

[0106] The chassis strain used in this embodiment is SL1. The method of this embodiment can also be used with strains SL2 and / or SL3.

[0107] E5.1 used PZPK-Hyg-LDP-tHMGR-FPPS***-GGGS-MstLS-Thsp as a vector to continue expressing the genes FPPS***::(-)-LS, ACCT, and IDI. Multiple copies of FPPS***::(-)-LS improved the conversion efficiency of GPP to (-)-limonene. Using plasmid PZPK-Hyg-LDP-tHMGR-FPPS***::(-)-LS-Thsp as a template, a 2808 bp target gene fragment was amplified using primers EnoI-fu-KpnI-FPPS-F / Thsp-fu-SpeI-(-)-LS-R.

[0108] E5.2 Using the KpnI single enzyme digestion plasmid PZPK-G418-EnoI as a vector, the plasmid PZPK-G418-EnoI-FPPS***::(-)-LS-Thsp was constructed by in-fusion cloning.

[0109] Using this plasmid as a template, the expression cassette EnoI-FPPS***::(-)-LS-Thsp was amplified using primers LB-fu-EcoRI-Thsp-F / PGK-fu-EnoI-R. The plasmid PZPK-Hyg-LDP-tHMGR-FPPS***::(-)-LS-Thsp, digested with EcoRI, was used as a vector. This expression cassette was then inserted in reverse before the resistance expression cassette and ligated using in-fusion cloning to construct the plasmid PZPK-Thsp-FPPS***::(-)-LS-EnoI-Hyg-LDP-tHMGR-FPPS***::(-)-LS-Thsp.

[0110] Using plasmids containing T2A-ACCT-RIDD and P2A-IDI gene fragments respectively as templates, E5.4 amplified the 2386bp target gene fragment T2A-ACCT-RIDD and the 871bp target gene fragment P2A-IDI using primers (-)-LS-fu-T2A-R / Thsp-fu-P2A-RIDD-R and RIDD-fu-P2A-F / Thsp-fu-SpeI-RtIDI-R respectively.

[0111] Using the SpeI-digested plasmid PZPK-Thsp-FPPS***::(-)-LS-EnoI-Hyg-LDP-tHMGR-FPPS***::(-)-LS-Thsp as a vector, the two target gene fragments were ligated to the vector via in-fusion cloning to construct the plasmid PZPK-Thsp-IDI-RIDD-ACCT-FPPS***::(-)-LS-EnoI-Hyg-LDP-tHMGR-FPPS***::(-)-LS-Thsp. This plasmid was transformed into Agrobacterium via electroporation, and then introduced into the genome of ACL1-NP11 using Agrobacterium-mediated transformation to obtain the (-)-limonene engineered strain SL1.

[0112] Based on strain SL1, E5.6 overexpresses the genes PMK, PDC, and GAPDH, and also makes an additional copy of FPPS***::(-)-LS. The specific plasmid construction steps are as follows: Using Rhizopus circophylla NP11 cDNA as a template, the target gene fragments T2A-PMK and P2A-PDC were amplified using primers (-)-LS-fu-T2A-R / P2A-fu-PMK-R and PMK-fu-P2A-F / Thsp-fu-PDC-R. The two fragments were then ligated to the vector using the SpeI-digested plasmid PZPK-EnoI-FPPS***::(-)-LS-Thsp to construct the plasmid PZPK-EnoI-FPPS***::(-)-LS-PMK-PDC-Thsp.

[0113] E5.7 GAPDH was synthesized by a gene company and constructed on the vector Puc57-Amp. The 1499bp target gene fragment was amplified using primers LDP-fu-GAPDH-F and Thsp-fu-GAPDH-R. The plasmid PZPK-G418-fu-LDP-Thsp, which was double-digested with EcoRV and SpeI, was used as a vector to construct the plasmid PZPK-G418-LDP-NADPH-Thsp through seamless cloning. Using this plasmid as a template, the expression cassette LDP-NADPH-Thsp was amplified using primers LB-fu-EcoRI-Thsp-F and PGK-fu-LDP-R. This cassette was then inserted in reverse before the resistance expression cassette of plasmid PZPK-EnoI-FPPS***::(-)-LS-PMK-PDC-Thsp, thus constructing plasmid PZPK-Thsp-NADPH-LDP-EnoI-FPPS***::(-)-LS-PMK-PDC-Thsp. This plasmid was then transformed into Agrobacterium by electroporation and subsequently introduced into the genome of strain SL1 using Agrobacterium-mediated transformation to obtain the (-)-limonene engineered strain SL4.

[0114] Example 6: Construction of engineered strains for biosynthesizing (-)-carvacrol

[0115] The chassis cells used in this embodiment include, but are not limited to, Rhodotorula buergerianum. All other proteins that can be expressed using bacterial, yeast, or cell expression systems are included within the scope of this invention.

[0116] Using the engineered strain SL4 for (-)-limonene synthesis as the chassis cell, heterologous biosynthetic pathways for (-)-carvacrol and (-)-carvacrol were constructed, mainly including the following steps: (1) The cytochrome P450 reductase gene CPR from Arabidopsis thaliana and the cytochrome P450-limonene-6-hydroxylase gene L6H from Mentha x gracilis were introduced, and a copy of the L6H gene was made to construct the (-)-carvacrol biosynthetic pathway; (2) The (-)-carvacrol dehydrogenase gene CDH from Rhodococcus erythropolis was introduced to construct the (-)-carvacrol biosynthetic pathway.

[0117] E6.1 used (-)-limonene engineered strain SL4 as the starting strain. Genes CPR and L6H were synthesized by the company and constructed into the vector Puc57-Amp. Using Puc57-Amp-CPR-L6H as a template, the target gene fragment CPR-L6H was amplified using primers LDP-fu-EV-CPR-F / Thsp-fu-SpeI-L6H-R. Using the EcoRV and SpeI double-digested plasmid PZPK-Bar-LDP-Thsp as a vector, the plasmid PZPK-Bar-LDP-CPR-L6H-Thsp was constructed via seamless cloning.

[0118] E6.2 We also compared the promoting effects of CPR and L6H on the production of (-)-carvacrol and found that overexpression of L6H promoted its production. Therefore, we further overexpressed the L6H gene. The target gene fragment T2A-L6H was amplified using primers CPR-fu-T2A-F / Thsp-fu-SpeI-L6H-R. Using the Sp eI-digested plasmid PZPK-Bar-LDP-CPR-L6H-Thsp as a vector, the plasmid PZPK-Bar-LDP-CPR-L6H-L6H-Thsp was constructed via seamless cloning. This plasmid was transformed into Agrobacterium by electroporation, and then introduced into the genome of strain SL2 using Agrobacterium-mediated transformation to obtain the (-)-carvacrol engineered strain SC1.

[0119] Example 7: Construction of engineered strains for biosynthesizing (-)-carvone

[0120] E7.1 used (-)-limonene engineered strain SL2 as the starting strain. The CDH gene was synthesized by the company and constructed in the vector Puc57-Amp. Using Puc57-Amp-CDH as a template, the target gene fragment CDH was amplified using primers LDP-fu-EV-CDH-F / Thsp-fu-SpeI-CDH-R. Using the EcoRI and SpeI double-digested plasmid PZPK-Bar-LDP-Thsp as a vector, plasmid PZPK-Bar-LDP-CDH-Thsp was constructed via seamless cloning. Using this plasmid as a template, the expression cassette LDP-CDH-Thsp was amplified using primers LB-fu-EcoRI-Thsp-F and PGK-fu-LDP-R, and then inserted in reverse before the resistance expression cassette of plasmid PZPK-Bar-LDP-CPR-L6H-L6H-Thsp to construct plasmid PZPK-Thsp-CDH-LDP-Bar-LDP-CPR-L6H-L6H-Thsp.

[0121] E7.2 used (-)-limonene engineered strain SL2 as the starting strain. The plasmid PZPK-Thsp-CDH-LDP-Bar-LDP-CPR-L6H-L6H-Thsp was transformed into Agrobacterium by electroporation, and then introduced into the genome of strain SL2 by Agrobacterium-mediated transformation to obtain (-)-carvone engineered strain SE1.

[0122] Example 8: Production of (-)-limonene, (-)-carvacrol and (-)-carvacrol by fermentation of engineered strains in 50 mL centrifuge tubes

[0123] E8.1 The fermentation yield of engineered strains was tested in 50 mL centrifuge tubes. Single colonies of strains SL4, SC1, and SE1 were streaked onto plates. Three single colonies from each strain were selected as parallel samples and fermented using the aforementioned nitrogen-limiting medium (C / N ratio 8:1), with a 20% (v / v) isopropyl myristate cover layer added. Fermentation was carried out at 22°C and 180 rpm for 120 h. After fermentation, 1 mL of the organic phase was transferred to a 2 mL centrifuge tube, anhydrous sodium sulfate was added to remove water, and the mixture was then filtered through a 0.22 μm organic filter membrane before gas chromatography detection.

[0124] The GC and GC-MS detection results of the fermentation products of E8.2(-)-limonene engineered strain SL4 are as follows: Figure 4 As shown, Figure 4 Figure A in the table shows the gas chromatographic detection results of the fermentation products of the strain. Figure 4 Figure B shows the mass spectrometry identification results of the fermentation product of the strain and the (-)-limonene standard. The results show that the fermentation product of the engineered strain SL4 is (-)-limonene.

[0125] The GC and GC-MS detection results of the fermentation products of E8.3(-)-carvone engineered strain SC1 are as follows: Figure 5 As shown, Figure 5 Figure A in the table shows the gas chromatographic detection results of the fermentation products of the strain. Figure 5 Figure B in the diagram shows the mass spectrometry identification results of the fermentation products of the strain. Figure 5 In the study, the standard for carvacrol was a mixture of (-)-trans-carvacrol and cis-carvacrol, with the peak at 12.3 min being (-)-trans-carvacrol. The fermentation product of the engineered strain SC1 was (-)-trans-carvacrol, and it also contained (-)-limonene residue (peak at 6.8 min).

[0126] The GC and GC-MS detection results of the fermentation products of the E8.4(-)-carvone engineered strain SE1 are as follows: Figure 6 As shown, Figure 6 Figure A in the table shows the gas chromatographic detection results of the fermentation products of the strain. Figure 6Figure B in the diagram shows the mass spectrometry identification results of the fermentation products of the strain. Figure 6 It can be seen that the standard of (-)-carvone has a peak at 12.8 min. In the SE1 fermentation product, the peak at 12.8 min is (-)-carvone, the peak at 12.1 min is the residue of (-)-trans-carvone alcohol, and the peak at 6.8 min is the residue of (-)-limonene.

[0127] Gas chromatography analysis of E8.5 revealed that the yield of (-)-limonene engineered strain SL4 (-)-limonene was 155.5 mg / L, the yield of (-)-carvone engineered strain SC1 (-)-carvone was 119.8 mg / L, and the yield of (-)-carvone engineered strain SE1 (-)-carvone was 5.0 mg / L.

[0128] Example 9: Effect of carbon-nitrogen ratio on the fermentation production of (-)-limonene, (-)-carvone by engineered strains

[0129] E9.1 By adjusting the yeast extract or NH4Cl content in the nitrogen-limiting medium, the carbon-nitrogen ratio of the medium was set to 15 / 1, 30 / 1, 60 / 1, 120 / 1, and 240 / 1, respectively.

[0130] In E9.2, (-)-limonene engineered strain SL4, (-)-carvone engineered strain SC1, and (-)-carvone engineered strain SE1 were fermented in 250 mL shake flasks at five different C / N ratios as described in E9.1. SL4, SC1, and SE1 were activated on plates, and single colonies were picked and cultured into primary seed cultures in 50 mL centrifuge tubes. The initial OD was then used for further analysis. 600 =0.5% Transfer to a 250mL shake flask for fermentation. Ferment at 22℃ and 180rpm for 240h.

[0131] After fermentation of E9.3, the product content was extracted and tested according to Example 8. The yields of limonene, carvacrol, and carvacrol in each of the SL4, SC1, and SE1 treatments are shown in Table 1.

[0132] Table 1. Effects of C / N ratio on the yields of limonene, carvone, and carvacrol (mg / L)

[0133]

[0134] Example 10: Production of (-)-limonene, (-)-carvone and (-)-carvone from SL4, SC1 and SE1 in a 500 mL bioreactor

[0135] The high-yielding (-)-limonene strain SL4, the high-yielding (-)-carvone strain SC1, and the (-)-carvone-producing strain SE1 were fermented separately in a 500 mL bioreactor using a fed-batch method. SL4 and SC1 were activated on plates, and single colonies were picked and cultured into primary seed culture in 50 mL centrifuge tubes. These were then transferred to 250 mL shake flasks for secondary seed culture. The secondary seed culture was then cultured at the initial OD value. 600 =0.5g / L was inoculated into a 500mL bioreactor. The temperature was 28℃, pH 5.6, DO 5-40%, aeration rate 0.5vvm, and stirring speed 400-800rpm, linked to DO value. Feeding was performed when glucose consumption dropped below 5g / L. The yield of (-)-limonene engineered strain SL2 was the highest at 156h, reaching 608.5mg / L; the yield of (-)-carvone engineered strain SC1 was the highest at 240h, reaching 667.6mg / L; and the yield of (-)-carvone engineered strain SE1 was the highest at 240h, reaching 67.1mg / L.

[0136] This invention provides examples of *Rhodotorula circopilosa* as a chassis cell for the biosynthesis of (-)-limonene and its derivatives (-)-carvone and (-)-carvone. This invention utilizes *Rhodotorula circopilosa* as a chassis cell, modifies the source carbon metabolic flux of the mevalonate pathway, and constructs a universal platform strain that can promote the production of terpenoids. Using this strain as the starting strain, the biosynthetic pathway of (-)-limonene and its derivative (-)-carvone is introduced exogenously, and key genes of the biosynthetic pathway are overexpressed to enhance metabolic flux, thereby successfully constructing high-yielding engineered strains of (-)-limonene (SL2) and (-)-carvone (SC1), and obtaining engineered strain (-)-carvone (SE1). The method disclosed in this invention for biosynthesizing (-)-limonene, (-)-carvacrol, and (-)-carvacrol from the mevalonic acid source carbon metabolic flux of Rhodotorula buergerianum will provide a new reference for the efficient production of terpenoids by microorganisms and lay the foundation for the industrial production of (-)-limonene and its derivatives (-)-carvacrol and (-)-carvacrol.

[0137] It should be noted that the embodiments described above are only for explaining the present invention and do not constitute any limitation on the present invention. The present invention has been described with reference to typical embodiments, but it should be understood that the words used therein are descriptive and explanatory terms, not limiting terms. Modifications can be made to the present invention within the scope of the claims, and revisions can be made to the present invention without departing from the scope and spirit of the present invention. Although the present invention described herein relates to specific methods, materials, and embodiments, it does not mean that the present invention is limited to the specific examples disclosed herein; on the contrary, the present invention can be extended to all other methods and applications with the same function.

[0138] The embodiments described above are merely preferred embodiments for fully illustrating the present invention, and the scope of protection of the present invention is not limited thereto. Equivalent substitutions or modifications made by those skilled in the art based on the present invention are all within the scope of protection of the present invention. The scope of protection of the present invention is defined by the claims. The above descriptions are merely several embodiments of this application and are not intended to limit the present application in any way. Although the present application discloses preferred embodiments as above, it is not intended to limit the present application. Any modifications or alterations made by those skilled in the art using the disclosed technical content without departing from the scope of the technical solution of this application are equivalent to equivalent implementations and all fall within the scope of the technical solution.

Claims

1. A genetically engineered bacterium for producing (-)-limonene, (-)-carveol and / or (-)-carvone, characterized in that, The genetically engineered bacteria can synthesize (-)-limonene, (-)-carveol and / or (-)-carvone from scratch using glucose as raw material.

2. The genetically engineered bacteria producing (-)-limonene according to claim 1, characterized by:

1. Knocking out ATP-citrate lyase ACL, endogenous bifunctional enzyme phytoene synthase / phytoene cyclase CARYB and 2-acylglycerol o-acyltransferase gene DGAT gene and introducing "ACCT-RIDD-ACL-RIAD" complex; 2. Overexpressing endogenous key enzymes of mevalonate pathway ACC T, HMGR, IDI; 3. Introducing exogenous genes NphT7, EfMvaE, EfMvaS, MmMK; 4. Synthesizing geranyl pyrophosphate GPP or neryl pyrophosphate based on the mevalonate pathway, introducing exogenous (-)-limonene synthase gene (-)-LS or fusion gene of (-)-LS and endogenous FPPS mutant; wherein the NCBI accession numbers corresponding to the ACC T, HMGR, IDI and FPPS genes are XM_016416572.1, XM_016417713.1, XM_016418800.1 and XM_016415341.1 respectively; the FPPS mutant has mutations at positions 91, 122 and 192, and the phenylalanine at position 91 is mutated to tryptophan, the asparagine at position 122 is mutated to tryptophan, and the lysine at position 192 is mutated to glycine, and the amino acid sequence is shown in the sequence table SEQ ID NO. 1; the amino acid sequences of NphT7, EfMvaE, EfMvaS, MmMK and (-)-LS are shown in the sequence tables SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5 and SEQ ID NO. 6 respectively.

3. The genetically engineered bacteria for producing (-)-limonene and / or (-)-carveol according to claim 1, characterized by: The engineered bacteria take (-)-limonene synthesis strain as a chassis, and construct a carveol synthesis pathway by introducing limonene-6-hydroxylase gene L6H and cytochrome P450 reductase gene CPR, and overexpress key genes to enhance metabolic flow of the synthesis pathway, so as to improve the yield of (-)-carveol; the amino acid sequences of L6H and CPR are shown in the sequence tables SEQ ID NO. 7 and SEQ ID NO. 8 respectively.

4. The genetically engineered bacterium for producing (-)-carvone according to claim 1, wherein The engineered bacteria take (-)-carveol synthesis strain as a chassis, and construct a (-)-carvone biosynthesis pathway by introducing carveol dehydrogenase gene CDH; further, overexpressing key genes to enhance metabolic flow of the synthesis pathway, so as to improve the yield of (-)-carvone; the amino acid sequence of CDH is shown in the sequence table SEQ ID NO.

9.

5. The genetically engineered bacterium for producing (-)-limonene, (-)-carveol and / or (-)-carvone according to claim 1, characterized in that, The genetically engineered strain for de novo synthesis of (-)-carveol and (-)-carvone is Rhodotorula toruloides NP11.

6. The genetically engineered bacterium for producing (-)-limonene, (-)-carveol and / or (-)-carvone according to claim 1, characterized by, The (-)-limonene synthase (-)-LS is derived from but not limited to Mentha spicata; the cytochrome P450 limonene-6-hydroxylase (L6H) is derived from but not limited to Mentha x gracilis; the cytochrome P450 reductase (CPR) is derived from but not limited to Arabidopsis thaliana, and the carvyl dehydrogenase (CDH) is derived from but not limited to Rhodococcus erythropolis.

7. The genetically engineered bacteria for producing (-)-limonene, (-)-carveol and / or (-)-carvone according to claim 1, characterized by, The acetoacetyl-CoA synthase gene (NphT7) contained in the microbial de novo synthesis engineering strain of (-)-carveol and (-)-carvone is derived from Streptomyces sp.; the bifunctional enzyme acetoacetyl-CoA synthase / 3-hydroxy-3-methylglutaryl-CoA synthase reductase (Ef MavE) 3-hydroxy-3-methylglutaryl-CoA synthase (Ef MvaS) is derived from Enterococcus faecalis; the mevalonate kinase gene (MmMK) is derived from Methanosarcina mazei; the glycerol-3-phosphate dehydrogenase gene (GAPDH) is derived from Clostridium; and the other mevalonate genes are endogenous genes of Rhodotorula or corresponding gene mutants.

8. The genetically engineered bacteria for producing (-)-limonene, (-)-carveol, and (-)-carvone according to claim 1, characterized by, The engineering strain is Rhodotorula, which is one of Rhodotorula, including but not limited to R. toruloides, R. glutinis, R. acheniorum, R. graminis, R. marina, R. mucilaginosa, R. rubra, R. lactosa, R. sphaerocarpum, and R. bogoriensis.

9. Use according to claim 5, characterized in that, The application includes fermenting the engineering strain to produce (-)-limonene, (-)-carveol, and (-)-carvone using monosaccharide as the substrate.

10. Use according to claim 9, characterized in that, The engineering strain of (-)-limonene, (-)-carveol, and (-)-carvone is inoculated into a nitrogen-limited fermentation medium (NL) containing 20 g / L of initial sugar content; batch or fed-batch fermentation is used, and the required temperature is 18-32℃, the dissolved oxygen is 5-40%, the carbon-nitrogen ratio is 8 / 1 to 240 / 1, and the pH is 3.0-6.0.