Composition and culture solution for promoting development of bovine gene editing cloned embryos and application of composition and culture solution

By adding δ-like ligand 3, Vercirnon, and ML604086 to the in vitro maturation medium of bovine oocytes, cell pathways were regulated, solving the problem of low development efficiency of gene-edited cloned embryos, achieving higher cleavage and blastocyst rates, and enhancing the industrial application potential of gene-edited cattle.

CN121406567AActive Publication Date: 2026-01-27CHINA AGRI UNIV
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
CN202511970796.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-25
Publication Date
2026-01-27
Estimated Expiration
2045-12-25

AI Technical Summary

Technical Problem

Gene-edited cloned embryos have low in vitro and in vivo development efficiency and poor oocyte quality, resulting in low pregnancy rates and high perinatal mortality rates in newborn calves. Existing culture media cannot effectively enhance the stress resistance of oocytes and inhibit abnormal cell death signaling pathways.

Method used

Synergistic addition of δ-like ligand 3 (DLL3), Vercirnon, and ML604086 to bovine oocyte in vitro maturation medium regulates three cellular pathways: Notch-apoptosis, CCR9-mitochondria, and S1P3-autophagy, forming an anti-apoptosis-anti-autophagy-promoting coupling network and improving oocyte quality.

Benefits of technology

It significantly reduces apoptosis and autophagy levels, increases embryonic cell number, improves cleavage rate and blastocyst rate, and enhances the production efficiency and quality of gene-edited cloned embryos.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121406567A_ABST
    Figure CN121406567A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of gene editing, in particular to a composition and a culture solution for promoting development of bovine gene editing cloned embryos and application of the composition and the culture solution. The composition (DLL3, Vercircon and ML604086) is added into an oocyte in-vitro maturation culture medium, and the DLL3, the Vercircon and the ML604086 cooperate with one another, so that apoptosis and autophagy injury of bovine oocytes are effectively reduced, the cleavage rate and blastocyst rate of embryos are increased, and the method has important practical value for improving the production efficiency and quality of gene editing cloned embryos.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of gene editing technology, and in particular to a composition, culture medium, and application for promoting the development of bovine gene-edited cloned embryos. Background Technology

[0002] With the rapid development of modern molecular biology techniques, gene editing technology (such as the CRISPR / Cas system) has become a revolutionary tool in life science research. By precisely editing the bovine genome, new breeds with superior traits can be bred, such as increased meat yield, improved dairy quality, enhanced disease resistance, reduced environmental impact, and use as biomedical models or reactors. This provides an unprecedented technological pathway for the high-quality and sustainable development of animal husbandry. However, the in vitro and in vivo development efficiency of gene-edited cloned embryos is still significantly lower than that of in vivo fertilized embryos, with an average blastocyst rate of less than 20%, a pregnancy rate of less than 30%, and a peripartum mortality rate of 40%–60% in newborn calves, severely restricting industrialization. The fundamental reason for this bottleneck lies in the poor quality of in vitro matured oocytes.

[0003] Oocyte quality is widely recognized as the primary factor determining the developmental potential of cloned embryos. Although the bovine oocyte in vitro maturation (IVM) system has been optimized over many years, it still has significant shortcomings, with oocyte quality far lower than that of in vivo matured oocytes. Conventional IVM culture media primarily provide basic nutrients and hormones, with insufficient consideration given to how to actively intervene and optimize the internal state of oocytes, particularly how to enhance their ability to resist subsequent cloning stress and inhibit abnormal cell death signaling pathways. While some studies have attempted to add various additives (such as antioxidants and growth factors) to the culture medium to improve embryo development, their effects are limited and unstable, especially for embryos that have undergone both gene editing and cloning, where the improvement is negligible. The gene editing process itself may cause unknown metabolic or epigenetic perturbations to donor cells. When these "damaged" cells combine with poor-quality oocytes, it further exacerbates the embryonic developmental difficulties. Therefore, developing an IVM culture medium that can specifically and efficiently improve oocyte quality, thereby providing gene-edited cloned embryos with stronger developmental potential, has become a pressing technical challenge in this field. Summary of the Invention

[0004] To address the aforementioned problems, this invention provides a composition, culture medium, and application for promoting the development of bovine gene-edited cloned embryos. The composition provided by this invention effectively improves the production efficiency and quality of cloned embryos, and has extremely important practical value for promoting the industrial application of gene-edited cattle from the laboratory.

[0005] To achieve the above objectives, the present invention provides the following technical solution: This invention provides a composition for promoting the development of bovine gene-edited clonal embryos, comprising: δ-like ligand 3, Vercirnon, and ML604086; wherein the molar ratio of δ-like ligand 3 to Vercirnon is 10~200 µg: 0.3~10 µmol; and the molar ratio of δ-like ligand 3 to ML604086 is 10~200 µg: 0.3~10 µmol.

[0006] Preferably, the mass molar ratio of the δ-sample ligand 3 to Vercirnon is 20~100 µg: 1~10 µmol; the mass molar ratio of the δ-sample ligand 3 to ML604086 is 20~100 µg: 3~10 µmol.

[0007] This invention provides a culture medium for in vitro maturation of bovine oocytes, comprising a basal culture medium, δ-like ligand 3 10~200 µg / L, Vercirnon 0.3~10 µmol / L, and ML604086 0.3~10 µmol / L.

[0008] Preferred components include basal culture medium, δ-sample ligand 3 20~100 µg / L, Vercirnon 1~10 µmol / L, and ML604086 3~10 µmol / L.

[0009] Preferably, the basal culture medium comprises: 90-95% (v / v) TCM199 culture medium, 3-5 IU / mL pregnant mare serum gonadotropin, 3-5 IU / mL luteinizing hormone, 1-10 ng / mL estrogen, 95-105 IU / mL penicillin, 95-105 μg / mL streptomycin, 5-10% (v / v) follicular fluid, 0.4-0.6 mg / mL glucose, 1.8-2.3 mg / mL sodium bicarbonate, 0.04-0.08 mg / mL sodium pyruvate, and 0.4-0.7 mg / mL cysteine.

[0010] Preferably, the basal culture medium comprises: 90% (v / v) TCM199 culture medium, 5 IU / mL pregnant mare serum gonadotropin, 4 IU / mL luteinizing hormone, 5 ng / mL estrogen, 100 IU / mL penicillin, 100 μg / mL streptomycin, 8% (v / v) follicular fluid, 0.50 mg / mL glucose, 2.10 mg / mL sodium bicarbonate, 0.06 mg / mL sodium pyruvate, and 0.57 mg / mL cysteine.

[0011] This invention provides the use of the composition or culture medium described in the above-described technical solutions in one or more of the following applications, wherein the applications are for non-disease diagnosis and non-disease treatment: 1) Reduce the level of apoptosis in bovine oocytes; 2) Reduce the autophagy level in bovine oocytes; 3) Improve the development rate of bovine gene-edited cloned embryos; 4) Increase the number of cells in bovine gene-edited cloned embryos.

[0012] Preferably, improving the development rate of bovine gene-edited cloned embryos includes: improving the cleavage rate and / or blastocyst rate of bovine gene-edited cloned embryos.

[0013] The present invention provides a method for promoting in vitro maturation of bovine oocytes and / or improving the quality of in vitro maturation of bovine oocytes, comprising: culturing immature bovine oocytes in vitro using the culture medium described in the above technical solution.

[0014] This invention provides the application of the method described in the above technical solution in improving the production efficiency and / or quality of bovine gene-edited cloned embryos.

[0015] Beneficial effects: This invention provides a composition for promoting the development of bovine gene-edited cloned embryos, comprising: delta-like ligand 3 (DLL3), Vercirnon, and ML604086; wherein the molar ratio of DLL3 to Vercirnon is 10-200 µg: 0.3-10 µmol; and the molar ratio of DLL3 to ML604086 is 10-200 µg: 0.3-10 µmol. This invention discovers that by precisely intervening at the small molecule level, synergistically adding three specific substances—DLL3, Vercirnon, and ML604086—to the in vitro maturation medium of bovine oocytes can effectively improve the production efficiency and quality of cloned embryos, exhibiting a synergistic effect. These three substances act on different cellular pathways, collectively constructing a microenvironment conducive to embryonic development. This composition can effectively alleviate the stress experienced by cloned embryos during reprogramming and early development, significantly reduce apoptosis levels, and inhibit harmful excessive activation of autophagy, thereby reducing embryonic cell damage and increasing the number of embryonic cells. This has significant practical value and application prospects for improving the production efficiency and quality of gene-edited cloned embryos. Attached Figure Description

[0016] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0017] Figure 1 Bright field images of blastocysts from the control and experimental groups; Figure 2 The results show the effects of the control group and the experimental group on the levels of apoptosis and autophagy. Figure 3 The results show the effects of the control group and the experimental group on the number of bovine gene-edited cloned blastocyst cells. Detailed Implementation

[0018] This invention provides a composition for promoting the development of bovine gene-edited clonal embryos, comprising: δ-like ligand 3, Vercirnon, and ML604086; wherein the molar ratio of δ-like ligand 3 to Vercirnon is 10~200 µg: 0.3~10 µmol; and the molar ratio of δ-like ligand 3 to ML604086 is 10~200 µg: 0.3~10 µmol.

[0019] In one embodiment, the molar ratio of δ-ligand 3 to Vercirnon is 20-100 µg: 1-10 µmol; the molar ratio of δ-ligand 3 to ML604086 is 20-100 µg: 3-10 µmol. In another embodiment, the molar ratio of δ-ligand 3 to Vercirnon is 100 µg: 10 µmol; the molar ratio of δ-ligand 3 to ML604086 is 100 µg: 10 µmol.

[0020] This invention provides a culture medium for in vitro maturation of bovine oocytes, comprising a basal culture medium, δ-like ligand 3 10~200 µg / L, Vercirnon 0.3~10 µmol / L, and ML604086 0.3~10 µmol / L.

[0021] In one embodiment, the culture medium comprises a basal culture medium, δ-sample ligand 3 20~100 µg / L, Vercirnon 1~10 µmol / L, and ML604086 3~10 µmol / L. In another embodiment, the culture medium comprises a basal culture medium, δ-sample ligand 3 100 µg / L, Vercirnon 10 µmol / L, and ML604086 10 µmol / L.

[0022] In one embodiment, the basal culture medium comprises: 90-95% (v / v) TCM199 culture medium, 3-5 IU / mL pregnant mare serum gonadotropin, 3-5 IU / mL luteinizing hormone, 1-10 ng / mL estrogen, 95-105 IU / mL penicillin, 95-105 μg / mL streptomycin, 5-10% (v / v) follicular fluid, 0.4-0.6 mg / mL glucose, 1.8-2.3 mg / mL sodium bicarbonate, 0.04-0.08 mg / mL sodium pyruvate, and 0.4-0.7 mg / mL cysteine. In one embodiment, the basal culture medium comprises: 90% (v / v) TCM199 culture medium, 5 IU / mL pregnant mare serum gonadotropin, 4 IU / mL luteinizing hormone, 5 ng / mL estrogen, 100 IU / mL penicillin, 100 μg / mL streptomycin, 8% (v / v) follicular fluid, 0.50 mg / mL glucose, 2.10 mg / mL sodium bicarbonate, 0.06 mg / mL sodium pyruvate, and 0.57 mg / mL cysteine.

[0023] Through in-depth research and extensive experimentation, the inventors have creatively proposed a novel solution that departs from traditional nutritional supplementation approaches. Instead, it focuses on regulating key cell fate signaling pathways to fundamentally improve the "quality" of oocytes. This invention involves precise intervention at the small molecule level, synergistically adding three specific substances to the in vitro maturation medium of bovine oocytes: delta-like ligand 3 (DLL3), Vercirnon (CCX282-B), and ML604086. These three substances target three complementary pathways: Notch-apoptosis, CCR9-mitochondria, and S1P3-autophagy, respectively. They form a synergistic network of "anti-apoptosis-anti-autophagy-promoting coupling," effectively improving the production efficiency and quality of cloned embryos, specifically manifested in higher cleavage rates and a more practically significant blastocyst rate. The blastocyst stage is crucial for embryo transfer and implantation; increasing its rate directly translates to improved productivity in gene-edited bovine individuals. The composition provided by this invention can effectively alleviate the stress experienced by cloned embryos during reprogramming and early development, significantly reduce apoptosis levels and inhibit harmful excessive activation of autophagy, thereby reducing embryonic cell damage and increasing the number of embryonic cells. This has significant practical value and application prospects for improving the production efficiency and quality of gene-edited cloned embryos.

[0024] Based on the above advantages, the present invention provides the application of the composition or culture medium described in the above technical solution in one or more of the following, wherein the application is for non-disease diagnosis and non-disease treatment: 1) Reduce the level of apoptosis in bovine oocytes; 2) Reduce the autophagy level in bovine oocytes; 3) Improve the development rate of bovine gene-edited cloned embryos; 4) Increase the number of cells in bovine gene-edited cloned embryos.

[0025] As one implementation method, improving the development rate of bovine gene-edited cloned embryos includes: increasing the cleavage rate and / or blastocyst rate of bovine gene-edited cloned embryos.

[0026] Based on the above advantages, the present invention provides a method for promoting in vitro maturation of bovine oocytes and / or improving the quality of in vitro maturation of bovine oocytes, comprising: culturing immature bovine oocytes in vitro using the culture medium described in the above technical solution.

[0027] Based on the above advantages, the present invention provides the application of the method described in the above technical solution in improving the production efficiency and / or quality of bovine gene-edited cloned embryos.

[0028] To further illustrate the present invention, the following detailed description, in conjunction with embodiments and accompanying drawings, describes a composition, culture medium, and application of the present invention for promoting the development of bovine gene-edited clonal embryos, but these descriptions should not be construed as limiting the scope of protection of the present invention.

[0029] Example 1: Method for improving the developmental rate of bovine gene-edited cloned embryos 1. In vitro maturation of oocytes Bovine ovaries were collected from the slaughterhouse and placed in physiological saline at 35°C, then transported back to the laboratory within 2 hours. The ovaries were washed three times with physiological saline. Using a disposable syringe with a 20G needle containing 5 mL of oocyte aspiration fluid, the follicles were punctured to release the cumulus-oocyte complex. Bovine cumulus-oocyte complexes with homogeneous cytoplasm and at least three layers of cumulus cells were collected under a stereomicroscope. The selected bovine cumulus-oocyte complexes were washed three times with oocyte aspiration fluid, and then three times with basal oocyte maturation culture medium pre-equilibrated in an incubator for 3 hours. The complexes were then transferred to four-well plates containing 600 μL of different in vitro maturation culture media and 300 μL of mineral oil per well for culture. Each well contained 30 bovine cumulus-oocyte complexes. The four-well plates were then incubated in a 5% CO2, 38.5°C saturated humidity incubator for 24 hours.

[0030] The oocyte aspiration fluid consisted of 49 mL of TCM199 culture medium (purchased from Thermo Fisher, catalog number 11150059) and 1 mL of fetal bovine serum (FBS).

[0031] Composition of the basal culture medium for in vitro maturation of oocytes: 90% (v / v) TCM199 medium, 5 IU / mL pregnant mare serum gonadotropin (PMSG), 4 IU / mL luteinizing hormone (LH), 5 ng / mL estrogen (E2), 100 IU / mL penicillin, 100 μg / mL streptomycin, 8% (v / v) follicular fluid, 0.50 mg / mL glucose, 2.10 mg / mL sodium bicarbonate, 0.06 mg / mL sodium pyruvate, and 0.57 mg / mL cysteine.

[0032] 2. Based on this invention, multiple experimental groups were set up. The culture medium used in the experimental groups was the oocyte in vitro maturation basal culture medium (referred to as the control group) with different concentrations of DLL3, Vercirnon (CCX282-B, CAS No.: 698394-73-9), ML604086 (CAS No.: 850330-18-6) or a combination thereof added, as detailed in Tables 1-5.

[0033] 3. Gene editing of bovine fibroblasts Primary fibroblasts were obtained from the ear margin tissue of 3-month-old Holstein bulls by collagenase IV digestion and cultured in DMEM + 15% FBS to P3; then digested with 0.25% trypsin, counted with trypan blue, and adjusted to 5 × 10⁻⁶ cells / mL. 5 Cells / tube, stored at 4°C. Cas12i (1 μg / μL) and BLG site crRNA (2 μg / μL, SEQ ID NO.1) were mixed at a 1:1.2 molar ratio and incubated at 37°C for 15 min. 1.2×SSDNA (50 ng / μL, SEQ ID NO.2) was added and incubated for another 5 min to form the RNP-donor complex. The cell suspension was mixed with the RNP complex and transferred to a 4 mm electroporation cuvette. Parameters: 150 V, 5 ms, 2 pulses (Neon® system). Immediately transferred to pre-warmed DMEM + 10% FBS. After 48 h, the medium was replaced with puromycin containing 2 μg / mL, and selection was performed for 72 h. Cells were seeded into 96-well plates using a limiting dilution method, one cell per well. After 10 days, single clones were picked, and the genome was extracted by Direct-PCR. The target sequences (SEQ ID NO.3 and SEQ ID NO.4) were amplified, and T7E1 digestion was used for initial screening. Successful editing would produce two bands (250bp and 450bp) consistent with the expected results; otherwise, only a single band was observed. Positive clones were sent for Sanger sequencing to verify homozygous / heterozygous mutations and gene editing efficiency. The Cas12i was obtained from China Agricultural University and is disclosed in Chinese patent CN111757889A.

[0034] SEQ ID NO.1: 5'-GCCATGGCGGCCAGCGACAT-3'; SEQ ID NO.2: 5'-GTGGCTGTGGTCTGCACAGACGACGGCTCCAAGGCCTGTGAGGCCGTGTGCCCTCCATCTGCACAGACTACCGGGTGCAGGCACCGTGGTCGTCTCCTGCAGGTGGTGCAGCCCTGCAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAG AGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC-3'; SEQ ID NO.3: 5'-TTCTCCCTGTGTCCTTTGCG-3'; SEQ ID NO. 4: 5'-ATAAGCAGCCTTGGGTGGAC-3'.

[0035] 4. Preparation and culture of bovine gene-edited cloned embryos Fibroblasts were digested with trypsin. G0 / G1 phase cells (10-15 μm in diameter) were injected under the zona pellucida of enucleated oocytes and electrofused with a 1.2 kV / cm, 30 μs DC pulse twice. The fusion rate was observed after 1 h. Fusion embryos were activated with 5 μmol / L iomycin for 4 min, followed by treatment with 2 mmol / L 6-DMAP + 10 μg / mL CHX for 4 h. After washing, they were placed in a droplet of mSOFaa + 4 mg / mL BSA and cultured in a saturated humidity incubator at 38.5℃, 5% O2, 5% CO2, and 90% N2. The cleavage rate was recorded after 48 h, and the blastocyst rate was assessed on day 7. High-quality blastocysts were used for transfer or cryopreservation.

[0036] Electrofusion solution: 0.28 mol / L mannitol, 0.1 mmol / L MgSO4, 0.5 mmol / L HEPES and 0.05% (v / v) BSA.

[0037] The mSOFaa culture medium was prepared as follows: each 1L contained 6.34 g NaCl, 0.54 g KCl, 0.23 g CaCl2·2H2O, 0.01 g MgSO4·7H2O, 0.17 g KH2PO4, 0.24 g NaHCO3, 0.30 g glucose, 0.04 g sodium pyruvate, 5.8 mL sodium lactate, 2% BME amino acid solution (v / v), and 1% MEM non-essential amino acid solution (v / v). All reagents were purchased from Sigma-Aldrich.

[0038] II. Experimental Results 1. The effects of different concentrations of DLL3 on the development of bovine gene-edited cloned embryos are shown in Table 1.

[0039] The results showed that the cleavage rate and blastocyst rate of the groups supplemented with 20 µg / L, 50 µg / L, 100 µg / L and 200 µg / L DLL3 were significantly higher than those of the control group and the groups supplemented with 1 µg / L, 5 µg / L, 10 µg / L and 500 µg / L DLL3.

[0040] Table 1. Effects of different concentrations of DLL3 added to in vitro maturation solution on the development rate of bovine gene-edited cloned embryos.

[0041] In the table, different superscript letters (a, b, c) in the same column indicate significant differences between groups. P <0.05, the same applies below.

[0042] 2. The effects of different concentrations of Vercirnon on the development of bovine gene-edited cloned embryos are shown in Table 2.

[0043] The results showed that the cleavage rate and blastocyst rate of the groups with 1 µmol / L, 3 µmol / L, and 10 µmol / L Vercirnon were significantly higher than those of the control group and the groups with 0.1 µmol / L, 0.3 µmol / L, and 30 µmol / L Vercirnon.

[0044] Table 2. Effects of different concentrations of Vercirnon added to in vitro maturation solution on the development rate of bovine gene-edited cloned embryos.

[0045] 3. The effects of different concentrations of ML604086 on the development of bovine gene-edited cloned embryos are shown in Table 3.

[0046] The results showed that the cleavage rate and blastocyst rate of the groups supplemented with 0.1 µmol / L, 0.3 µmol / L, 1 µmol / L, 3 µmol / L, 10 µmol / L, and 30 µmol / L ML604086 were not different from those of the control group.

[0047] Table 3. Effects of different concentrations of ML604086 added to in vitro maturation solution on the development rate of bovine gene-edited cloned embryos.

[0048] 4. The effects of combined treatment with DLL3 and Vercirnon on the development of bovine gene-edited cloned embryos are shown in Table 4.

[0049] The results showed that the cleavage rate and blastocyst rate of treatment groups 5-8 were significantly higher than those of the control group and treatment groups 1-4.

[0050] Table 4. Effects of combined addition of DLL3 and Vercirnon to in vitro maturation solution on the development rate of bovine gene-edited cloned embryos.

[0051] 5. The combined treatment of DLL3, Vercirnon and ML604086 on the development of bovine gene-edited cloned embryos is shown in Table 5.

[0052] The results showed that the blastocyst rates of the combined treatment groups 4-6 and 8-10 were significantly higher than those of the control group, treatment groups 1-3 and 7.

[0053] Table 5. Effects of combined addition of DLL3, Vercirnon, and ML604086 on the developmental rate of bovine gene-edited cloned embryos.

[0054] Example 2: Combined addition of DLL3, Vercirnon, and ML604086 improves the quality of bovine gene-edited cloned embryos. I. Experimental Design and Methods 1. Grouping and Cultivation Control group: Immature oocytes were cultured in vitro for 24 h in in vitro maturation basal culture medium; Experimental group: Immature oocytes were cultured for 24 h in an in vitro maturation basal culture medium supplemented with 100 µg / L DLL3, 10 µmol / L Vercirnon and 10 µmol / L ML604086.

[0055] Bovine cumulus-oocyte complexes were collected according to the method described in Example 1 for oocyte maturation, in vitro fertilization, and embryo culture. Oocytes were cultured using the in vitro maturation culture medium grouped as described above. At the same time, bovine gene-edited cloned embryos were prepared and cultured according to the method described in Example 1.

[0056] 2. Apoptosis detection Mature oocytes were collected and washed twice with 0.1% PVA-PBS buffer (0.1% PVA-PBS). After washing, the oocytes were fixed in 4% PFA fixative at 4°C for 2 h. They were then washed three times with 0.1% PVA-PBS and transferred to 0.5% Triton X100-0.1% PVA-PBS permeabilization buffer for 1 h. Finally, they were transferred to DNA damage detection solution (C1091, Beyotime) and incubated at 37°C for 1 h. After incubation, the oocytes were washed three times with 0.1% PBS-PVA and incubated in 20 μL DAPI staining solution for 5 min. The oocytes were then photographed under a fluorescence microscope. The number of TUNEL-positive cells was taken as the number of apoptotic cells, and the number of DAPI-positive cells was taken as the total number of cells. The apoptosis rate was calculated as follows: Apoptosis rate = (Number of TUNEL-positive cells / Number of DAPI-positive cells) × 100%.

[0057] 3. Protein immunoblotting detection For SDS-PAGE electrophoresis, an 8% separating gel was prepared according to the protein molecular weight. The sample was mixed with loading buffer and heated to denature before loading. The stacking gel was run at 80V, and the separating gel at 120V until the indicator reached the bottom. The membrane was activated with methanol and assembled according to the sequence "negative electrode-filter paper-gel-membrane-filter paper-positive electrode," and wet-stretched at 100V for 60-90 min. It was blocked with 5% skim milk powder for 1-2 h. The membrane was incubated overnight at 4°C with diluted primary antibody, washed with TBST, and then incubated with secondary antibody at room temperature for 1-2 h. Finally, the signal was detected using ECL developing solution, and the loading amount was corrected using internal controls to calculate the relative expression level.

[0058] 4. Protein immunofluorescence staining Gene-edited cloned blastocysts were washed twice with 0.1% PVA-PBS buffer, then fixed in 4% PFA solution at 4°C for 2 h. They were then washed three times with 0.1% PVA-PBS and permeabilized in 0.5% Triton X100-0.1% PVA-PBS solution for 1 h. Afterward, they were transferred to SOX2 and CDX2 primary antibodies (purchased from Abcam, catalog numbers ab97959 and ab76541, respectively) and incubated at 37°C for 1 h. After incubation, they were washed three times with 0.1% PBS-PVA, incubated in 20 μL DAPI staining solution for 5 min, and photographed under a fluorescence microscope to count the number of cells.

[0059] II. Experimental Results like Figure 1 As shown, the number and diameter of blastocysts in the experimental group were significantly higher than those in the control group.

[0060] The effects of the control and experimental groups on apoptosis and autophagy levels are as follows: Figure 2 As shown in the figure, A represents the TUNEL staining images of apoptosis in the control and experimental groups; B represents the Western blot images of apoptosis proteins and autophagy proteins in the control and experimental groups. The results showed that the apoptosis rate in the experimental group (1.83±0.02%) was significantly lower than that in the control group (7.61±0.44%). Simultaneously, the apoptosis protein CASPASE3 and autophagy proteins LC3B, ATG12-ATG5, and ATG5 were significantly lower in the experimental group than in the control group, while the anti-autophagy protein P62 was higher in the experimental group than in the control group.

[0061] The effects of the control and experimental groups on the number of cells in bovine gene-edited cloned blastocysts are as follows: Figure 3 As shown in the figure, A represents the staining images of blastocyst cells in the control and experimental groups, with green representing trophoblast cells (CDX2 positive), red representing inner cell mass cells (SOX2 positive), and blue representing total cells (DAPI positive); B represents the statistical results of the total number of blastocyst cells in the control and experimental groups; and C represents the statistical results of the proportion of inner cell mass cells to total cells in the blastocysts of the control and experimental groups. The results showed that the total number of blastocyst cells in the experimental group (112.57±8.11%) was significantly higher than that in the control group (83.18±5.36%), and the proportion of inner cell mass cells to total cells in the experimental group (39.23±5.01%) was significantly higher than that in the control group (27.33±8.61%).

[0062] In summary, by detecting a series of embryo quality evaluation indicators, the method provided by this invention can significantly improve the quality of bovine gene-edited cloned embryos, which has an important impact on improving the efficiency of animal cloning technology.

[0063] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A composition for promoting the development of bovine gene-edited cloned embryos, characterized in that, include: The δ-ligand 3, Vercirnon, and ML604086 are present; the molar ratio of δ-ligand 3 to Vercirnon is 10~200 µg: 0.3~10 µmol; the molar ratio of δ-ligand 3 to ML604086 is 10~200 µg: 0.3~10 µmol.

2. The composition according to claim 1, characterized in that, The mass molar ratio of the δ-sample ligand 3 to Vercirnon is 20~100 µg: 1~10 µmol; the mass molar ratio of the δ-sample ligand 3 to ML604086 is 20~100 µg: 3~10 µmol.

3. A culture medium for in vitro maturation of bovine oocytes, characterized in that, This includes basal culture medium, δ-sample ligand 3 10~200 µg / L, Vercirnon 0.3~10 µmol / L, and ML604086 0.3~10 µmol / L.

4. The culture medium according to claim 3, characterized in that, This includes basal culture medium, δ-sample ligand 3 20~100 µg / L, Vercirnon 1~10 µmol / L, and ML604086 3~10 µmol / L.

5. The culture medium according to claim 3 or 4, characterized in that, The basic culture medium includes: 90-95% (v / v) TCM199 culture medium, 3-5 IU / mL pregnant mare serum gonadotropin, 3-5 IU / mL luteinizing hormone, 1-10 ng / mL estrogen, 95-105 IU / mL penicillin, 95-105 μg / mL streptomycin, 5-10% (v / v) follicular fluid, 0.4-0.6 mg / mL glucose, 1.8-2.3 mg / mL sodium bicarbonate, 0.04-0.08 mg / mL sodium pyruvate, and 0.4-0.7 mg / mL cysteine.

6. The culture medium according to claim 5, characterized in that, The basic culture medium includes: 90% (v / v) TCM199 medium, 5 IU / mL pregnant mare serum gonadotropin, 4 IU / mL luteinizing hormone, 5 ng / mL estrogen, 100 IU / mL penicillin, 100 μg / mL streptomycin, 8% (v / v) follicular fluid, 0.50 mg / mL glucose, 2.10 mg / mL sodium bicarbonate, 0.06 mg / mL sodium pyruvate, and 0.57 mg / mL cysteine.

7. The use of the composition of claim 1 or 2 or the culture medium of any one of claims 3 to 6 in one or more of the following, wherein the use is for non-disease diagnosis and non-disease treatment: 1) Reduce the level of apoptosis in bovine oocytes; 2) Reduce the autophagy level in bovine oocytes; 3) Improve the development rate of bovine gene-edited cloned embryos; 4) Increase the number of cells in bovine gene-edited cloned embryos.

8. The application according to claim 7, characterized in that, The improvement of bovine gene-edited cloned embryo development rate includes: improving the cleavage rate and / or blastocyst rate of bovine gene-edited cloned embryos.

9. A method for promoting in vitro maturation of bovine oocytes and / or improving the quality of in vitro maturation of bovine oocytes, characterized in that, include: Immature bovine oocytes were cultured in vitro using the culture medium described in any one of claims 3 to 6.

10. The application of the method of claim 9 in improving the production efficiency and / or quality of bovine gene-edited cloned embryos.

Citation Information

Patent Citations

  • Novel crispr / cas12f enzyme and system

    CN111757889A

  • Engineered platelets for targeted delivery of therapeutic agents

    CN115087665A

  • Novel uses of mammalian CCR8 receptors and related reagents

    US20030148369A1

  • Medical use of notch4 or inhibitors thereof

    US20200022998A1

  • Methods and compositions for classifying and treating lung cancer

    US20250346957A1