A composition for promoting development of bovine gene edited cloned embryos, a culture solution and application thereof
By adding δ-like ligand 3, Vercirnon, and ML604086 to the in vitro maturation medium of bovine oocytes, a synergistic network targeting specific cellular pathways was formed, solving the problem of low developmental efficiency of gene-edited cloned embryos, achieving higher cleavage and blastocyst rates, and enhancing the industrial application potential of gene-edited cattle.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-25
- Publication Date
- 2026-03-27
AI Technical Summary
Gene-edited cloned embryos have low in vitro and in vivo development efficiency and poor oocyte quality, resulting in low pregnancy rates and high perinatal mortality rates in newborn calves. Existing culture media cannot effectively enhance the stress resistance of oocytes and inhibit abnormal cell death signaling pathways.
Synergistic addition of delta-like ligand 3 (DLL3), Vercirnon, and ML604086 to bovine oocyte in vitro maturation medium targets three pathways: Notch-apoptosis, CCR9-mitochondria, and S1P3-autophagy, forming an 'anti-apoptosis-anti-autophagy-promoting coupling' network to improve oocyte quality.
It significantly reduces apoptosis and autophagy levels, increases embryonic cell number, improves cleavage rate and blastocyst rate, and enhances the production efficiency and quality of gene-edited cloned embryos.
Smart Images

Figure CN121406567B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of gene editing technology, and in particular to a composition, culture medium, and application for promoting the development of bovine gene-edited cloned embryos. Background Technology
[0002] With the rapid development of modern molecular biology techniques, gene editing technology (such as the CRISPR / Cas system) has become a revolutionary tool in life science research. By precisely editing the bovine genome, new breeds with superior traits can be bred, such as increased meat yield, improved dairy quality, enhanced disease resistance, reduced environmental impact, and use as biomedical models or reactors. This provides an unprecedented technological pathway for the high-quality and sustainable development of animal husbandry. However, the in vitro and in vivo development efficiency of gene-edited cloned embryos is still significantly lower than that of in vivo fertilized embryos, with an average blastocyst rate of less than 20%, a pregnancy rate of less than 30%, and a peripartum mortality rate of 40%–60% in newborn calves, severely restricting industrialization. The fundamental reason for this bottleneck lies in the poor quality of in vitro matured oocytes.
[0003] Oocyte quality is widely recognized as the primary factor determining the developmental potential of cloned embryos. Although the bovine oocyte in vitro maturation (IVM) system has been optimized over many years, it still has significant shortcomings, with oocyte quality far lower than that of in vivo matured oocytes. Conventional IVM culture media primarily provide basic nutrients and hormones, with insufficient consideration given to how to actively intervene and optimize the internal state of oocytes, particularly how to enhance their ability to resist subsequent cloning stress and inhibit abnormal cell death signaling pathways. While some studies have attempted to add various additives (such as antioxidants and growth factors) to the culture medium to improve embryo development, their effects are limited and unstable, especially for embryos that have undergone both gene editing and cloning, where the improvement is negligible. The gene editing process itself may cause unknown metabolic or epigenetic perturbations to donor cells. When these "damaged" cells combine with poor-quality oocytes, it further exacerbates the embryonic developmental difficulties. Therefore, developing an IVM culture medium that can specifically and efficiently improve oocyte quality, thereby providing gene-edited cloned embryos with stronger developmental potential, has become a pressing technical challenge in this field. Summary of the Invention
[0004] To address the aforementioned problems, this invention provides a composition, culture medium, and application for promoting the development of bovine gene-edited cloned embryos. The composition provided by this invention effectively improves the production efficiency and quality of cloned embryos, and has extremely important practical value for promoting the industrial application of gene-edited cattle from the laboratory.
[0005] To achieve the above objectives, the present invention provides the following technical solution:
[0006] The application provides a composition for promoting development of bovine gene editing clone embryos, which comprises delta-like ligand 3, Vercirnon and ML604086; the mass molar ratio of the delta-like ligand 3 and the Vercirnon is 10-200 µg: 0.3-10 µmol; and the mass molar ratio of the delta-like ligand 3 and the ML604086 is 10-200 µg: 0.3-10 µmol.
[0007] Preferably, the mass molar ratio of the delta-like ligand 3 and the Vercirnon is 20-100 µg: 1-10 µmol; and the mass molar ratio of the delta-like ligand 3 and the ML604086 is 20-100 µg: 3-10 µmol.
[0008] The application provides a culture solution for in-vitro maturation of bovine oocytes, which comprises a basic culture solution, 10-200 µg / L of delta-like ligand 3, 0.3-10 µmol / L of Vercirnon and 0.3-10 µmol / L of ML604086.
[0009] Preferably, the culture solution comprises a basic culture solution, 20-100 µg / L of delta-like ligand 3, 1-10 µmol / L of Vercirnon and 3-10 µmol / L of ML604086.
[0010] Preferably, the basic culture solution comprises 90-95% (v / v) of TCM199 culture solution, 3-5 IU / mL of pregnant mare serum gonadotropin, 3-5 IU / mL of luteinizing hormone, 1-10 ng / mL of estrogen, 95-105 IU / mL of penicillin, 95-105 μg / mL of streptomycin, 5-10% (v / v) of follicular fluid, 0.4-0.6 mg / mL of glucose, 1.8-2.3 mg / mL of sodium bicarbonate, 0.04-0.08 mg / mL of sodium pyruvate and 0.4-0.7 mg / mL of cysteine.
[0011] Preferably, the basic culture solution comprises 90% (v / v) of TCM199 culture solution, 5 IU / mL of pregnant mare serum gonadotropin, 4 IU / mL of luteinizing hormone, 5 ng / mL of estrogen, 100 IU / mL of penicillin, 100 μg / mL of streptomycin, 8% (v / v) of follicular fluid, 0.50 mg / mL of glucose, 2.10 mg / mL of sodium bicarbonate, 0.06 mg / mL of sodium pyruvate and 0.57 mg / mL of cysteine.
[0012] The application provides application of the composition or the culture solution in one or more of the following: non-disease diagnosis and non-disease treatment.
[0013] 1) reducing the apoptosis level of the bovine oocyte;
[0014] 2) reducing the autophagy level of the bovine oocyte;
[0015] 3) improving the development rate of bovine gene editing clone embryos;
[0016] 4) increasing the cell number of bovine gene editing clone embryos.
[0017] Preferably, the improvement of the development rate of bovine gene editing clone embryos comprises: improving the cleavage rate and / or blastocyst rate of bovine gene editing clone embryos.
[0018] The application provides a method for promoting in-vitro maturation of bovine oocytes and / or improving the quality of in-vitro maturation of bovine oocytes, comprising: using the culture solution to culture immature bovine oocytes in-vitro.
[0019] The application provides application of the method in improving the production efficiency and / or quality of bovine gene editing clone embryos.
[0020] Beneficial effects:
[0021] The application provides a composition for promoting development of bovine gene editing clone embryos, comprising: delta-like ligand 3, Vercirnon and ML604086; the mass molar ratio of the delta-like ligand 3 and the Vercirnon is 10-200 µg: 0.3-10 µmol; and the mass molar ratio of the delta-like ligand 3 and the ML604086 is 10-200 µg: 0.3-10 µmol. The application finds that: by precisely intervening at the small molecule level, synergistically adding three specific substances: delta-like ligand 3 (DLL3), Vercirnon and ML604086 in the bovine oocyte in-vitro maturation culture medium, the production efficiency and quality of clone embryos can be effectively improved, and there is a synergistic effect. The three substances act on different cell pathways, and together construct a microenvironment conducive to embryo development. The composition can effectively alleviate the stress suffered by clone embryos during reprogramming and early development, significantly reduce the apoptosis level and inhibit harmful excessive activation of autophagy, thereby reducing cell damage of the embryo and increasing the cell number of the embryo. This has important practical value and application prospect for improving the production efficiency and quality of gene editing clone embryos. BRIEF DESCRIPTION OF DRAWINGS
[0022] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the embodiments will be briefly introduced as follows.
[0023] Figure 1 The blastomere bright field images of the control group and the test group;
[0024] Figure 2 The results of the influence of the control group and the test group on the apoptosis and autophagy levels;
[0025] Figure 3 The results of the influence of the control group and the test group on the cell number of bovine gene editing clone blastocysts. DETAILED DESCRIPTION
[0026] The present application provides a composition for promoting the development of bovine gene editing clone embryos, comprising: delta-like ligand 3, Vercirnon and ML604086; the mass molar ratio of the delta-like ligand 3 and Vercirnon is 10-200 µg: 0.3-10 µmol; the mass molar ratio of the delta-like ligand 3 and ML604086 is 10-200 µg: 0.3-10 µmol.
[0027] As an implementation form, the mass molar ratio of the delta-like ligand 3 and Vercirnon is 20-100 µg: 1-10 µmol; the mass molar ratio of the delta-like ligand 3 and ML604086 is 20-100 µg: 3-10 µmol. As an implementation form, the mass molar ratio of the delta-like ligand 3 and Vercirnon is 100 µg: 10 µmol; the mass molar ratio of the delta-like ligand 3 and ML604086 is 100 µg: 10 µmol.
[0028] The present application provides a culture solution for in vitro maturation of bovine oocytes, comprising a basic culture solution, delta-like ligand 3 10-200 µg / L, Vercirnon 0.3-10 µmol / L and ML604086 0.3-10 µmol / L.
[0029] As an implementation form, the culture solution comprises a basic culture solution, delta-like ligand 3 20-100 µg / L, Vercirnon 1-10 µmol / L and ML604086 3-10 µmol / L. As an implementation form, the culture solution comprises a basic culture solution, delta-like ligand 3 100 µg / L, Vercirnon 10 µmol / L and ML604086 10 µmol / L.
[0030] As an embodiment, the basic culture solution comprises: TCM199 culture solution 90-95% (v / v), pregnant mare serum gonadotropin 3-5 IU / mL, luteinizing hormone 3-5 IU / mL, estrogen 1-10 ng / mL, penicillin 95-105 IU / mL, streptomycin 95-105 μg / mL, follicular fluid 5-10% (v / v), glucose 0.4-0.6 mg / mL, sodium bicarbonate 1.8-2.3 mg / mL, sodium pyruvate 0.04-0.08 mg / mL, and cysteine 0.4-0.7 mg / mL. As an embodiment, the basic culture solution comprises: TCM199 culture solution 90% (v / v), pregnant mare serum gonadotropin 5 IU / mL, luteinizing hormone 4 IU / mL, estrogen 5 ng / mL, penicillin 100 IU / mL, streptomycin 100 μg / mL, follicular fluid 8% (v / v), glucose 0.50 mg / mL, sodium bicarbonate 2.10 mg / mL, sodium pyruvate 0.06 mg / mL, and cysteine 0.57 mg / mL.
[0031] The present inventors have made in-depth research and a large number of experiments, and creatively put forward a brand-new solution, which is no longer limited to the traditional nutritional supplement idea, but starts from the regulation of key cell fate signaling pathways, aiming to fundamentally improve the "physical fitness" of oocytes. The present application precisely intervenes at the small molecule level, and synergistically adds three specific substances: delta-like ligand 3 (DLL3), Vercirnon (CCX282-B), and ML604086 in the bovine oocyte in vitro maturation culture medium. The three substances target the Notch-apoptosis, CCR9-mitochondria, and S1P3-autophagy three complementary pathways, respectively, can form a synergistic network of "anti-apoptosis-suppressed autophagy-promoted coupling", and can effectively improve the production efficiency and quality of cloned embryos, which is specifically manifested in higher cleavage rate and more practically meaningful blastocyst rate. The blastocyst is a key stage that can be used for embryo transfer and implantation, and the improvement of the rate directly means the improvement of the output efficiency of gene edited bovine individuals. The composition provided by the present application can effectively alleviate the stress suffered by cloned embryos during reprogramming and early development, significantly reduce the level of cell apoptosis and inhibit harmful excessive activation of autophagy, thereby reducing cell damage of embryos and increasing the number of embryo cells. This has important practical value and application prospect for improving the production efficiency and quality of gene edited cloned embryos.
[0032] Based on the above advantages, the composition described in the above technical solution or the culture solution described in the above technical solution is applied in one or more of the following applications, which are non-disease diagnosis and non-disease treatment:
[0033] 1) reducing the apoptosis level of bovine oocytes;
[0034] 2) reducing the autophagy level of the bovine oocyte;
[0035] 3) increasing the development rate of the bovine gene edited cloned embryo;
[0036] 4) increasing the cell number of the bovine gene edited cloned embryo.
[0037] As an implementation form, the method for increasing the development rate of the bovine gene edited cloned embryo comprises: increasing the cleavage rate and / or blastocyst rate of the bovine gene edited cloned embryo.
[0038] Based on the above advantages, the application provides a method for promoting in vitro maturation of bovine oocytes and / or improving the quality of in vitro maturation of bovine oocytes, comprising: using the culture solution in the above technical solution to culture the immature bovine oocytes in vitro.
[0039] Based on the above advantages, the application provides the application of the method in the above technical solution in improving the production efficiency and / or quality of bovine gene edited cloned embryos.
[0040] In order to further illustrate the application, the composition for promoting the development of bovine gene edited cloned embryos, the culture solution and the application thereof provided by the application are described in detail below in combination with examples and drawings, but they should not be understood as limiting the protection scope of the application.
[0041] Example 1: method for increasing the development rate of bovine gene edited cloned embryos
[0042] 1. In vitro maturation of oocytes
[0043] Bovine ovaries were collected from slaughterhouses and placed in physiological saline at 35°C, and transported back to the laboratory within 2 hours. Physiological saline was washed three times, and a 20G needle syringe containing 5 mL of oocyte suction liquid was used to puncture the follicle to release the cumulus oocyte complex. Under the stereomicroscope, bovine cumulus oocyte complexes with uniform cytoplasm and more than 3 layers of cumulus cells were collected. The selected bovine cumulus oocyte complexes were washed three times with oocyte suction liquid, and then washed three times with oocyte in vitro maturation basal culture medium pre-equilibrated in the incubator for 3 hours. Each well contained 600 μL of different in vitro maturation culture medium, 300 μL of mineral oil, and 30 bovine cumulus oocyte complexes were cultured in a four-well plate. Then the four-well plate was placed in a 5% CO2, 38.5°C saturated humidity incubator for 24 hours.
[0044] Composition of oocyte suction liquid: 49 mL TCM199 culture medium (purchased from Thermo Fisher, item number 11150059) and 1 mL fetal bovine serum (FBS).
[0045] The composition of the oocyte in vitro maturation basic culture solution is: TCM199 culture solution 90% (v / v), pregnant mare serum gonadotropin (PMSG) 5 IU / mL, luteinizing hormone (LH) 4 IU / mL, estrogen (E2) 5 ng / mL, penicillin 100 IU / mL, streptomycin 100 μg / mL, follicular fluid 8% (v / v), glucose 0.50 mg / mL, sodium bicarbonate 2.10 mg / mL, sodium pyruvate 0.06 mg / mL, and cysteine 0.57 mg / mL.
[0046] 2. On the basis, a plurality of test groups are respectively arranged, and the culture solution used in the test groups is obtained by adding different concentrations of DLL3, Vercirnon (CCX282-B, CAS number: 698394-73-9), ML604086 (CAS number: 850330-18-6) or combined addition in the oocyte in vitro maturation basic culture solution (denoted as a control group), and specific contents are shown in Tables 1-5.
[0047] 3. Gene editing of bovine fibroblasts
[0048] The ear edge tissue of a 3-month-old Holstein bull is digested by collagenase IV to obtain primary fibroblasts, which are cultured in DMEM+15% FBS to P3; 0.25% trypsin is used for digestion, and the number of cells is counted by using trypan blue, and the number of cells is adjusted to 5×10 5 cells / tube, and the cells are stored at 4°C. Cas12i (1 μg / μL) and BLG site crRNA (2 μg / μL, SEQ ID NO. 1) are mixed at a molar ratio of 1:1.2, incubated at 37°C for 15 min; 1.2×SSDNA (50 ng / μL, SEQ ID NO. 2) is added and incubated for 5 min to form an RNP-donor complex. After mixing the cell suspension with the RNP complex, the mixture is transferred into a 4 mm electroporation cup, and the parameters are as follows: 150 V, 5 ms, 2 pulses (Neon system). Immediately transfer into pre-warmed DMEM+10% FBS, and replace the culture medium containing 2 μg / mL puromycin after 48 h, and screen for 72 h. The cells are inoculated in a 96-well plate by limiting dilution, 1 cell per well; after 10 days, single clones are picked, the genome is extracted by Direct-PCR, the target sequence (SEQ ID NO. 3 and SEQ ID NO. 4) is amplified, and T7E1 enzyme digestion is used for preliminary screening; if the editing is successful, two bands (250 bp and 450 bp) consistent with the expected results will be generated, otherwise only a single band will be generated; the positive clone is sent for Sanger sequencing to verify the homozygous / heterozygous mutation and gene editing efficiency. The Cas12i is obtained from China Agricultural University and is disclosed in Chinese patent CN111757889A.
[0049] SEQ ID NO. 1: 5'-GCCATGGCGGCCAGCGACAT-3';
[0050] SEQ ID NO. 2:
[0051] 5'-GTGGCTGTGGTCTGCACAGACGACGGCTCCAAGGCCTGTGAGGCCGTGTGCCCTCCATCTGCACAGACTACCGGGTGCAGGGCACCGTGGTCGTCTCCTGCAGGTGGTGCAGCCCTGCAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC-3';
[0052] SEQ ID NO. 3: 5'-TTCTCCCTGTGTCCTTTGCG-3';
[0053] SEQ ID NO. 4: 5'-ATAAGCAGCCTTGGGTGGAC-3'.
[0054] 4. Preparation and culture of bovine gene edited cloned embryos
[0055] Fibroblasts were trypsinized and G0 / G1 cells (10-15 μm in diameter) were injected under the zona pellucida of enucleated oocytes. The fusion rate was observed after 1 h of treatment with 2 direct current pulses at 1.2 kV / cm and 30 μs. The fused embryos were activated with 5 μmol / L ionomycin for 4 min, followed by treatment with 2 mmol / L 6-DMAP and 10 μg / mL CHX for 4 h. After washing, the embryos were cultured in microdrops of mSOFaa+4 mg / mL BSA in a saturated humidity incubator at 38.5°C, 5% O2, 5% CO2, and 90% N2. The cleavage rate was recorded after 48 h, and the blastocyst rate was evaluated on day 7. High-quality blastocysts were used for transplantation or cryopreservation.
[0056] The fusion solution was 0.28 mol / L mannitol, 0.1 mmol / L MgSO4, 0.5 mmol / L HEPES, and 0.05% (v / v) BSA.
[0057] The mSOFaa culture solution was configured as follows: 6.34 g of NaCl, 0.54 g of KCl, 0.23 g of CaCl2·2H2O, 0.01 g of MgSO4·7H2O, 0.17 g of KH2PO4, 0.24 g of NaHCO3, 0.30 g of glucose, 0.04 g of sodium pyruvate, 5.8 mL of sodium lactate, 2% BME amino acid solution by volume, and 1% MEM non-essential amino acid solution by volume per 1 L. All reagents were purchased from Sigma-Aldrich.
[0058] II. Experimental results
[0059] 1. The effects of different concentrations of DLL3 on the development of bovine gene editing clone embryos are shown in Table 1.
[0060] The results show that the cleavage rate and blastocyst rate of the groups with the addition of 20 µg / L, 50 µg / L, 100 µg / L, and 200 µg / L DLL3 were significantly higher than those of the control group and the groups with the addition of 1 µg / L, 5 µg / L, 10 µg / L, and 500 µg / L DLL3.
[0061] Table 1. Effects of different concentrations of DLL3 added to in vitro maturation solution on the development rate of bovine gene editing clone embryos
[0062]
[0063] In the table, different superscripts (a, b, c) in the same column indicate significant differences between groups P <0.05, same below.
[0064] 2. The effects of different concentrations of Vercirnon on the development of bovine gene editing clone embryos are shown in Table 2.
[0065] The results show that the cleavage rate and blastocyst rate of the groups with the addition of 1 µmol / L, 3 µmol / L, and 10 µmol / L Vercirnon were significantly higher than those of the control group and the groups with the addition of 0.1 µmol / L, 0.3 µmol / L, and 30 µmol / L Vercirnon.
[0066] Table 2. Effects of different concentrations of Vercirnon added to in vitro maturation solution on the development rate of bovine gene editing clone embryos
[0067]
[0068] 3. The effects of different concentrations of ML604086 on the development of bovine gene editing clone embryos are shown in Table 3.
[0069] The results show that the cleavage rate and blastocyst rate of groups with 0.1 μmol / L, 0.3 μmol / L, 1 μmol / L, 3 μmol / L, 10 μmol / L, 30 μmol / L ML604086 added are not different from the cleavage rate and blastocyst rate of the control group.
[0070] Table 3 Effect of different concentrations of ML604086 added to in vitro maturation solution on the development rate of bovine gene editing clone embryos
[0071]
[0072] 4、DLL3 and Vercirnon combined treatment on the development of bovine gene editing clone embryos as shown in Table 4.
[0073] The results show that the cleavage rate and blastocyst rate of groups 5-8 are significantly higher than the cleavage rate and blastocyst rate of the control group and groups 1-4.
[0074] Table 4 Effect of combined addition of DLL3 and Vercirnon to in vitro maturation solution on the development rate of bovine gene editing clone embryos
[0075]
[0076] 5、DLL3, Vercirnon and ML604086 combined treatment on the development of bovine gene editing clone embryos as shown in Table 5.
[0077] The results show that the blastocyst rate of combined addition treatment groups 4-6 and treatment groups 8-10 is significantly higher than the blastocyst rate of the control group and treatment groups 1-3 and treatment group 7.
[0078] Table 5 Effect of combined addition of DLL3, Vercirnon and ML604086 on the development rate of bovine gene editing clone embryos
[0079]
[0080] Example 2 Combined addition of DLL3, Vercirnon and ML604086 improves the quality of bovine gene editing clone embryos
[0081] I. Experimental design and experimental methods
[0082] 1. Grouping and culture
[0083] Control group: immature oocytes were cultured in vitro for 24 h in in vitro maturation basal medium;
[0084] Test group: immature oocytes were cultured in the in vitro maturation basal medium with the combined addition of 100 μg / L DLL3, 10 μmol / L Vercirnon and 10 μmol / L ML604086 for 24 h.
[0085] Oocyte in vitro maturation, in vitro fertilization and embryo culture were performed according to the method described in Example 1. The bovine cumulus-oocyte complexes were collected, and the oocytes were cultured using the in vitro maturation medium described above, while the preparation and culture of bovine genetically edited cloned embryos were performed according to the method described in Example 1.
[0086] 2. Apoptosis detection
[0087] The mature oocytes were collected and washed twice with 0.1% PVA-PBS. The washed oocytes were fixed in 4% PFA fixing solution at 4°C for 2 h. The oocytes were washed three times with 0.1% PVA-PBS and transferred to 0.5% Triton X100-0.1% PVA-PBS permeation solution for 1 h. The oocytes were transferred to cell DNA damage detection solution (C1091, Biyun Tian) and incubated at 37°C for 1 h. The oocytes were washed three times with 0.1% PVA-PBS and incubated in 20 μL DAPI staining solution for 5 min. The oocytes were photographed under a fluorescence microscope. The number of TUNEL-positive signal cells was taken as the number of apoptotic cells, and the number of DAPI-positive signal cells was taken as the total number of cells. The apoptosis rate was calculated as follows: apoptosis rate = (number of TUNEL-positive signal cells / number of DAPI-positive signal cells) x 100%.
[0088] 3. Western blot detection
[0089] SDS-PAGE electrophoresis was performed according to the protein molecular weight. The samples were mixed with the loading buffer and heated for denaturation, and then loaded. The concentrated gel was run at 80V, and the separation gel was run at 120V until the indicator reached the bottom. The membrane was activated with methanol, and then assembled according to the order of "negative electrode-filter paper-gel-membrane-filter paper-positive electrode". Wet transfer was performed at 100V for 60-90 min. The membrane was blocked with 5% skim milk for 1-2 h. The membrane was incubated with the diluted primary antibody at 4°C overnight, and then washed with TBST. The secondary antibody was incubated at room temperature for 1-2 h. Finally, the signal was detected using ECL developing solution, and the relative expression amount was calculated by correcting the loading amount with the internal reference.
[0090] 4. Protein immunofluorescence staining
[0091] The gene editing clone blastocyst is washed twice with 0.1% PVA-PBS buffer, and then is placed in 4% PFA fixing solution, and is fixed in a refrigerator at 4°C for 2 hours; then is washed three times with 0.1% PVA-PBS, and is transferred to 0.5% TritonX100-0.1% PVA-PBS permeation liquid for permeation for 1 hour; then is transferred to SOX2 and CDX2 primary antibodies (purchased from abcam company, and the article numbers are ab97959 and ab76541 respectively), and is incubated in a 37°C incubator for 1 hour; after the incubation is completed, the blastocyst is washed three times with 0.1% PBS-PVA, is placed in 20 μL DAPI staining solution for incubation for 5 minutes, and is photographed under a fluorescence microscope, and the number of cells is counted.
[0092] II. Experimental results
[0093] As shown in Figure 1 , the number and diameter of the blastocysts in the test group are obviously higher than those in the control group.
[0094] The effects of the control group and the test group on the apoptosis and autophagy levels are shown in Figure 2 , wherein A is the apoptosis staining (TUNEL) diagram of the control group and the test group; B is the apoptosis protein and autophagy protein immunoblotting diagram of the control group and the test group. The results show that the apoptosis rate of the test group (1.83±0.02%) is significantly lower than that of the control group (7.61±0.44%), and the apoptosis proteins CASPASE3 and the autophagy proteins LC3B, ATG12-ATG5 and ATG5 of the test group are significantly lower than those of the control group, while the anti-autophagy protein P62 of the test group is higher than that of the control group.
[0095] The effects of the control group and the test group on the number of bovine gene editing clone blastocyst cells are shown in Figure 3 , wherein A is the blastocyst cell staining diagram of the control group and the test group, the green color is the trophoblast cells (CDX2 positive), the red color is the inner cell mass cells (SOX2 positive), and the blue color is the total cells (DAPI positive); B is the total cell number statistical results of the control group and the test group; C is the proportion of the inner cell mass cells to the total cells of the control group and the test group. The results show that the total cell number of the test group (112.57±8.11%) is significantly higher than that of the control group (83.18±5.36%), and the proportion of the inner cell mass cells to the total cells (39.23±5.01%) is significantly higher than that of the control group (27.33±8.61%).
[0096] In summary, by detecting a series of embryo quality evaluation indexes, the method provided by the present application can significantly improve the quality of bovine gene editing clone embryos, and has an important influence on improving the efficiency of animal cloning technology.
[0097] Although the above embodiments have been described in detail, it should be understood that these are only some embodiments of the present application, but not all embodiments. Other embodiments can be obtained on the basis of the above embodiments without creativity, and these embodiments all belong to the protection scope of the present application.
Claims
1. A composition for promoting the development of bovine gene-edited cloned embryos, characterized in that, include: The δ-ligand 3, Vercirnon, and ML604086 are present; the molar ratio of δ-ligand 3 to Vercirnon is 10~200 µg: 0.3~10 µmol; the molar ratio of δ-ligand 3 to ML604086 is 10~200 µg: 0.3~10 µmol.
2. The composition according to claim 1, characterized in that, The mass molar ratio of the δ-sample ligand 3 to Vercirnon is 20~100 µg: 1~10 µmol; the mass molar ratio of the δ-sample ligand 3 to ML604086 is 20~100 µg: 3~10 µmol.
3. A culture medium for in vitro maturation of bovine oocytes, characterized in that, This includes basal culture medium, δ-sample ligand 3 10~200 µg / L, Vercirnon 0.3~10 µmol / L, and ML604086 0.3~10 µmol / L.
4. The culture medium according to claim 3, characterized in that, This includes basal culture medium, δ-sample ligand 3 20~100 µg / L, Vercirnon 1~10 µmol / L, and ML604086 3~10 µmol / L.
5. The culture medium according to claim 3 or 4, characterized in that, The basic culture medium includes: 90-95% (v / v) TCM199 culture medium, 3-5 IU / mL pregnant mare serum gonadotropin, 3-5 IU / mL luteinizing hormone, 1-10 ng / mL estrogen, 95-105 IU / mL penicillin, 95-105 μg / mL streptomycin, 5-10% (v / v) follicular fluid, 0.4-0.6 mg / mL glucose, 1.8-2.3 mg / mL sodium bicarbonate, 0.04-0.08 mg / mL sodium pyruvate, and 0.4-0.7 mg / mL cysteine.
6. The culture medium according to claim 5, characterized in that, The basic culture medium includes: 90% (v / v) TCM199 medium, 5 IU / mL pregnant mare serum gonadotropin, 4 IU / mL luteinizing hormone, 5 ng / mL estrogen, 100 IU / mL penicillin, 100 μg / mL streptomycin, 8% (v / v) follicular fluid, 0.50 mg / mL glucose, 2.10 mg / mL sodium bicarbonate, 0.06 mg / mL sodium pyruvate, and 0.57 mg / mL cysteine.
7. The use of the composition of claim 1 or 2 or the culture medium of any one of claims 3 to 6 in one or more of the following, wherein the use is for non-disease diagnosis and non-disease treatment: 1) Reduce the level of apoptosis in bovine oocytes; 2) Reduce the autophagy level in bovine oocytes; 3) Improve the development rate of bovine gene-edited cloned embryos; 4) Increase the number of cells in bovine gene-edited cloned embryos.
8. The application according to claim 7, characterized in that, The improvement of bovine gene-edited cloned embryo development rate includes: improving the cleavage rate and / or blastocyst rate of bovine gene-edited cloned embryos.
9. A method for promoting in vitro maturation of bovine oocytes and / or improving the quality of in vitro maturation of bovine oocytes, characterized in that, include: Immature bovine oocytes were cultured in vitro using the culture medium described in any one of claims 3 to 6.
10. The application of the method of claim 9 in improving the production efficiency and / or quality of bovine gene-edited cloned embryos.
Citation Information
Patent Citations
Novel crispr / cas12f enzyme and system
CN111757889A
Medical use of notch4 or inhibitors thereof
US20200022998A1
Diagnostics and therapeutics for diseases associated with chemokine receptor 9(CCR9)
WO2003095967A2