Ultra-minimum inverted terminal repeat (ITR) sequences and uses thereof

By designing an ultra-minimal piggyBac ITR sequence and combining it with SPB transposase, the transposon structure was optimized, solving the problem of insufficient transposase integration and excision activity, and achieving more efficient gene delivery and disease treatment effects.

CN121368635APending Publication Date: 2026-01-20POSEIDA THERAPEUTICS INC
View PDF 12 Cites 0 Cited by

Patent Information

Application Number
CN202480034971.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2023-04-05
Filing Date
2024-04-04
Publication Date
2026-01-20

AI Technical Summary

Technical Problem

Existing ITR designs for transposases have failed to effectively improve their integration and excision activities, resulting in insufficient transposon delivery efficiency in the genome.

Method used

By employing the ultra-minimal piggyBac right-hand (RE) inverted terminal repeat (ITR) sequence and left-hand (LE) minimal ITR sequence, combined with transposases such as SPB or TAL-ssSPB PBx fusion proteins, the transposon structure was optimized to improve transposition frequency and stability.

Benefits of technology

It enhances the integration and excision activity of transposases in cells and improves the delivery efficiency of transposons in the genome, making it suitable for the treatment of various diseases such as cancer, liver disease, urea cycle disorders and hemophilia.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

The present disclosure relates generally to ultra-minimum transposon inverted repeat (ITR) polynucleotides, compositions comprising the polynucleotides, and methods of delivering nucleic acids to cells ex vivo and in vivo, particularly therapeutic genes in vivo, using the compositions comprising the polynucleotides to treat genetic disorders or diseases.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Cross-references to related applications

[0002] This application claims the benefit of U.S. Provisional Patent Application No. 63 / 494,300, filed April 5, 2023, which is incorporated herein by reference in its entirety.

[0003] References to sequence lists submitted electronically

[0004] This application contains a sequence list, which has been submitted in XML format via the Patent Center and is hereby incorporated in its entirety by reference. The XML copy created on March 19, 2024, is named “POTH-081_001WO_SeqList” and has a size of 101,935 bytes. Technical Field

[0005] This disclosure generally relates to ultraminimum transposon inverted repeat (ITR) polynucleotides, compositions containing polynucleotides, and methods for delivering nucleic acids to cells in vitro and in vivo using compositions containing polynucleotides, particularly for delivering therapeutic genes in vivo to treat genetic conditions or diseases. Background Technology

[0006] Transposases can be used to introduce non-endogenous DNA sequences into genomic DNA and have advantages over other gene editing methods in many ways. However, the need for improvements in transposon ITR design to enhance transposon integration and / or excision activity in vitro or in vivo remains unmet.

[0007] The piggyBac (PB) transposase contains two distinct DNA-binding domains that interact with the inverted terminal repeat (ITR) sequence of the transposon. The DNA-binding and dimerizing domain (DDBD) binds to the sequence near the TTAA site adjacent to the transposon, while the C-terminal cysteine-rich domain (CRD) binds to the sequence distal to the TTAA site. Upon dimerization, the DDBD binds symmetrically to the ITR, with the DDBD of one monomer binding to the left-hand (LE) ITR and the DDBD of the second monomer binding to the (RE) ITR. The two CRDs of the dimer bind asymmetrically, both to the LE ITR. Based on sequence homology, the RE ITR is predicted to contain two CRD binding sites, indicating that the second dimer of the PB transposase can bind distally to the first dimer. It is hypothesized that the proximal dimer catalyzes the transposition reaction, while the distal dimer stabilizes the hairpin structure that binds the LE and RE together, a prerequisite for transposition.

[0008] The DDBD and CRD of PB transposase bind to the ITRs in a sequence-specific manner. The LE ITR contains approximately 35 bp of DNA, while the RE ITR is approximately 63 bp in length. The DDBD interacts with about 10 bp of DNA located 6 bp from the TTAA sequence flanking the transposon. The binding of the DDBD is symmetrical with the DDBD of one transposase monomer bound to the LE ITR and the DDBD of a second monomer bound to the RE ITR. The CRD domain of the dimer binds to a 19 bp sequence of the LE ITR immediately distal to the DDBD binding site. The CRD binding is asymmetrical, with both CRD domains of the dimer interacting with the 19 bp sequence on the LE ITR. The RE ITR contains a second DDBD binding sequence followed by a 19 bp CRD binding sequence 34 bp from the TTAA, which is the potential second dimer PB transposase binding site.

[0009] In nature, the 5' untranslated region (UTR) and 3' UTR are directly adjacent to the LE and RE ITRs of the transposon, respectively, with the coding sequence for PB transposase collocated between the UTRs. The PB 5' UTR and 3' UTR are not required for transposition; however, the 5' UTR and 3' UTR, or at least a portion thereof, are often retained in recombinant transposon constructs used for DNA delivery, as they are believed to increase the rate of transposition by an un-described mechanism. Based on sequence homology, it is hypothesized that the 5' UTR contains sequences that share a reasonable degree of similarity to the PB transposase binding site.

[0010] In general, the LE ITR and 5' UTR together comprise 328 bp of DNA, while the RE ITR and 3' UTR together comprise 359 bp. In some transposon constructs, the 5' UTR end distal to the TTAA can be truncated, resulting in a LE ITR+5' UTR length of 309 bp. Similarly, the 3' UTR end distal to the TTAA has been truncated, resulting in a RE ITR+3' UTR length of 238 bp. The combined 309 bp LE ITR / 5' UTR and 238 bp RE ITR / 3' UTR are often referred to as "full ITRs."

[0011] The transposon ITR sequence in which the 5' UTR has been deleted (yielding a 35 bp LE ITR) and the ITR sequence in which the 3' UTR has been deleted (yielding a 63 bp RE ITR) are referred to as "minimal LE PB ITR" and "minimal RE ITR," respectively. Provided herein are such minimal ITRs. SUMMARY

[0012] In one aspect, provided herein is a polynucleotide encoding a transposon, the polynucleotide comprising a super-minimal piggyBac right end (RE) inverted terminal repeat sequence (ITR) and a left end (LE) minimal ITR sequence, wherein the super-minimal piggyBac RE ITR comprises the nucleic acid sequence set forth in any one of SEQ ID NOs: 3-9 and 46-67, and the LE ITR comprises the sequence of SEQ ID NO: 1. In some embodiments, the transposon is a piggyBac transposon or a piggyBac-like transposon.

[0013] In some embodiments, the polynucleotide further comprises at least one exogenous nucleic acid sequence. In some embodiments, the at least one exogenous nucleic acid sequence encodes a non-naturally occurring antigen receptor. In some embodiments, the at least one exogenous nucleic acid sequence encodes a therapeutic polypeptide. In some embodiments, the therapeutic polypeptide is a Factor VIII polypeptide, a Factor IX polypeptide, a phenylalanine hydroxylase (PAH), an ornithine transcarbamylase (OTC) polypeptide, or a methylmalonyl-CoA mutase (MUT1) polypeptide.

[0014] In some embodiments, the polynucleotide further comprises a promoter sequence. In some embodiments, the RE ITR is in reverse orientation and / or the LE ITR is in reverse orientation.

[0015] In another aspect, provided herein is a vector comprising a polynucleotide described herein.

[0016] In another aspect, provided herein is a cell comprising a polynucleotide provided herein.

[0017] In another aspect, provided herein is a pharmaceutical composition comprising a cell provided herein and a pharmaceutically acceptable carrier.

[0018] In another aspect, provided herein is a transposon comprising, in 5' to 3' order: (i) a left end (LE) inverted terminal repeat (ITR) sequence; (ii) a promoter; (iii) an exogenous nucleic acid sequence encoding a non-naturally occurring antigen receptor; and (iv) a reverse complement of a super minimal right end (RE) inverted terminal repeat (ITR) sequence.

[0019] In another aspect, provided herein is a transposon comprising, in 5' to 3' order: (i) a left end (LE) inverted terminal repeat (ITR) sequence; (ii) a promoter; (iii) an exogenous nucleic acid sequence encoding a therapeutic polypeptide; and (iv) a reverse complement of a super minimal right end (RE) inverted terminal repeat (ITR) sequence.

[0020] In another aspect, provided herein is a transposon comprising, in 5' to 3' order: (i) a right end (RE) inverted terminal repeat (ITR) sequence; (ii) a promoter; (iii) an exogenous nucleic acid sequence encoding a non-naturally occurring antigen receptor; and (iv) a reverse complement of a super minimal left end (LE) inverted terminal repeat (ITR) sequence.

[0021] In another aspect, provided herein is a transposon comprising, in 5' to 3' order: (i) a right end (RE) inverted terminal repeat (ITR) sequence; (ii) a promoter; (iii) an exogenous nucleic acid sequence encoding a therapeutic polypeptide; and (iv) a reverse complement of a super minimal left end (LE) inverted terminal repeat (ITR) sequence.

[0022] In some embodiments, the therapeutic polypeptide is a Factor VIII polypeptide, a Factor IX polypeptide, a phenylalanine hydroxylase (PAH), an ornithine transcarbamylase (OTC) polypeptide, or a methylmalonyl-CoA mutase (MUT1) polypeptide.

[0023] In another aspect, provided herein is a method of treating a disease or disorder in a subject in need thereof, the method comprising administering to the subject (i) at least one therapeutically effective dose of a vector described herein or a transposon described herein, and (ii) a transposase or a nucleic acid or nucleic acid sequence encoding a transposase. In some embodiments, the transposase is a SPB transposase, a TAL-ss-SPB PBx transposase fusion protein, or a ZNF-ssSPB transposase fusion protein.

[0024] In another aspect, provided herein is a method of treating a disease or disorder in a subject in need thereof, the method comprising administering to the subject at least one therapeutically effective dose of a cell described herein. In some embodiments, the disease or disorder is cancer, a liver disease or disorder, a urea cycle disorder, a metabolic liver disorder, or hemophilia.

[0025] All documents cited herein, including any cross-referenced or related patents or applications, are hereby incorporated by reference in their entirety, unless expressly excluded or otherwise limited. The citation of any document is not an admission that it is prior art with respect to any invention disclosed or claimed herein or that it alone, or along with any other DETAILED DESCRIPTION

[0026] Provided herein are super-minimal PB transposon inverted terminal repeat (ITR) sequences, in particular super-minimal PB transposon right end (RE) ITR polynucleotides, transposons comprising super-minimal PB ITR polynucleotides, and methods of use thereof. Minimal ITRs are believed to be advantageous because they increase the frequency of transposition. Without wishing to be bound by theory, it is believed that shorter sequences reduce the size of the transposon and plasmid, improving transposition. In addition, because the left and right ITRs are similar in sequence, super-minimal ITRs reduce the repetitiveness of the plasmid, which can improve the stability of the plasmid when it is produced.

[0027] Additionally, provided herein is a method of treating a disease or disorder in a subject in need thereof, the method comprising administering to the subject at least one therapeutically effective dose of a polynucleotide, transposon, vector, cell, or composition described herein. In some embodiments, the disease or disorder is cancer, a liver disease or disorder, a urea cycle disorder, a metabolic liver disorder, or hemophilia.

[0028] Transposition system

[0029] Transposase

[0030] Any suitable transposase can be used to introduce the ultraminimal transposon described herein into a cell. In some embodiments, the transposase is a piggyBac transposase. In some embodiments, the transposase is a super piggyBac (SPB) transposase. In some embodiments, a TAL-ssSPB PBx fusion protein is used, e.g., a TAL-ssPBx fusion protein comprising a TAL array targeting DNA sequences flanking upstream and downstream of a TTAA integration site fused to a piggyBac transposase (PBx) comprising an N-terminal deletion of amino acids 1-93 and further comprising four high-activity SPB mutations and a mutation that renders the transposase integration-deficient but retains normal excision activity.

[0031] The transposon of the present disclosure can be a piggyBac (PB) transposon. In certain aspects, the transposon comprises an ultraminimal transposon ITR. In some aspects, a nanotransposon is used to deliver the transposon to a cell. Nanotransposons are described, e.g., in International Patent Application Publication No. WO2020132396, which is incorporated by reference herein in its entirety as an example of a nanotransposon that can be used to deliver the transposon described herein to a cell.

[0032] In one aspect, provided herein is a polynucleotide encoding a transposon, the polynucleotide comprising an ultraminimal piggyBac right end (RE) inverted terminal repeat sequence (ITR) and a left end (LE) minimal ITR sequence.

[0033] As will be apparent to those skilled in the art, the RE ITR can be located 5' to the LE ITR or 3' to the LE ITR, so long as the 3' ITR sequence is the reverse complement of the 5' ITR sequence. Thus, in another aspect, provided herein is a transposon comprising, in 5' to 3' order: (i) a left end (LE) inverted terminal repeat (ITR) sequence; (ii) a promoter; (iii) an exogenous nucleic acid sequence encoding a therapeutic polypeptide or a non-naturally occurring antigen receptor; and (iv) a reverse complement of an ultraminimal right end (RE) inverted terminal repeat (ITR) sequence.

[0034] In another aspect, provided herein is a transposon comprising, in 5' to 3' order: (i) a right end (RE) inverted terminal repeat (ITR) sequence; (ii) a promoter; (iii) an exogenous nucleic acid sequence encoding a therapeutic polypeptide or a non-naturally occurring antigen receptor; and (iv) a reverse complement of an ultraminimal left end (LE) inverted terminal repeat (ITR) sequence.

[0035] In certain aspects, the ultraminimal transposon ITR is an ultraminimal piggyBac right end (RE) ITR provided herein. In some embodiments, the ultraminimal piggyBac RE ITR comprises the nucleic acid sequence set forth in any one of SEQ ID NOs: 3-9 or 46-67.

[0036] In some embodiments, the ultraminimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCA (SEQ ID NO: 9). In some embodiments, the ultraminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence set forth in SEQ ID NO: 9. In some embodiments, the ultraminimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCATA (SEQ ID NO: 8). In some embodiments, the ultraminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence set forth in SEQ ID NO: 8. In some embodiments, the ultraminimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCATATTGTG (SEQ ID NO: 7). In some embodiments, the ultraminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence set forth in SEQ ID NO: 7. In some embodiments, the ultraminimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGACGTA (SEQ ID NO: 6). In some embodiments, the ultraminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence set forth in SEQ ID NO: 6. In some embodiments, the ultraminimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGACGTACGTTA (SEQ ID NO: 5).In some embodiments, the ultraminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence set forth in SEQ ID NO: 5. In some embodiments, the ultraminimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGACGTACGTTAAAGAT (SEQ ID NO. 4). In some embodiments, the ultraminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence set forth in SEQ ID NO:4. In some embodiments, the ultraminimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGACGTACGTTAAAGATAATCA (SEQ ID NO. 3). In some embodiments, the ultraminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence set forth in SEQ ID NO:3.

[0037] In some embodiments, the ultraminimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATC (SEQ ID NO: 46). In some embodiments, the ultraminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence set forth in SEQ ID NO: 46.

[0038] In some embodiments, the ultraminimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCAT (SEQ ID NO: 47). In some embodiments, the ultraminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence set forth in SEQ ID NO: 47.

[0039] In some embodiments, the ultraminimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCATAT (SEQ ID NO: 48). In some embodiments, the ultraminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence set forth in SEQ ID NO: 48.

[0040] In some embodiments, the ultraminimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCATATT (SEQ ID NO: 49). In some embodiments, the ultraminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence set forth in SEQ ID NO: 49.

[0041] In some embodiments, the ultraminimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCATATTG (SEQ ID NO: 50). In some embodiments, the ultraminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence set forth in SEQ ID NO: 50.

[0042] In some embodiments, the ultraminimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCATATTGT (SEQ ID NO: 51). In some embodiments, the ultraminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence set forth in SEQ ID NO: 51.

[0043] In some embodiments, the ultraminimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGA (SEQ ID NO: 52). In some embodiments, the ultraminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence set forth in SEQ ID NO: 52.

[0044] In some embodiments, the ultraminimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGAC (SEQ ID NO: 53). In some embodiments, the ultraminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence set forth in SEQ ID NO: 53.

[0045] In some embodiments, the ultraminimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGACG (SEQ ID NO: 54). In some embodiments, the ultraminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence set forth in SEQ ID NO: 54.

[0046] In some embodiments, the ultraminimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGACGT (SEQ ID NO: 55). In some embodiments, the ultraminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence set forth in SEQ ID NO: 55.

[0047] In some embodiments, the ultraminimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGACGTAC (SEQ ID NO: 56). In some embodiments, the ultraminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence set forth in SEQ ID NO: 56.

[0048] In some embodiments, the ultraminimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGACGTACG (SEQ ID NO: 57). In some embodiments, the ultraminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence set forth in SEQ ID NO: 57.

[0049] In some embodiments, the ultraminimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGACGTACGT (SEQ ID NO: 58). In some embodiments, the ultraminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence set forth in SEQ ID NO: 58.

[0050] In some embodiments, the ultraminimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGACGTACGTT (SEQ ID NO: 59). In some embodiments, the ultraminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence set forth in SEQ ID NO: 59.

[0051] In some embodiments, the ultraminimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGACGTACGTTAA (SEQ ID NO: 60). In some embodiments, the ultraminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence set forth in SEQ ID NO: 60.

[0052] In some embodiments, the ultraminimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGACGTACGTTAAA (SEQ ID NO: 61). In some embodiments, the ultraminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence set forth in SEQ ID NO: 61.

[0053] In some embodiments, the ultraminimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGACGTACGTTAAAG (SEQ ID NO: 62). In some embodiments, the ultraminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence set forth in SEQ ID NO: 62.

[0054] In some embodiments, the ultraminimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGACGTACGTTAAAGA (SEQ ID NO: 63). In some embodiments, the ultraminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence set forth in SEQ ID NO: 63.

[0055] In some embodiments, the ultraminimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGACGTACGTTAAAGATA (SEQ ID NO: 64). In some embodiments, the ultraminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence set forth in SEQ ID NO: 64.

[0056] In some embodiments, the ultraminimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGACGTACGTTAAAGATAA (SEQ ID NO: 65). In some embodiments, the ultraminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence set forth in SEQ ID NO: 65.

[0057] In some embodiments, the super-minimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGACGTACGTTAAAGATAAT (SEQ ID NO: 66). In some embodiments, the super-minimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence set forth in SEQ ID NO: 66.

[0058] In some embodiments, the super-minimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGACGTACGTTAAAGATAATC (SEQ ID NO: 67). In some embodiments, the super-minimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence set forth in SEQ ID NO: 67.

[0059] In some embodiments, the transposon further comprises a piggyBac left end (LE) minimal ITR sequence comprising the nucleic acid sequence of SEQ ID NO: 1.

[0060] In some aspects, when the transposon is a PB transposon, the transposase is a piggyBac® (PB) transposase, a piggyBac-like (PBL) transposase, or a Super piggyBac® (SPB) transposase. Preferably, the sequence encoding the SPB transposase is an mRNA sequence.

[0061] Non-limiting examples of PB transposons and PB, PBL, and SPB transposases are described in detail in U.S. Patent No. 6,218,182; U.S. Patent No. 6,962,810; U.S. Patent No. 8,399,643; and PCT Publication No. WO 2010 / 099296, each of which is incorporated by reference herein in its entirety as examples of transposases that can be used in conjunction with the transposons described herein.

[0062] Without wishing to be bound by theory, it is believed that PB, PBL, and SPB transposases recognize transposon-specific inverted terminal repeat sequences (ITRs) on the ends of the transposon and then insert the nucleotide sequence located between the ITRs of the transposon at a target site. The target sequence of a PB or PBL transposon can comprise or consist of 5'-TTAT-3', 5'-TTAA-3', 5'-CTAA-3', 5'-TTAG-3', 5'-ATAA-3', 5'-TCAA-3', 5'AGTT-3', 5'-ATTA-3', 5'-GTTA-3', 5'-TTGA-3', 5'-TTTA-3', 5'-TTAC-3', 5'-ACTA-3', 5'-AGGG-3', 5'-CTAG-3', 5'-TGAA-3', 5'-AGGT-3', 5'-ATCA-3', 5'-CTCC-3', 5'-TAAA-3', 5'-TCTC-3', 5'TGAA-3', 5'-AAAT-3', 5'-AATC-3', 5'-ACAA-3', 5'-ACAT-3', 5'-ACTC-3', 5'-AGTG-3', 5'-ATAG-3', 5'-CAAA-3', 5'-CACA-3', 5'-CATA-3', 5'-CCAG-3', 5'-CCCA-3', 5'-CGTA-3', 5'-GTCC-3', 5'-TAAG-3', 5'-TCTA-3', 5'-TGAG-3', 5'-TGTT-3', 5'-TTCA-3' 5'-TTCT-3', or 5'-TTTT-3'. In some embodiments, the PB or PBL transposon system has no size limit for a gene of interest that can be included between the ITRs.

[0063] Exhibitive amino acid sequences of one or more PB, PBL, and SPB transposases are disclosed in U.S. Patent No. 6,218,185; U.S. Patent No. 6,962,810; and U.S. Patent No. 8,399,643, each of which is incorporated by reference herein in its entirety as examples of transposases that can be used in conjunction with the transposons described herein.

[0064] A PB or PBL transposase can comprise or consist of an amino acid sequence having an amino acid substitution at two or more positions, three or more positions, or each position of positions 30, 165, 226, 282, or 538 of the sequence of SEQ ID NO: 45 (wherein the amino acid at each position is as set forth in SEQ ID NO: 45), wherein the amino acid at each position is as set forth in SEQ ID NO: 45. 12 amino acid start numbering). In some embodiments, the amino acid substitution is a high activity amino acid substitution. The transposase can be a SPB transposase comprising or consisting of the amino acid sequence of the sequence of SEQ ID NO: 45 having one, two, three, or all of the high activity amino acid substitutions I30V, G165S, M226F, M282V, and N538K, wherein numbering starts at position 12 of SEQ ID NO: 45. In one aspect, the SPB transposase comprises an amino acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the amino acid sequence set forth in SEQ ID NO: 45. In some embodiments, the SPB transposase comprises the amino acid sequence set forth in SEQ ID NO: 45 having one, two, three, four, or five conservative amino acid substitutions. In some embodiments, the SPB transposase comprises the amino acid sequence set forth in SEQ ID NO: 45.

[0065] Formulations, dosages, and methods of administration

[0066] The present disclosure provides formulations, dosages, and methods of administration of the compositions and cells described herein. In one aspect, provided herein is a pharmaceutical composition comprising a tandem dimer transposase described herein and a pharmaceutically acceptable carrier. In another aspect, provided herein is a pharmaceutical composition comprising a modified cell described herein and a pharmaceutically acceptable carrier.

[0067] The disclosed compositions and pharmaceutical compositions can comprise at least one of any suitable adjuvant, such as but not limited to, diluents, binders, stabilizers, buffers, salts, lipophilic solvents, preservatives, adjuvants, and the like. Pharmaceutically acceptable adjuvants are preferred. Non-limiting examples of such sterile solutions and methods of preparation are well known in the art, such as but not limited to Gennaro, ed., Remington's Pharmaceutical Sciences, 18th Ed., Mack Publishing Co. (Easton, Pa.) 1990 and in the “Physician's Desk Reference”, 52nd Ed., Medical Economics (Montvale, N.J.) 1998. Pharmaceutically acceptable carriers suitable for the mode of administration, solubility, and / or stability of the protein scaffold, fragment, or variant compositions well known in the art or as described herein can be routinely selected.

[0068] Non-limiting examples of pharmaceutical excipients and additives suitable for use include proteins, peptides, amino acids, lipids, and carbohydrates (e.g., sugars, including monosaccharides, disaccharides, trisaccharides, tetrasaccharides, and oligosaccharides; derivatized sugars, such as sugar alcohols, aldonic acids, esterified sugars, and the like; and polysaccharides or sugar polymers), which can be present alone or in combination, alone or in combination comprising 1% to 99.99% by weight or volume. Non-limiting examples of protein excipients include serum albumin, such as human serum albumin (HSA), recombinant human albumin (rHA), gelatin, casein, and the like. Representative amino acid / protein components that can also be used for buffer capacity include alanine, glycine, arginine, betaine, histidine, glutamic acid, aspartic acid, cysteine, lysine, leucine, isoleucine, valine, methionine, phenylalanine, aspartame, and the like. One preferred amino acid is glycine.

[0069] Non-limiting examples of carbohydrate excipients suitable for use include monosaccharides, such as fructose, maltose, galactose, glucose, D-mannose, sorbose, and the like; disaccharides, such as lactose, sucrose, trehalose, cellobiose, and the like; polysaccharides, such as raffinose, melezitose, maltodextrin, dextran, starch, and the like; and sugar alcohols, such as mannitol, xylitol, maltitol, lactitol, xylitol sorbitol (glucitol), inositol, and the like. Preferably, the carbohydrate excipient is mannitol, trehalose, and / or raffinose.

[0070] The composition can also include a buffering agent or pH adjusting agent; typically, the buffering agent is a salt prepared from an organic acid or base. Representative buffering agents include organic acid salts, such as salts of citric acid, ascorbic acid, gluconic acid, carbonic acid, tartaric acid, succinic acid, acetic acid, or phthalic acid; tris-hydroxymethyl aminomethane, tromethamine hydrochloride, or phosphate buffers. A preferred buffering agent is an organic acid salt, such as a citrate salt.

[0071] In addition, the disclosed compositions can include polymeric excipients / additives, such as polyvinylpyrrolidone, sucralose (polymeric sugar), dextrates (e.g., cyclodextrins, such as 2-hydroxypropyl- -cyclodextrin), polyethylene glycol, flavoring agents, antimicrobial agents, sweetening agents, antioxidants, antistatic agents, surfactants (e.g., polysorbate, such as "TWEEN 20" and "TWEEN 80"), lipids (e.g., phospholipids, fatty acids), steroids (e.g., cholesterol), and chelating agents (e.g., EDTA).

[0072] A therapeutically effective amount of the compositions or pharmaceutical compositions disclosed herein can be administered using any of the many known and developing modes of administration. Non-limiting examples of modes of administration include bolus, buccal, infusion, intraarticular, intrabronchial, intraabdominal, intracapsular, intracartilaginous, intracavitary, intracelial, intracerebellar, intracerebroventricular, intracolic, intracervical, intragastric, intrahepatic, intralesional, intramuscular, intramyocardial, intranasal, intraocular, intraosseous, intrapelvic, intraperitoneal, intrapleural, intraprostatic, intrapulmonary, intrarectal, intrarenal, intraretinal, intraspinal, intrasynovial, intrathoracic, intrauterine, intratumoral, intravenous, intravesical, oral, parenteral, rectal, sublingual, subcutaneous, transdermal, or vaginal. In preferred embodiments, the compositions comprising the modified cells described herein are administered intravenously, e.g., by intravenous infusion.

[0073] The compositions of the present disclosure can be prepared for parenteral (subcutaneous, intramuscular or intravenous) or any other administration, particularly in the form of a liquid solution or suspension. For parenteral administration, the compositions disclosed herein can be formulated in a solution, suspension, emulsion, granule, powder, or lyophilized powder with a pharmaceutically acceptable parenteral vehicle.

[0074] Formulations for parenteral administration can contain as a common excipient sterile water or saline, polyalkylene glycols such as polyethylene glycol, vegetable source oils, hydrogenated naphthalenes, and the like. Aqueous or oil suspensions can be prepared in accordance with known methods using suitable binders or wetting agents and suspending agents. Injectables or infusables can be diluents which are non-toxic, non- orally administered, such as aqueous solutions, sterile injectable solutions or suspensions in solvents.

[0075] As a carrier or solvent that can be used, water, Ringer's solution, isotonic saline and the like can be used; as a general solvent or suspending solvent, sterile non-volatile oil can be used. For these purposes, any kind of non-volatile oil and fatty acid, including natural or synthetic or semi-synthetic fatty oil or fatty acid, can be used; natural or synthetic or semi-synthetic monoglyceride or diglyceride or triglyceride. Parenteral administration is known in the art and includes, but is not limited to, conventional injection modes, a pneumatic needleless injection device as described in U.S. Patent No. 5,851,198, and a laser perforation device as described in U.S. Patent No. 5,839,446.

[0076] It can be desirable to deliver the disclosed compounds to a subject over an extended period of time (e.g., by a single administration lasting a period of one week to one year). Various slow release, depot, or implant dosage forms can be utilized. For example, the dosage form can contain a pharmaceutically non-toxic salt of the compound having low solubility in body fluids, for example, (a) acid addition salts with polyprotic acids such as phosphoric, sulfuric, citric, tartaric, tannic, pamoic, alginic, polyglutamic, naphthalene monosulfonic or disulfonic acids, polygalacturic acid, etc.; (b) salts with polyvalent metal cations such as zinc, calcium, bismuth, barium, magnesium, aluminum, copper, cobalt, nickel, cadmium, etc., or with organic cations formed, e.g., from N,N'-dibenzyl-ethylenediamine or ethylenediamine; or (c) combinations of (a) and (b), such as tannic acid zinc salt. In addition, the disclosed compounds or preferably relatively insoluble salts, such as those just described, can be formulated in a gel suitable for injection, for example, an aluminum monostearate gel with, e.g., sesame oil. Particularly preferred salts are zinc salts, tannic acid zinc salts, embonate salts, etc.

[0077] Another type of slow release, depot formulation for injection will contain the compound or salt dispersed for encapsulation in a slowly degrading, non-toxic, non-antigenic polymer, for example, a polylactic / polyglycolic polymer as described in U.S. Patent No. 3,773,919. The compound or preferably relatively insoluble salt, such as those described above, can also be formulated in a cholesterolic matrix silicone rubber pellet, particularly for use in animals. Additional slow release, depot, or implant formulations, for example, gaseous or liquid liposomes, are known in the literature (U.S. Patent No. 5,770,222 and "Sustained and Controlled Release Drug Delivery Systems", J. R. Robinson, Ed., Marcel Dekker, Inc., N.Y., 1978).

[0078] Methods of treatment

[0079] The present disclosure provides the use of the disclosed compositions or pharmaceutical compositions for treating a disease or disorder in a cell, tissue, organ, animal, or subject, as known in the art or as described herein, using the disclosed compositions and pharmaceutical compositions, e.g., administering or contacting a cell, tissue, organ, animal, or subject with a therapeutically effective amount of the composition or pharmaceutical composition. In one aspect, the subject is a mammal. Preferably, the subject is a human. The terms "subject" and "patient" are used interchangeably herein.

[0080] In some aspects, the treatment of a disease or disorder comprises adoptive cell therapy. For example, in an aspect, the present disclosure provides modified cells expressing a chimeric antigen receptor (CAR). The transposons described herein can be used to generate such modified cells. The modified cells can be allogeneic or autologous to the patient. In some preferred embodiments, the modified cells are allogeneic cells. In some embodiments, the modified cells are autologous T cells or modified autologous CAR T cells. In some preferred embodiments, the modified cells are allogeneic T cells or modified allogeneic CAR T cells.

[0081] In some embodiments, the disease or disorder treated according to the methods described herein is a cancer. Non-limiting examples of cancers include leukemia, acute leukemia, acute lymphoblastic leukemia (ALL), acute lymphocytic leukemia, B-cell, T-cell, or FAB ALL, acute myeloid leukemia (AML), acute myelogenous leukemia, chronic myelocytic leukemia (CML), chronic lymphocytic leukemia (CLL), hairy cell leukemia, myelodysplastic syndrome (MDS), lymphoma, Hodgkin’s disease, malignant lymphoma, non-Hodgkin’s lymphoma, Burkitt’s lymphoma, multiple myeloma, Kaposi’s sarcoma, colorectal cancer, pancreatic cancer, nasopharyngeal carcinoma, histiocytosis, paraneoplastic syndrome / hypercalcemia of malignancy, solid tumors, bladder cancer, breast cancer, colorectal cancer, endometrial cancer, head cancer, neck cancer, hereditary nonpolyposis cancer, Hodgkin’s lymphoma, liver cancer, lung cancer, non-small cell lung cancer, ovarian cancer, pancreatic cancer, prostate cancer, renal cell carcinoma, testicular cancer, adenocarcinoma, sarcoma, malignant melanoma, hemangioma, metastatic disease, cancer-related bone resorption, cancer-related bone pain, and the like.

[0082] In another non-limiting example, the present disclosure provides methods of treating a metabolic liver disorder in a subject, the methods comprising administering to the subject: a) at least one therapeutically effective amount of at least one composition comprising a transposon of the present disclosure comprising a sequence encoding a therapeutic polypeptide; and b) at least one therapeutically effective amount of a composition comprising a nucleic acid sequence encoding at least one transposase. In some aspects, the metabolic liver disorder can be ornithine transcarbamylase (OTC) deficiency, and the at least one therapeutic protein can comprise an ornithine transcarbamylase (OTC) polypeptide. In some aspects, the metabolic liver disorder can be methylmalonic acidemia (MMA), and the at least one therapeutic protein can comprise a methylmalonyl-CoA mutase (MUT1) polypeptide.

[0083] In non-limiting examples, the present disclosure provides methods of treating hemophilia in a subject, the methods comprising administering to the subject: at least one therapeutically effective amount of at least one composition comprising a transposon of the present disclosure comprising a sequence encoding a therapeutic polypeptide; and b) at least one therapeutically effective amount of a composition comprising a nucleic acid sequence encoding at least one transposase. In some aspects, the hemophilia can be hemophilia A and the at least one therapeutic protein can comprise Factor VIII. In some aspects, the hemophilia can be hemophilia B and the at least one therapeutic protein can comprise Factor IX.

[0084] In non-limiting examples, the present disclosure provides methods of treating phenylketonuria (PKU) in a subject, the methods comprising administering to the subject: at least one therapeutically effective amount of at least one composition comprising a transposon of the present disclosure comprising a sequence encoding a phenylalanine hydroxylase gene; and b) at least one therapeutically effective amount of a composition comprising a nucleic acid sequence encoding at least one transposase.

[0085] In non-limiting examples, the present disclosure provides methods of treating a disease or disorder in a subject by administering to the subject in need thereof a therapeutically effective amount of an LNP composition comprising a DNA transposon encoding a therapeutic protein comprising a super minimal ITR and an mRNA encoding a piggyBac transposase. In some embodiments, the disease or disorder is a cancer, a liver disease or disorder, a urea cycle disorder, a metabolic liver disorder, or hemophilia.

[0086] In non-limiting examples, the present disclosure provides methods of treating a disease or condition in a subject by administering to the subject in need thereof a therapeutically effective amount of a first LNP composition comprising a DNA transposon encoding a therapeutic protein comprising a super minimal ITR and a second LNP composition comprising an mRNA encoding a piggyBac transposase. In some embodiments, the disease or condition is a cancer, a liver disease or condition, a urea cycle disorder, a metabolic liver condition, or a hemophilia. In some embodiments, the disease or condition is an autoimmune disease. In one embodiment, the autoimmune disease is autoimmune neutropenia, Guillain-Barre syndrome, epilepsy, autoimmune encephalitis, Isaacs' syndrome, nevus syndrome, pemphigus vulgaris, deciduous pemphigus, bullous pemphigoid, acquired epidermolysis bullosa, gestational pemphigoid, mucous membrane pemphigoid, antiphospholipid syndrome, autoimmune anemia, myasthenia gravis, autoimmune Graves' disease, thyroid eye disease (TED), Goodpasture syndrome, multiple sclerosis, rheumatoid arthritis, lupus, idiopathic thrombocytopenic purpura (ITP), warm autoimmune hemolytic anemia (WAIHA), chronic inflammatory demyelinating polyneuropathy (CIDP), lupus nephritis, or membranous nephropathy.

[0087] The dosage of the pharmaceutical composition to be administered to a subject can vary according to known factors such as the pharmacodynamic characteristics of the particular agent and its mode and route of administration; the age, health, and weight of the recipient; the nature and extent of the symptoms; the kind of concurrent treatment, the frequency and effect of the treatment, and the effects desired. In some embodiments, the pharmaceutical composition is administered to a subject in need thereof in an amount effective to treat a disease or condition.

[0088] In aspects where the composition to be administered to a subject in need thereof is a modified cell as disclosed herein, about 1 x 105to about 1 x 1011modified cells can be administered. In some embodiments, about 1 x 105to about 1 x 1010modified cells can be administered. In some embodiments, about 1 x 106to about 1 x 109modified cells can be administered. In some embodiments, about 1 x 107to about 1 x 108modified cells can be administered. In some embodiments, about 1 x 107modified cells can be administered. In some embodiments, about 1 x 108modified cells can be administered. In some embodiments, about 1 x 109modified cells can be administered. In some embodiments, about 1 x 1010modified cells can be administered. In some embodiments, about 1 x 1011modified cells can be administered.3 between about 1 x 10 4 between about 1 x 10 4 between about 1 x 10 5 between about 1 x 10 5 between about 1 x 10 6 between about 1 x 10 6 between about 1 x 10 7 between about 1 x 10 7 between about 1 x 10 8 between about 1 x 10 8 between about 1 x 10 9 between about 1 x 10 9 between about 1 x 10 10 between about 1 x 10 10 between about 1 x 10 11 between about 1 x 10 11 between about 1 x 10 12 between about 1 x 10 12 between about 1 x 10 13 between about 1 x 10 13 between about 1 x 10 14 between about 1 x 10 14 between about 1 x 10 15 between about 1 x 10 15 between about 1 x 10 16 between about 1 x 10 16 between about 1 x 10 17 between about 1 x 10 17 between about 1 x 10 18 between about 1 x 10 18 between about 1 x 10 19 between about 1 x 10 19 between about 1 x 10 20 between about 5 x 10 6 between about 25 x 10 6 cells. In some embodiments, the cells are administered at a dose between about 5 x 10

[0089] In other embodiments, the cell dose can depend on the weight of the human, for example, about 1 x 10 3 between about 1 x 10 4 between about 1 x 10 4 between about 1 x 10 5Between cells; approximately 1x10 5 With approximately 1x10 6 Between cells; approximately 1x10 6 With approximately 1x10 7 Between cells; approximately 1x10 7 With approximately 1x10 8 Between cells; approximately 1x10 8 With approximately 1x10 9 Between cells; approximately 1x10 9 With approximately 1x10 10 Between cells, approximately 1x10 10 With approximately 1x10 11 Between cells, approximately 1x10 11 With approximately 1x10 12 Between cells, approximately 1x10 12 With approximately 1x10 13 Between cells, approximately 1x10 13 With approximately 1x10 14 Between cells, approximately 1x10 14 With approximately 1x10 15 Between cells, approximately 1x10 15 With approximately 1x10 16 Between cells, approximately 1x10 16 With approximately 1x10 17 Between cells, approximately 1x10 17 With approximately 1x10 18 Between cells, approximately 1x10 18 With approximately 1x10 19 Between cells; or approximately 1 x 10 19 With approximately 1x10 20 Between individual cells.

[0090] A more detailed description of the disclosed compositions and pharmaceutical compositions, their pharmaceutical excipients, formulations, dosages, and methods of administration is disclosed in PCT Publication No. WO 2019 / 049816, which is incorporated herein by reference in its entirety.

[0091] Reagent test kit

[0092] In another aspect, provided herein is a kit comprising a cell line that has been engineered to comprise a modified target site of a SPB or PBx provided herein within its genome, preferably in a highly expressed genomic region. The kit can further comprise a composition comprising one or more super minimal PB transposon inverted terminal repeat (ITR) sequences described herein. In some embodiments, the cell line is a T cell line.

[0093] Definitions

[0094] As used throughout this disclosure, the singular forms "a," "and," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a method" includes a plurality of such methods, and reference to "a dose" includes reference to one or more doses and equivalents thereof known to those skilled in the art, and so forth.

[0095] The term "about" or "approximately" means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, e.g., the limitations of the measurement system. For example, "about" can mean within 1 or more than 1 standard deviation, per the measurement system in use. Alternatively, "about" can mean ranges within 20% or less, or within 10% or less, or within 5% or less, or within 1% of a given value.

[0096] Alternatively, especially with respect to biological systems or processes, the term can mean within an order of magnitude, preferably within 5-fold and more preferably within 2-fold of a certain value. Where particular values described in the application and claims are preceded by the term "about," it is understood that the term "about" refers to an acceptable error range within the particular value, unless otherwise indicated.

[0097] The present disclosure provides isolated or substantially purified polynucleotide or protein compositions. An "isolated" or "purified" polynucleotide or protein, or biologically active portion thereof, is substantially or essentially free of components of the environment as can be found in nature. Thus, when produced by recombinant techniques, an isolated or purified polynucleotide or protein is substantially free of cellular material or culture medium, or when produced by chemical synthesis, is substantially free of chemical precursors or other chemicals. Optimally, an "isolated" polynucleotide is free of sequences (optimally protein encoding sequences) that naturally flank the polynucleotide in the genomic DNA of the organism from which the polynucleotide is derived (i.e., sequences located at the 5' and 3' ends of the polynucleotide). For example, in various aspects, an isolated polynucleotide can contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, or 0.1 kb of nucleotide sequence that naturally flank the polynucleotide in the genomic DNA of the cell from which the polynucleotide is derived. Proteins that are substantially free of cellular material include preparations of protein having less than about 30%, 20%, 10%, 5%, or 1% (by dry weight) of contaminating protein. When a protein of the disclosure, or biologically active portion thereof, is produced recombinantly, optimally, the culture medium represents less than about 30%, 20%, 10%, 5%, or 1% (by dry weight) of chemical precursors or chemical species other than the protein of interest.

[0098] The present disclosure provides fragments and variants of the disclosed DNA sequences and proteins encoded by these DNA sequences. As used throughout the present disclosure, the term "fragment" refers to a portion of a DNA sequence or a portion of an amino acid sequence, and thus to a portion of a protein encoded thereby. A fragment of a DNA sequence comprising a coding sequence can encode a protein fragment that retains the biological activity of the native protein, and thus retains the DNA recognition or binding activity for a target DNA sequence as described herein. Alternatively, a fragment of a DNA sequence that is useful as a hybridization probe does not generally encode a protein that retains biological activity or does not retain promoter activity. Thus, a fragment of a DNA sequence can range from at least about 20 nucleotides, about 50 nucleotides, about 100 nucleotides, and up to the full length polynucleotide of the present disclosure.

[0099] Nucleic acids or proteins of the present disclosure can be constructed by a modular approach that includes pre-assembly of monomer units and / or repeat units in a target vector, which can then be assembled into the final target vector. Polypeptides of the present disclosure can comprise repeat monomers of the present disclosure and can be constructed by a modular approach by pre-assembly of repeat units in a target vector, which can then be assembled into the final target vector. The present disclosure provides polypeptides produced by this approach as well as nucleic acid sequences encoding these polypeptides. The present disclosure provides host organisms and cells comprising nucleic acid sequences encoding polypeptides produced by this modular approach.

[0100] The term "comprising" is intended to mean that the compositions and methods include the recited elements, but not excluding others. "Consisting essentially of" when used to define compositions and methods, shall mean excluding other elements of any essential significance to the composition and method. Thus, a composition consisting essentially of the elements as defined herein, does not exclude trace contaminants or inert carriers.

[0101] "Consisting of means excluding more than trace elements of other ingredients and substantial method steps. Aspects defined by each of these transition terms are within the scope of the present disclosure.

[0102] As used herein "expression" refers to the process by which polynucleotides are transcribed into mRNA and / or the process by which the transcribed mRNA is subsequently translated into peptides, polypeptides, or proteins. If the polynucleotide is derived from genomic DNA, expression can include splicing of the mRNA in a eukaryotic cell.

[0103] "Gene expression" refers to the conversion of the information contained in a gene into a gene product. A gene product can be the direct transcriptional product of a gene (e.g., mRNA, tRNA, rRNA, antisense RNA, ribozyme, shRNA, microRNA, structural RNA, or any other type of RNA) or a protein produced by translation of mRNA. Gene products also include RNAs modified by processes such as capping, polyadenylation, methylation, and editing, as well as proteins modified by, for example, methylation, acetylation, phosphorylation, ubiquitination, ADP- ribosylation, myristoylation, and glycosylation.

[0104] Non-covalently linked components and methods of making and using non-covalently linked components are disclosed. Various components can take various different forms as described herein. For example, non-covalently linked (i.e., operably linked) proteins can be used to achieve transient interactions to avoid one or more problems in the art. The ability of non-covalently linked components, such as proteins, to associate and dissociate allows for functional association only or primarily when such association is needed to achieve a desired activity. The linkage can be sustained for a time sufficient to achieve a desired effect.

[0105] A method of directing a protein to a specific locus in a genome of an organism is disclosed. The method can include the steps of providing a DNA localization component and providing an effector molecule, wherein the DNA localization component and the effector molecule are operably linked via a non-covalent bond.

[0106] A "target site" or "target sequence" is a nucleic acid sequence defining the portion of a nucleic acid to which a binding molecule will bind, provided that sufficient binding conditions are present.

[0107] The term "nucleic acid" or "oligonucleotide" or "polynucleotide" refers to at least two nucleotides covalently linked together. Depiction of a single strand also defines the sequence of the complementary strand. Thus, a nucleic acid can also encompass the complementary strand of a depicted single strand. Nucleic acids of the disclosure also encompass substantially identical nucleic acids that retain the same structure or encode the same protein, and their complements.

[0108] Nucleic acids of the disclosure can be single-stranded or double-stranded. Nucleic acids of the disclosure can contain double-stranded sequences even if a majority of the molecule is single-stranded. Nucleic acids of the disclosure can contain single-stranded sequences even if a majority of the molecule is double-stranded. Nucleic acids of the disclosure can include genomic DNA, cDNA, RNA, or hybrids thereof. Nucleic acids of the disclosure can contain combinations of deoxyribonucleotides and ribonucleotides. Nucleic acids of the disclosure can contain combinations of bases including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine, hypoxanthine, isocytosine, and isoguanine. Nucleic acids of the disclosure can be synthesized to contain non-natural amino acid modifications. Nucleic acids of the disclosure can be obtained by chemical synthesis methods or by recombinant methods.

[0109] Nucleic acids of the disclosure, whether the entire sequence thereof or any portion thereof, can be non-naturally occurring. Nucleic acids of the disclosure can contain one or more non-naturally occurring mutations, substitutions, deletions, or insertions such that the entire nucleic acid sequence is non-naturally occurring. Nucleic acids of the disclosure can contain one or more repeated, inverted, or repeated sequences such that the resulting sequence is not naturally occurring, such that the entire nucleic acid sequence is non-naturally occurring. Nucleic acids of the disclosure can contain non-naturally occurring modified, artificial, or synthetic nucleotides such that the entire nucleic acid sequence is non-naturally occurring.

[0110] Due to the redundancy of the genetic code, multiple nucleotide sequences can encode any particular protein. All such nucleotide sequences are contemplated herein.

[0111] As used throughout this disclosure, the term "operably linked" means that the expression of a gene is under the control of a promoter spatially connected thereto. The promoter can be positioned 5' (upstream) or 3' (downstream) of the gene under its control. The distance between the promoter and the gene can be approximately the same as the distance between the promoter and the gene from which it is derived (the gene that the promoter is controlling). Variations in the distance between the promoter and the gene can be accommodated without loss of promoter function.

[0112] As used throughout this disclosure, the term "promoter" means a synthetic or naturally derived molecule capable of conferring, activating, or enhancing expression of a nucleic acid in a cell. The promoter can include one or more specific transcriptional regulatory sequences to further enhance expression and / or alter its spatial expression and / or temporal expression. The promoter can also include distal enhancer or suppressor elements, which can be located thousands of base pairs from the transcriptional start site. The promoter can be derived from sources including viruses, bacteria, fungi, plants, insects, and animals. The promoter can constitutively or differentially regulate expression of the genomic component in terms of the cell, tissue, or organ in which expression occurs, or in terms of the developmental stage at which expression occurs, or in response to external stimuli such as physiological stress, pathogens, metal ions, or inducers. Representative examples of promoters include the bacteriophage T7 promoter, the bacteriophage T3 promoter, the SP6 promoter, the lac operator promoter, the tac promoter, the SV40 late promoter, the SV40 early promoter, the RSV-LTR promoter, the CMV IE promoter, the EF-1 alpha promoter, the CAG promoter, the SV40 early promoter, or the SV40 late promoter and the CMV IE promoter.

[0113] As used throughout this disclosure, the term "vector" means a nucleic acid sequence containing an origin of replication. The vector can be a viral vector, a bacteriophage, a bacterial artificial chromosome, or a yeast artificial chromosome. The vector can be a DNA or RNA vector. The vector can be a self-replicating extrachromosomal vector, and is preferably a DNA plasmid. The vector can include a combination of amino acid and DNA sequences, RNA sequences, or both DNA and RNA sequences.

[0114] Conservative substitutions of amino acids, i.e., substitutions that do not generate significantly different properties for the molecule, are recognized in the art as typical of conservative changes. Such conservative changes can be made in the polynucleotides encoding the polypeptides of the present disclosure. As is understood in the art, such conservative changes can be identified by considering the hydropathicity indexes of amino acids. Kyte et al., J. Mol. Biol. 157: 105-132 (1982). The hydropathicity index of an amino acid is based on considerations of its hydrophobicity and charge. Amino acids with similar hydropathicity indexes can be substituted and still retain protein function. In one aspect, amino acids with a hydropathicity index of ±2 are substituted. The hydropathicity of amino acids can also be used to reveal substitutions that will result in a protein that retains biological function. Considering the hydropathicity of amino acids in the context of a peptide allows for the calculation of the maximum local average hydropathicity of the peptide, a useful measure that has been reported to have a good correlation with antigenicity and immunogenicity. U.S. Patent No. 4,554,101, which is incorporated by reference herein in its entirety.

[0115] Substitution of amino acids with similar hydropathic values can result in peptides retaining biological activity, e.g., immunogenicity. Substitutions can be made with amino acids having hydropathic values within ±2 of each other. Both the hydropathic index and the hydrophilicity values of amino acids are influenced by the particular side chain of the amino acid. Consistent with this observation, amino acid substitutions that are compatible with biological function are understood to depend on the relative similarity of the amino acids, and particularly the side chains of those amino acids, as revealed by the hydrophobicity, hydrophilicity, charge, size, and other properties.

[0116] As used herein, “conservative” amino acid substitutions can be defined as set forth in Table 1, Table 2, or Table 3. In some aspects, the conservative substitutions have been introduced by modifying the polynucleotides encoding the polypeptides of the present disclosure. Amino acids can be categorized according to physical properties and contributions to secondary and tertiary protein structure. A conservative substitution is the replacement of one amino acid with another amino acid having similar properties. Exemplary conservative substitutions are set forth in Table 1.

[0117] Table 1: Conservative Substitutions I

[0118]

[0119] Alternatively, conservative amino acids can be in accordance with Lehninger’s description (Biochemistry, Second Edition; Worth Publishers, Inc. NY, N.Y. (1975), pp. 71-77), as set forth in Table 2.

[0120] Table 2: Conservative Substitutions II

[0121]

[0122] Alternatively, the display conservative substitutions are listed in Table 3.

[0123] Table 3: Conservative Substitutions III

[0124]

[0125] The polypeptides and proteins of the present disclosure, whether the entire sequence thereof or any portion thereof, can be non-naturally occurring. The polypeptides and proteins of the present disclosure can contain one or more non-naturally occurring mutations, substitutions, deletions, or insertions such that the entire amino acid sequence is non-naturally occurring. The polypeptides and proteins of the present disclosure can contain one or more repeated, inverted, or repeated sequences such that the resulting sequence is not naturally occurring, such that the entire amino acid sequence is non-naturally occurring. The polypeptides and proteins of the present disclosure can contain non-naturally occurring modified, artificial, or synthetic amino acids such that the entire amino acid sequence is non-naturally occurring.

[0126] As used throughout the present disclosure, the identity between two sequences can be determined by using the standalone executable BLAST engine program (bl2seq) for blasting two sequences using default parameters, which is available from the National Center for Biotechnology Information (NCBI) ftp site (Tatusova and Madden, FEMS Microbiol Lett., 1999, 174, 247-250; which is incorporated by reference herein in its entirety).

[0127] When the terms "identical" or "identity" are used in the context of two or more nucleic acid or polypeptide sequences, it is recognized that the specified percentage of residues that are identical is determined by comparing the sequences over a specified region. In some embodiments, sequence identity is determined over the entire length of the sequences. The percentage of identity is calculated by optimally aligning the two sequences, comparing the identical residues over the specified region, determining the number of positions at which the residues are identical, dividing the number of identical positions by the total number of positions in the specified region, and multiplying the result by 100 to yield the percentage of sequence identity. In cases where the two sequences have different lengths or the alignment produces one or more staggered ends and the specified comparison region includes only a single sequence, the residues of the single sequence are included in the denominator of the calculation but not in the numerator. When comparing DNA and RNA, thymine (T) and uracil (U) can be considered equivalent. Identity determinations can be performed manually or using computer sequence algorithms such as BLAST or BLAST 2.0.

[0128] In certain embodiments, if a sequence has a certain sequence identity (e.g., 75%, 80%, 85%, 90%, 95%, 98%, or 99%) to a certain SEQ ID NO, the sequence has the same length as the sequence of the SEQ ID NO. In certain embodiments, if a sequence has a certain sequence identity (e.g., 75%, 80%, 85%, 90%, 95%, 98%, or 99%) to a certain SEQ ID NO, the sequence differs from the sequence of the SEQ ID NO only by conservative amino acid substitutions.

[0129] As used throughout this disclosure, the term "endogenous" refers to a nucleic acid or protein sequence that is naturally associated with a target gene or host cell into which the target gene is introduced.

[0130] As used throughout this disclosure, the term "exogenous" refers to a nucleic acid or protein sequence that is not naturally associated with a target gene or host cell into which the target gene is introduced, including non-naturally occurring multiple copies of a naturally occurring nucleic acid, e.g., a DNA sequence, or a naturally occurring nucleic acid sequence located at a non-naturally occurring genomic location.

[0131] The present disclosure provides methods of introducing a polynucleotide construct comprising a DNA sequence into a host cell. By "introducing" is intended to present the polynucleotide construct to the cell in a manner that the construct is able to enter the interior of a host cell. The methods of the present disclosure do not depend on the particular method used to introduce the polynucleotide construct into the host cell, so long as the polynucleotide construct is able to enter the interior of one of the cells of the host. Methods for introducing polynucleotide constructs into bacteria, plants, fungi, and animals are known in the art, including but not limited to stable transformation methods, transient transformation methods, and virus-mediated methods.

[0132] Examples

[0133] The examples in this section are provided for demonstration and are not intended to limit the invention.

[0134] Example 1: Construction of super-minimal PiggyBac inverted terminal repeat polynucleotides

[0135] A set of truncated super-minimal PBRE ITR polynucleotides of the 63bp minimal right end (RE) ITR of piggyBac (SEQ ID NO: 2) were constructed by sequentially deleting the 3’ end of the minimal RE ITR sequence to produce super-minimal piggyBac RE ITR variants. The super-minimal RE ITR variants comprise the first 17bp, 19bp, 24bp, 29bp, 34bp, 39bp, or 44bp of the 63bp minimal RE ITR sequence set forth in SEQ ID NO: 2, resulting in the nucleic acid sequences of SEQ ID NOs: 3-9, respectively.

[0136] Briefly, nucleic acids encoding super-minimal RE ITR variants were synthesized, purified, and used to produce transposons comprising the super-minimal RE ITR variants.

[0137] Example 2: Effect of super-minimal PBRE ITR polynucleotide length on Super PiggyBac (SPB) transposase excision activity

[0138] The super-minimal PB ITR polynucleotides prepared in Example 1 were initially tested using a luciferase transposon excision reporter. Briefly, the excision reporter contains a PGK promoter (SEQ ID NO: 10), followed by a disrupted nanoLuc luciferase coding sequence, followed by an SV40 late polyadenylation signal sequence (SEQ ID NO: 11). The nanoLuc sequence is disrupted at TTAA, such that the 5’ end of nanoLuc (SEQ ID NO: 12) is separated from the 3’ end of nanoLuc (SEQ ID NO: 13) by a PB transposon. The 5’ to 3’ transposon comprises a TTAA sequence, a 35bp LE ITR (SEQ ID NO: 1), a 189bp “cargo” (SEQ ID NO: 14), the reverse complement of a 63bp RE (SEQ ID NO: 2), or a truncated RE ITR comprising one of SEQ ID NOs: 3-9 and a TTAA sequence. The reporter construct was co-transfected into cells with a plasmid expressing Super piggyBac (SPB) transposase. If the super-minimal ITR is functional, excision of the transposon and seamless repair of the reporter coding sequence comprising the super-minimal PBRE ITR results in nanoLuc expression that can be detected by a luciferase assay.

[0139] Briefly, on day 0, 30,000 HEK293T cells were reverse transfected with 20 ng reporter gene construct, 10 ng SPB expression vector, and 20 ng vector DNA using 0.15 µL Transit2020 transfection reagent according to the manufacturer’s instructions and plated in a 96-well plate in 100 µL DMEM media + 10% FBS. Cells were incubated at 37°C and luciferase activity was measured on day 1. Results are shown in Table 1.

[0140] Table 1

[0141]

[0142] As shown in Table 1, luciferase activity was detected in transposed cells for all hyperminimized PB RE ITR variants, with the highest signal observed using the hyperminimized 19bp PB RE ITR.

[0143] In a second experiment, reporter gene constructs containing either a 17bp PB RE hyperminimized ITR or a 19bp PB RE hyperminimized ITR were tested in a luciferase excision assay, as well as reporter gene constructs containing a full PB ITR (comprising a full PB 5’UTR sequence (SEQ ID NO: 15) and an intact 3’UTR sequence (SEQ ID NO: 16)), and a reporter gene construct containing a minimal PB ITR (comprising a 35bp LE ITR (SEQ ID NO: 1) and a 63bp RE (SEQ ID NO: 2)). Results are shown in Table 2.

[0144] Table 2

[0145]

[0146] As shown in Table 2, the 19bp PB RE hyperminimized ITR reporter gene outperformed the minimal 63bp RE ITR, as well as the full PB ITR reporter gene, which further comprises the PB 5’UTR and 3’UTR added back to the PB LE ITR and hyperminimized PB RE ITR, respectively.

[0147] Example 3: Effect of transposon DNA cargo size on SPB transposase integration and excision activity of transposons containing hyperminimized PB RE ITRs

[0148] The full ITR, minimal ITR, and superminimal ITR effects on SPB transposase activity for integration or excision of larger transposons were tested using the double excision / integration luciferase reporter gene system compared to the transposon of Example 2. The reporter gene system contains an open reading frame for firefly luciferase that is disrupted by the SPB transposon. Initially, no firefly luciferase is expressed, but SPB-mediated excision and nonhomologous end repair of the transposon results in expression. The transposon itself expresses a destabilized nanoluc luciferase mRNA. The nanoluc expression from the episomal vector is unstable because the mRNA lacks a polyA tail and contains a 3’ destabilization element. Integration of the transposon into genomic DNA allows the mRNA to utilize a genomic polyA sequence and splice out the destabilization element using a splice donor sequence on the transposon, resulting in luciferase expression (SEQ ID NO: 17).

[0149] The transposon ITRs of this reporter plasmid were modified to make transposons containing the following: full ITR, minimal ITR, or 19bp RE superminimal ITR. Briefly, on day 0, about 200,000 K562 cells were nucleofected with 50 ng of one reporter and 500 ng of SPB expression vector (or vector DNA as a negative control) and plated in 24-well plates in 600 µL IMDM media + 10% FBS. Cells were incubated at 37°C and luciferase activity was measured on day 2. Results are shown in Table 3.

[0150] Table 3

[0151]

[0152] Rep.: Replicate.

[0153] As shown in Table 3, the detected firefly luciferase excision signal and nanoLuc integration signal were each highest for the full PB ITR, lower for the minimal PB ITR, and lowest for the 19bp PB RE superminimal ITR. The transposons containing larger DNA cargo resulted in LE ITR and RE ITR placement further apart, suggesting that the lack of a second transposase dimer binding site in the superminimal RE ITR can reduce transposition efficiency for larger DNA cargo.

[0154] Example 4: SPB transposase integration and excision activity of spacer length between PB LE ITR and PB RE ITR of transposons containing superminimal PB RE ITR

[0155] Transposons are typically delivered to cells either in vitro or in vivo via circular DNA vectors. Even for large transposons, strategies to bring the ITRs closer on the circular vector reduce the number of base pairs separating the ITRs outside the transposon (i.e., the plasmid backbone).

[0156] The dual luciferase reporter prepared in Example 3 was modified to place the ITRs close together, essentially converting the entire vector into a transposon, to produce transposons containing the full PB ITR (SEQ ID NO: 18), the minimal PB ITR (SEQ ID NO: 19), or the super-minimal PB ITR (SEQ ID NO: 20) and a 221 bp sequence between TTAA outside the transposon. In this process, the firefly excision reporter was partially deleted, but the nanoLuc integration reporter remained intact. These new integration-only luciferase reporters, as well as a positive control luciferase reporter containing the full-length plasmid backbone, were tested for transposon integration in K562 cells as described in Example 3. The results are shown in Table 4.

[0157] Table 4

[0158]

[0159] As shown in Table 4, the full ITR and minimal ITR resulted in high transposition, while lower levels of transposition were observed using the 19 bp super-minimal ITR, indicating that the super-minimal ITR is best suited for SPB-mediated transposition of very small transposons.

[0160] Example 5: Effect of super-minimal PB RE ITR polynucleotide length on site specificity of TAL-only excision - Effect of Super PiggyBac fusion protein (TAL-ss-SPB PBx) on transposase excision activity

[0161] The nanoLuc only excision reporter system described in Example 2 was used to compare the excision activity of reporter plasmids for transposons containing full ITRs, minimal ITRs, or 44bp, 34bp, 19bp, and 17bp RE super-minimal ITR variants. Briefly, 30,000 HEK293T cells were co-transfected with the TAL-ssSPB PBx expression vector targeting GFP left (SEQ ID NO: 21) and the TAL-ssSPB PBx expression vector targeting GFP right (SEQ ID NO: 22) as described in Example 2, and each reporter. The TAL-ssSPB PBx expression vector targeting GFP contains a TAL array targeting DNA sequences upstream and downstream of a TTAA integration site fused to a piggyBac transposase containing an N-terminal deletion of amino acids 1-93 and further containing four high-activity SPB mutations and a mutation rendering the transposase integration defective but retaining normal excision activity (PBx). The TAL array-SPB transposase fusion protein GFP1 right TAL-ssSPB PBx and GFP1 left TAL-ssSPB PBx target specific 10 bp right and 10 bp left sequences in the coding region of the GFP gene were prepared as described in Examples 14 and 18 of commonly owned International Patent Application Publication No. PCT / 2022 / 22549, the contents of which are incorporated by reference in their entirety.

[0162] Luciferase signal was measured from cells transfected with transposons containing various ITR sequences. Results are shown in Table 5.

[0163] Table 5

[0164]

[0165] As shown in Table 5, transfection of cells with any of the reporter constructs resulted in production of luciferase signal, indicating excision of the transposon from the reporter and restoration of the full-length luciferase coding sequence. Transposons containing full ITRs, minimal ITRs, or 44bp super-minimal ITRs (retaining a portion of the distal transposase binding site) all performed similarly. Transposons containing 34bp, 19bp, and 17bp super-minimal ITRs, which have all completely lacked the binding site for the distal transposase dimer, each exhibited higher excision signal than transposons containing full ITRs or their larger ITR variants.

[0166] Example 6: Effect of super-minimal PBRE ITR polynucleotide length on site specificity of TAL-only excision - Effect of Super PiggyBac fusion protein (TAL-ss-SPB PBx) on transposase excision activity

[0167] By transfecting HEK293T as described in Example 3, the polynucleotides containing full ITR, minimal ITR, or 19bp super-minimal ITR were examined for transposition by the large transposon using the dual excision / integration luciferase reporter, as well as the SPB transposase and TAL-ssSPB PBx fusion protein. Given that TAL-ssSPB consists of only the excision PBx transposase δ1-93 sequence, and there is no targeted integration site for the GFP TAL-ssSPB in the genome, only the excision signal of the dual excision / integration luciferase reporter was monitored. The results of the excision assay are shown in Table 6.

[0168] Table 6

[0169]

[0170] As shown in Table 6, the highest excision activity of the SPB transposase was observed using the reporter construct containing the full ITR, with lower excision activity using the minimal ITR, and the lowest excision activity using the super-minimal ITR. However, this trend was partially reversed using the TAL-ssSPB PBx fusion protein, where the reporter construct containing the super-minimal ITR exhibited the highest excision activity compared to the reporter constructs containing the full ITR or minimal ITR, which performed similarly but to a lesser extent. As a negative control for the assay, the catalytically dead SPB exhibited background levels of luciferase activity.

[0171] Example 7: Construction of TAL-bound ITR and use with TAL-ssSPB PBx fusion protein for site-specific transposition

[0172] A series of superminimal RE ITR variants were constructed by extending the spacer region of the superminimal RE ITR sequence using various lengths, followed by a reporter plasmid target site for the second distal GFP1 R TAL-ssSPB, which includes the TAL binding site (SEQ ID NO: 23), the spacer region, and then the binding sites for the PBx DBD and CRD domains. Several TAL RE ITR variants ("TAL binding RE ITR") were constructed with different spacer lengths between the RE ITR and the TAL array: no spacer (SEQ ID NO: 24); +5 bp spacer (SEQ ID NO: 25), +10 bp spacer (SEQ ID NO: 26); +15 bp spacer (SEQ ID NO: 27), +20 bp spacer (SEQ ID NO: 28), and +25 bp spacer (SEQ ID NO: 29). Increasing the spacer length further separates the binding sites for the first proximal left TAL-ssSPB PBx dimer and the second distal right TAL-ssSPB PBx dimer.

[0173] Similarly, a series of superminimal LE ITR variants were constructed for the second distal TAL-ssSPB dimer. Several TAL LE ITR variants ("TAL binding LE ITR") were constructed with different spacer lengths between the LE ITR and the TAL array: no spacer (SEQ ID NO: 30); +5 bp spacer (SEQ ID NO: 31), +10 bp spacer (SEQ ID NO: 32); +15 bp spacer (SEQ ID NO: 33), +20 bp spacer (SEQ ID NO: 34), and +25 bp spacer (SEQ ID NO: 35). To avoid potential recombination between these extended superminimal LE and RE ITRs, the spacer sequences of the LE and RE ITR pairs were modified to reduce sequence redundancy and homology.

[0174] TAL binding LE and RE ITRs were initially tested in HEK293T using a luciferase transposon excision reporter as described in Example 2 above. Each reporter plasmid was co-transfected with either the GFP1 R TAL-ssSPB PBx (SEQ ID NO: 22) which binds the ITR or the PAH2 L TAL-ssSPB PBx (SEQ ID NO: 36) which does not bind the ITR. The PAH2 L TAL-ssSPB PBx was prepared as described in co-owned International Patent Application Publication No. PCT / 2022 / 22549. The GFP1 R TAL-ssSPB PBx produced higher excision signals for all TAL binding ITR reporter genes than the PAH2 L TAL ssSPB PBx. As a control, reporter constructs containing minimal and superminimal ITRs were transfected, in this case, both TAL-ssSPBs PBx fusion proteins produced similar excision signals. Results are shown in Table 7.

[0175] Table 7

[0176]

[0177] As shown in Table 7, the highest signal using TAL binding ITRs was seen with the version containing the longest 25bp spacer sequence.

[0178] Example 8: Construction of TAL binding ITRs targeting LINE1 elements and use with TAL-ssSPB PBx fusion proteins targeting LINE1 for site-specific transposition

[0179] A. Small transposons

[0180] In a first experiment, various TAL-bound ITR designs were compared for site-specific transposition into the human genome at a target site found in LINE1 repeat sequence (SEQ ID NO: 37) catalyzed by LINE1 TAL-ssSPB PBx comprising LINE LI ss-SPB PBx (SEQ ID NO: 38) and LINE R1 ss-SPB PBx (SEQ ID NO: 39). LINE1 LI TAL-ssSPB PBx and LINE R1 ss-SPB PBx were prepared as described in commonly owned International Patent Application Publication No. PCT / 2022 / 22549. A 610bp transposon with full ITR (SEQ ID NO: 40), a 392bp transposon with TAL-bound ITR with 25bp spacer (SEQ ID NO: 41), a 365bp transposon with minimal ITR (SEQ ID NO: 42), and a 321bp transposon with 19bp super-minimal ITR (SEQ ID NO: 43) were cloned into a 4.5kb donor vector. 450ng of each transposon donor was co-transfected into 120,000 HEK293T cells (plated one day in advance) along with a total of 50ng of a pair of LINE1 TAL-ssSPB pairs using 1 pL JetPrime transfection reagent according to the manufacturer’s instructions. Two days later, genomic DNA was harvested and site-specific integration of the transposon into the target site in both the forward and reverse direction was quantified by ddPCR. Results are shown in Table 8.

[0181] Table 8

[0182]

[0183] As shown in Table 8, the super-minimal ITR transposon resulted in the highest level of site-specific integration of the four ITR designs tested; however, the TAL-bound ITRs demonstrated good activity at the LINE1 element.

[0184] B. Large transposons

[0185] In a second experiment, the various ITR designs were next compared for site-specific transposition of the Sleeping Beauty transposon into the human genome at a target site found in LINE1 repeat sequence (SEQ ID NO: 37) catalyzed by LINE1 TAL-ssSPB PBx containing LINE LI ss-SPB PBx (SEQ ID NO: 38) and LINE R1 ss-SPB PBx (SEQ ID NO: 39). The transposon donor nanoplasmid contained a PiggyBac transposon containing in the 5' to 3' direction: TTAA, a 309 bp fragment containing the PiggyBac 5' ITR and a portion of the UTR, a "cargo" consisting of an EFla promoter, a puromycin resistance gene, a 2A peptide, and a GFP reporter, followed by a 238 bp fragment containing the PiggyBac 3' ITR and a portion of the UTR, and TTAA (SEQ ID NO: 44). The donor DNA transposon was modified to replace the full ITR with a TAL-bound ITR with 25 bp spacer, minimal ITR, or 19 bp superminimal ITR. Each transposon donor was co-transfected with the LINE1 TAL-ssSPB expression vector into HEK293T cells. After one or three days, genomic DNA was harvested and site-specific integration of the transposon in the forward direction into the target site was quantified by ddPCR. The results are shown in Table 9.

[0186] Table 9

[0187]

[0188] As shown in Table 9, similar to the first experiment using the mini-transposon, the superminimal ITR transposon resulted in the highest level of site-specific integration of the Sleeping Beauty transposon into the LINE1 element repeat sequence.

Claims

1. A polynucleotide encoding a transposon, the polynucleotide comprising a super-minimal piggyBac right end (RE) inverted terminal repeat (ITR) and a left end (LE) minimal ITR sequence, wherein the super-minimal piggyBac RE ITR comprises the nucleic acid sequence set forth in SEQ ID NO: 8 and the LE ITR comprises the sequence of SEQ ID NO:

1.

2. The polynucleotide of claim 1, wherein the transposon is a piggyBac transposon or a piggyBac-like transposon.

3. The polynucleotide of claim 1 or 2, wherein the polynucleotide further comprises at least one exogenous nucleic acid sequence.

4. The polynucleotide of claim 3, wherein the at least one exogenous nucleic acid sequence encodes a non-naturally occurring antigen receptor.

5. The polynucleotide of claim 3, wherein the at least one exogenous nucleic acid sequence encodes a therapeutic polypeptide.

6. The polynucleotide of claim 5, wherein the therapeutic polypeptide is a Factor VIII polypeptide, a Factor IX polypeptide, a phenylalanine hydroxylase (PAH), an ornithine transcarbamylase (OTC) polypeptide, or a methylmalonyl-CoA mutase (MUT1) polypeptide.

7. The polynucleotide of any one of claims 3 to 6, further comprising a promoter sequence.

8. The polynucleotide of any one of claims 1 to 7, wherein the RE ITR is in reverse orientation and / or the LE ITR is in reverse orientation.

9. A vector comprising the polynucleotide of any one of claims 1 to 8.

10. A cell comprising the polynucleotide of any one of claims 1 to 8 or the vector of claim 9.

11. A pharmaceutical composition comprising the cell of claim 10 and a pharmaceutically acceptable carrier.

12. A transposon comprising, in 5' to 3' order: (i) a left end (LE) inverted terminal repeat (ITR) sequence; (ii) a promoter; (iii) an exogenous nucleic acid sequence encoding a non-naturally occurring antigen receptor; and (iv) a reverse complement of a super-minimal right end (RE) inverted terminal repeat (ITR) sequence.

13. A transposon comprising, in 5' to 3' order: (i) a left end (LE) inverted terminal repeat (ITR) sequence; (ii) a promoter; (iii) an exogenous nucleic acid sequence encoding a therapeutic polypeptide; and (iv) a reverse complement of a super-minimal right end (RE) inverted terminal repeat (ITR) sequence.

14. A transposon comprising, in 5' to 3' order: (i) a right end (RE) inverted terminal repeat (ITR) sequence; (ii) a promoter; (iii) an exogenous nucleic acid sequence encoding a non-naturally occurring antigen receptor; and (iv) a reverse complement of a super minimal left end (LE) inverted terminal repeat (ITR) sequence.

15. A transposon comprising, in 5' to 3' order: (i) a right end (RE) inverted terminal repeat (ITR) sequence; (ii) a promoter; (iii) an exogenous nucleic acid sequence encoding a therapeutic polypeptide; and (iv) a reverse complement of a super minimal left end (LE) inverted terminal repeat (ITR) sequence.

16. The transposon of claim 13 or 15, wherein the therapeutic polypeptide is a Factor VIII polypeptide, a Factor IX polypeptide, phenylalanine hydroxylase (PAH), ornithine transcarbamylase (OTC) polypeptide, or methylmalonyl-CoA mutase (MUT1) polypeptide.

17. A method of treating a disease or disorder in a subject in need thereof, the method comprising administering to the subject (i) at least one therapeutically effective dose of the vector of claim 9, or the transposon of any one of claims 13 to 15, and (ii) a transposase or a nucleic acid or nucleic acid sequence encoding a transposase.

18. The method of claim 17, wherein the transposase is a SPB transposase, a TAL-ss-SPB PBx transposase fusion protein, or a ZNF-ssSPB transposase fusion protein.

19. A method of treating a disease or disorder in a subject in need thereof, the method comprising administering to the subject at least one therapeutically effective dose of the cell of claim 10.

20. The method of any one of claims 17 to 19, wherein the disease or disorder is a cancer, a liver disease or disorder, a urea cycle disorder, a metabolic liver disorder, or a hemophilia.

Citation Information

Patent Citations

  • Polylactide-drug mixtures

    US3773919A

  • Identification and preparation of epitopes on antigens and allergens on the basis of hydrophilicity

    US4554101A

  • Therapeutic drug delivery systems

    US5770222A

  • Laser perforator

    US5839446A

  • Gas pressured needle-less injection device and method

    US5851198A