Construction method and application of matrigel Teteterocyte immortalized cell line

Abstract

The invention discloses a construction method and application of a matrigel suppository telocyte immortalized cell line, which comprises the following steps: recruiting in vivo matrigel suppository, sorting telocytes by CD34 immunomagnetic beads, and combining SV40T transduction to establish the telocyte immortalized cell line. And carrying out morphological observation, specific marker detection and functional verification to identify that the obtained cell line is the teterocyte. According to the construction method, the teterocyte closer to the in-vivo functional state can be efficiently obtained, and the obtained cell line can be stably passaged for a long time and maintain the morphological characteristics and biological functions of primary cells; a stable and reliable tool is provided for in-vitro research such as subcutaneous microenvironment research, drug screening and cell therapy, tissue engineering and regenerative medicine and continuous in-depth research in related fields, and the method has wide application value in multiple scientific research fields such as tissue engineering model construction, intercellular interaction research and drug effect evaluation.

Description

Technical Field

[0001] This invention relates to a method for constructing an immortalized Terois cell line and its application, and more particularly to a method for constructing an immortalized Terois cell line using matrix glitch and its application. Background Technology

[0002] Matrigel, an extract of the basement membrane matrix, is rich in extracellular matrix components and growth factors. Subcutaneous injection to form matrigel plugs has been widely used in in vivo angiogenesis studies and cell recruitment experiments. This in vivo microenvironment can effectively recruit various cell types, including endothelial cells, progenitor cells, and mesenchymal cells.

[0003] Telocytes are a type of mesenchymal cell with distinctive morphological characteristics. These cells are characterized by extremely long cytoplasmic processes (telopodes), exhibiting a beaded structure, and are widely distributed in various organs and tissues, including the heart, lungs, liver, skin, and reproductive system. Telocytes participate in key biological processes such as cell signal transduction, tissue homeostasis maintenance, stem cell nest regulation, and tissue repair and regeneration by forming intercellular network structures. Studies have shown that Telocytes also play an important regulatory role in the stromal microenvironment, inflammatory responses, and fibrotic diseases.

[0004] Currently, research on Terois cells faces significant technical challenges: First, obtaining primary Terois cells from fascia and mesenchyme is difficult, and traditional isolation methods typically require complex tissue digestion and cell separation steps, resulting in low cell yields; second, primary cells have limited proliferative capacity under in vitro culture conditions, and usually exhibit senescence and loss of function after 3-4 passages; furthermore, primary cell culture suffers from large batch-to-batch variations and poor experimental reproducibility, severely restricting in-depth research on their biological functions in the microenvironment, extracellular matrix interactions, and disease mechanisms.

[0005] In summary, current technologies cannot solve the problem of the scarcity of primary Terois cells, nor are there simple and efficient methods for constructing immortalized Terois cell lines. Summary of the Invention

[0006] Purpose of the invention: The purpose of this invention is to provide a method for constructing an immortalized Teronasal cell line based on in vivo matrix plug recruitment and positive sorting of specific marker proteins, and its application.

[0007] Technical solution: The method for constructing the matrix gel plug-Trocomy cell immortalized cell line includes the following steps: S10. In vivo preparation of matrix gel plugs and cell recruitment: The matrix gel was implanted into the experimental animals via subcutaneous injection to form matrix gel plugs and recruit cells. S20. Cell isolation and purification: Remove the matrix plug and release the cells inside the plug. Use CD34 immunomagnetic bead sorting technology to isolate high-purity NAT cells from the mixed cell population. S30, Immortification treatment: The isolated and purified primary Teroblastic cells were co-cultured with lentiviral particles containing pGMLV-SV40T-PURO plasmid, and immortalized cell lines were obtained by screening with puromycin. S40. Cell line identification: Morphological observation, detection of specific markers, and functional verification of immortalized cell lines.

[0008] In step S10, the in vivo culture time of the matrix gel plug is 14-21 days to ensure that a sufficient number of Terois cells are recruited into the plug, preferably 14 days; the experimental animal is a mouse. Terois cells in vivo are recruited using the extracellular matrix components and growth factors in the matrix gel.

[0009] In step S20, the CD34 immunomagnetic bead sorting technology adopts a positive sorting strategy, with a sorting purity of over 90%, preferably over 95%; and releases intrathrombus cells through enzymatic digestion.

[0010] In step S30, the lentiviral particles are transduced under infection conditions with a multiple of infection (MOI) of 40-100, and the transduction time is 12-24 hours; preferably, the MOI is 40 and the transduction time is 24 hours.

[0011] In step S40, the specific biomarker is the Trident cell characteristic biomarker CD34 or Pdgfra; the detection of the specific biomarker is immunofluorescence detection.

[0012] The present invention also provides a Tropocell immortalized cell line obtained by the above construction method.

[0013] The immortalized Terois cell line has the following characteristics: (1) it expresses Terois cell-specific markers CD34 and Pdgfra; (2) it maintains typical Terois cell morphology with slender cytoplasmic protrusions; (3) it can be stably passaged in vitro for more than 50 generations and maintain stable biological characteristics; (4) it has extracellular matrix secretion function and intercellular communication ability similar to primary cells.

[0014] The Terois immortalized cell line can be used to prepare tissue engineering models, drug screening platforms, or regenerative medicine research tools.

[0015] The inventors discovered that matrix gel plugs can recruit NAT cells. Based on this, this invention innovatively employs a technical route combining in vivo matrix gel plug recruitment with CD34 magnetic bead sorting. First, NAT cells are recruited and enriched through the in vivo microenvironment. Then, a high-purity cell population is obtained through CD34 immunomagnetic bead sorting. Finally, cell immortalization is achieved using a pGMLV-SV40T-PURO plasmid-mediated lentiviral transduction system. This method not only solves the problem of the scarcity of primary NAT cell sources but also better preserves the functional characteristics of cells under physiological conditions, providing a reliable technical platform for NAT cell research.

[0016] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: 1. The construction method innovatively adopts an in vivo matrix plug recruitment strategy to better simulate the physiological microenvironment, so that the obtained Terois cells maintain a functional state closer to that in vivo; high-purity cell populations are obtained by sorting with CD34 immunomagnetic beads, avoiding the cell contamination problem in traditional separation methods; the SV40T-mediated immortalization technology successfully solves the problem of limited proliferation capacity of primary Terois cells, and establishes a stable cell line that can be passaged for a long time. 2. The resulting immortalized cell lines can be stably passaged and maintain the morphological characteristics and biological functions of primary Terois cells, providing a stable and reliable tool for in vitro research and related fields such as subcutaneous microenvironment research, drug screening and cell therapy, tissue engineering and regenerative medicine. It has broad application value in multiple scientific research fields such as tissue engineering model construction, cell-cell interaction research, and drug effect evaluation. Attached Figure Description

[0017] Figure 1 A schematic diagram illustrating the process of constructing the mouse matrix gel thrombus-type cell immortalization line (TCs40); Figure 2 Immunofluorescence detection of CD34 and Pdgfra, specific markers of telogen plexus cells in mouse matrix glitch; Figure 3 Flow cytometry results of CD34 in cells after CD34 immunomagnetic bead positive sorting; Figure 4 Comparison of infected and uninfected Trenafil cells for puromycin screening; Figure 5 Comparison chart of different generations of TCs40; Figure 6 RT-PCR detection of SV40T gene expression within TCs40; Figure 7 The growth curve of TCs40 cells; Figure 8Immunofluorescence detection of TCs40 specific markers CD34 and Pdgfra; Figure 9 This is a karyotype analysis diagram of TCs40; Figure 10 Plate clone detection for TCs40; Figure 11 Microscopic images of TCs40 plate clone detection. Detailed Implementation

[0018] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0019] Example

[0020] This embodiment provides a method for constructing a matrix gel plug-type Terois cell immortalized cell line, comprising four steps: S10, in vivo matrix gel plug preparation and cell recruitment; S20, cell isolation and purification; S30, immortalization treatment; and S4, cell line identification. The construction process is described below. Figure 1 The details are as follows: S10. In vivo preparation of matrix gel plugs and cell recruitment: Matrix gel was injected subcutaneously into mice to form matrix gel plugs. The extracellular matrix components and growth factors in the matrix gel were used to recruit in vivo NAT cells. Compared with traditional in vitro isolation methods, in vivo matrix gel plug recruitment can better enrich NAT cells, resulting in a higher proportion of NAT cells than ordinary animal tissues. It is also easier to isolate NAT cells, providing a high-quality cell source for subsequent immortalization processes.

[0021] In this invention, the matrix gel plug is prepared by the following steps: Prepare 6-8 week old C57BL / 6 mice, weighing 18-22g, SPF grade. Thaw Corning Matrigel® matrix gel overnight at 4°C before use. Draw 300μL of the thawed matrix gel into a 1mL sterile syringe and mix in basic fibroblast growth factor (bFGF) to a final concentration of 200ng / ml. Disinfect the groin skin of the mice with 75% ethanol, inject the matrix gel subcutaneously, keeping the needle at a 30° angle to the skin during injection, and slowly push to form a uniform plug.

[0022] Observe the mice after injection to ensure there are no abnormal reactions. House them individually with ample drinking water and standard feed. Observe the injection site daily for signs of redness, swelling, or infection.

[0023] The matrix-coated plugs were cultured in vivo for 14 days, during which plug formation was observed regularly. On day 14, the plugs were removed: mice were anesthetized with isoflurane, the groin skin was thoroughly disinfected with 75% ethanol, the skin was incised along the injection site, the matrix-coated plug was carefully dissected, and the surrounding connective tissue was separated. The removed matrix-coated plug was immediately placed in pre-cooled PBS, and the wound was sutured. All procedures should be performed in a laminar flow hood. Successful plugs should be pink and homogeneous in texture. Figure 2 The immunofluorescence results showed that there were a large number of CD34 and Pdgfra double-positive slender cells inside the matrix plug, which could be identified as Terois cells.

[0024] S20. Cell isolation and purification: Remove the matrix plug, release the cells inside the plug by enzymatic digestion, and use CD34 immunomagnetic bead sorting technology to separate high-purity NAT cells from the mixed cell population. Remove the matrix plugs cultured in mice for 14 days and immediately place them in pre-cooled PBS buffer. Prepare a digestion solution using collagenase I, neutral protease, and DNase I, filter to remove bacteria, and store at 4°C for later use. Simultaneously prepare basic reagents such as fetal bovine serum, DMEM / F-12 medium, and PBS buffer.

[0025] Transfer the matrix plug to a sterile culture dish and wash three times with pre-cooled PBS. Cut the plug into small pieces using sterile surgical scissors and add 10 mL of digestion solution. The digestion solution mainly consists of type I collagenase, neutral protease, and DNase I. Place in a horizontal shaker at 37°C and digest at 100 rpm for 30 minutes. Gently pipette the solution every 10 minutes during digestion.

[0026] Add an equal volume of DMEM / F-12 medium containing 10% fetal bovine serum to terminate digestion. Filter the cell suspension through a 40 μm cell sieve and collect the filtrate. Centrifuge at 2000 rpm for 15 min, discard the supernatant, and resuspend the cell pellet in PBS. Repeat the centrifugation and washing steps twice, and finally resuspend the cells in 2 mL of PBS.

[0027] The magnetic bead sorting procedure is as follows: Take 100 μL of cell suspension (approximately 1 × 10⁻⁶ cells / mL) 7 Add 10 μL of CD34 microbeads to each cell, mix well, and incubate at 4°C for 30 min. Wash with 1 mL of PBS and centrifuge at 500 g for 10 min. Discard the supernatant and resuspend the cells in 500 μL of PBS. Place the sorting column in a magnetic field and rinse the column with 500 μL of PBS. Load the cell suspension onto the sorting column and wash three times with 500 μL of PBS. Remove the sorting column, add 1 mL of PBS, and quickly push the plunger to collect CD34-positive cells.

[0028] The sorted CD34-positive cells were resuspended in DMEM / F-12 complete medium (containing 10% FBS and 1% penicillin antibiotics). They were then seeded in T25 cell culture flasks and cultured at 37°C in a 5% CO2 incubator. After 24 hours, the medium was replaced with fresh medium, and non-adherent cells were removed. The medium was changed every 2 days thereafter, and the cells were passaged when they reached 80-90% confluence.

[0029] After sorting, a portion of the cells were used for flow cytometry to detect CD34 expression levels. Figure 3 As shown, the required sorting purity is 90% or higher. Cell morphology observation should show typical Tranexamic cell characteristics: small cell body with slender cytoplasmic protrusions.

[0030] Step S30, Immortality Treatment: The isolated and purified primary mouse Terato cells are co-cultured with lentiviral particles containing the pGMLV-SV40T-PURO plasmid. Immortized cell lines are obtained through puromycin selection. In this invention, the lentiviral particles containing the pGMLV-SV40T-PURO plasmid are called pGMLV-SV40T-PURO (product name: pGMLV-EF1a-SV40T-PuroLentivirus; product number: GM-0220LV23), used to transform or transfect plasmids containing the target gene into cells to achieve protein overexpression. The selection of a suitable expression vector depends on factors such as protein type, host organism, and specific research objectives.

[0031] Primary mouse matrix gel plugged teratolytic cells were seeded into 6-well plates, with approximately 1 x 10 cells per well. 5 On the second day, after the cells adhered to the culture plate, the medium was changed, 1 mL of complete culture medium was added, followed by 80 μL of SV40T lentivirus. The mixture was then stirred and cultured for another 24 hours. The cell status was observed, and the medium was replaced with fresh medium. Once the cells had reached confluence with the plate, they were passaged into T25 culture flasks to obtain transfected cells. The transfected cells were then divided into groups of 5 x 10n cells per well. 4 Cells were seeded into 24-well plates and incubated overnight. The next day, the old culture medium was removed from the 24-well plates, and selection medium containing puromycin (2 μg / mL) was added for incubation. The selection medium was replaced with fresh medium every two days, and the cell viability rate was observed daily (see [link to article]). Figure 4 Cells that survive for 3 days after culture are considered successfully transfected cells, resulting in a mouse matrix glottyl thrombus-Tornet cell immortalized cell line. The selected cells are then expanded, and the confluent cells are digested, added to cell cryopreservation solution, and transferred to cryovials for storage at -80°C.

[0032] This method is the first to propose a way to construct an immortalized mouse matrix glitch-mediated NAT cell line, named TCs40, laying the foundation for studying the relevant morphological characteristics of NAT cells. For the screening results, please refer to [link to relevant documentation]. Figure 5As shown: the morphology of the cells in the 5th, 10th and 20th generations after screening tends to be consistent with that of the primary cells, indicating that the immortalized cell line was successfully constructed.

[0033] S40. Cell line identification: Morphological observation, detection of specific markers, and functional verification of immortalized cell lines.

[0034] The main procedures include: RT-PCR detection of exogenous gene (SV40T) expression, plotting TCs40 growth curves, detection of TCs40 teratocellular-specific protein expression, TCs40 karyotype analysis, and TCs40 plate colony formation assay.

[0035] The procedure for detecting the expression of the exogenous gene (SV40T) by RT-PCR is as follows: Total mRNA extraction: Wash TCs40 twice with PBS, then add 1 mL Trizol to lyse cells. Incubate at room temperature for 5 min, collect the mRNA in 2 mL enzyme-free EP tubes, add 200 μL of chloroform to each tube, vortex vigorously for 30 s, incubate at room temperature for 5 min, centrifuge at 12000g for 15 min at 4℃, and transfer the supernatant (approximately 400-500 μL) to a new 1.5 mL EP tube. Add an equal volume of isopropanol, mix by inverting, incubate at room temperature for 10 min, and centrifuge at 12000g for 10 min at 4℃. A white precipitate (mRNA) will be visible at the bottom of the tube. Discard the supernatant and add 1 mL of... Use 75% alcohol to rinse the tube walls by inverting the tube. Centrifuge at 12000g for 5 minutes at 4℃, discard the supernatant, and remove as much residual liquid as possible from the tube. Place the tube in a clean bench and let it air dry for about 5 minutes. Add 30μL of sterile, enzyme-free water to each tube, vortex to mix, and determine the mRNA concentration and OD260 / OD value. Qualified samples are stored at -80℃.

[0036] cDNA reverse transcription: Follow the instructions for the cDNA reverse transcription kit.

[0037] Primer design and synthesis: Primer design and synthesis steps: Primers for PCR analysis were designed using the NCBI gene database, and the sequences were verified by BLAST in NCBI. Specifically, the upstream nucleotide sequence of the SV40T primer is: TGGAAACCAAGTGCGACGAC; the downstream nucleotide sequence is: CGGCGAAGATAGCGGCATTA.

[0038] RT-PCR procedure: Follow the instructions for the SBYR Green MIX kit.

[0039] Experimental results are as follows Figure 6 As shown: The SV40T gene is expressed in TCs40.

[0040] The steps for plotting the TCs40 growth curve are as follows: TCs40 were seeded at a rate of 5000 cells / well in 96-well plates, with 100 μL of culture medium per well. There were 8 groups, with 3 wells per group. Every 24 hours, one group was selected, and 10 μL of CCK8 was added to each well. The plates were incubated at 37°C in the dark for 2 hours. The OD value of each well was measured at 450 nm, and the measurements were repeated for 5 days. A growth curve was plotted with time on the x-axis and OD value on the y-axis.

[0041] Experimental results are as follows Figure 7 As shown: Day 1 of the 30th generation TCs40 is the latent period. On days 2-3, it enters the exponential growth phase and has strong proliferative activity. On day 4, the cells gradually enter the proliferation plateau phase. At this time, the cells should be passaged or the medium changed in time to prevent cell senescence or death.

[0042] The immunofluorescence detection procedure for TCs40-specific proteins is as follows: Experimental method: Cell smears were placed in 24-well plates, and 1 mL of culture medium and 2 x 10⁻⁶ TCs were added to each well. 4 Cells / well. Incubate for 24 hours. After cell migration onto the slide, aspirate the culture medium, wash once with PBS, add 4% paraformaldehyde and fix at 4°C for 30 minutes. Wash with PBS 3 x 5 minutes each time. Alternatively, do not aspirate the PBS for the last time, incubate at 4°C overnight, remove moisture from the slide, place it on a culture dish support, and prepare the glass slide blocking solution: mix 0.5% Trition X~100 with PBS 1:1, add 10% serum, and drop 50 μL of the membrane rupture blocking solution onto a waterproof membrane. Cover the slide with the cell-containing side for 2 hours. After membrane rupture and blocking, place 50 μL of primary antibody on a waterproof membrane, cover the slide (cell-containing side), and incubate at 4°C in the dark for 2 hours with secondary antibody. Wash with PBS 3 x 5 minutes each time, stain with DAPI for 5 minutes, and wash with PBS 3 x 5 minutes each time. Place 1 drop of anti-quenching mounting medium on each slide and cover with the cell-containing side. Observe under a fluorescence microscope.

[0043] Experimental results are as follows Figure 8 As shown: TCs40 is positive for CD34 and Pdgfra, proving that the cell is a Terois cell.

[0044] The specific method for karyotype analysis of TCs40 is as follows: Add logarithmic growth phase TCs40 cells to a 10cm cell culture dish and allow them to grow to 70-80%. Remove TCs40 cells from the incubator, add colchicine (final concentration 0.2μg / mL), mix well, and incubate for 1.5h. Prepare a hypotonic solution (0.075M KCl) and preheat in a 37℃ water bath. Digest the incubated cells with trypsin, add whole culture medium to stop the digestion, resuspend the cells, centrifuge, discard the culture medium, resuspend in 8mL of hypotonic solution, collect in a centrifuge tube, mix well, and incubate in a 37℃ water bath for 25min. Add 1mL of freshly prepared fixative (methanol:glacial acetic acid = 3:1), mix well, incubate at room temperature for 10min, then centrifuge at 1500rpm for 10min, discard the supernatant (retain 500μL, first resuspend the cells at the bottom), add 8mL of fresh fixative, centrifuge at 1500rpm for 10min, repeat three times, discard the supernatant, and resuspend the cell pellet in an appropriate amount of fixative. Cell suspensions were dropped onto slides at an angle, with the slides tilted to a height of approximately 20 cm. The slides were then aged in a 60°C oven for 4 hours. Next, the slides were immersed in a 0.25% trypsin solution and bathed in a 37°C water bath for 5 minutes. The dried slides were then stained with Giemsa stain for 20 minutes. After rinsing off the stain with running water, the chromosomes were counted and the karyotype analyzed using an oil immersion microscope under an upright orientation.

[0045] Experimental results are as follows Figure 9 As shown, TCs40 still had 40 chromosomes at the 25th generation, with no loss or doubling. The cell line was still diploid, and the G-banded chromosome morphology was highly similar to the mouse karyotype.

[0046] The steps for plate cloning TCs40 cells are as follows: First, prepare TCs40 cells and HELA cells in logarithmic growth phase. Prepare a single-cell suspension using 0.25% trypsin digestion and adjust the cell concentration to 1×10⁻⁶ cells using a cell counting chamber. 3 Cells / mL; then, the cell suspension was seeded into 6-well plates at densities of 500 / 1000 / 2000 cells per well, with 2 mL of complete culture medium added to each well. The plates were gently shaken to ensure even cell distribution, and then incubated at 37°C in a 5% CO2 incubator. The culture medium was replaced with fresh medium every 3 days to maintain nutrient supply. After 10-14 days of culture, when clonal formation was visible to the naked eye, the culture medium was aspirated, and the cells were gently washed twice with PBS. The cells were then fixed with 4% paraformaldehyde at room temperature for 30 minutes, washed again with PBS, and stained with 0.1% crystal violet for 20 minutes. Excess stain was removed by slowly rinsing with running water, and the cells were air-dried at room temperature. Finally, cell clusters with a diameter greater than 50 μm were counted under a microscope to define clones, and the cloning rate (clone number / seeded cell number × 100%) was calculated to evaluate the proliferation capacity and single-cell cloning efficiency of TCs40 cells.

[0047] Experimental results are as follows Figure 10As shown, TCs40 can form clones, but the efficiency is far lower than that of HELA, and TCs40 does not have tumorigenicity. Figure 11 As shown, TCs40 requires strong intercellular connections to grow, and its migration ability is much higher than that of HELA.

[0048] In summary, the mouse matrix glottyl thrombus-teratophore (TCs40) immortalized cell line prepared by the method of constructing mouse matrix glottyl thrombus-teratophore cell line can maintain the biological characteristics of primary teratophore cells, express teratophore cell-specific marker proteins (such as CD34 and Pdgfra), and this cell line can be stably passaged for more than 50 generations, completely solving the limitations of primary cells such as limited passage number and easy aging, and providing effective support for microenvironment research, drug screening platforms and regenerative medicine tools.

Claims

1. A method for constructing a matrix gel plug-type teratolytic cell immortalized cell line, characterized in that, Includes the following steps: S10. In vivo preparation of matrix gel plugs and cell recruitment: The matrix gel was implanted into the experimental animals via subcutaneous injection to form matrix gel plugs and recruit cells. S20. Cell isolation and purification: Remove the matrix plug and release the cells inside the plug. Use CD34 immunomagnetic bead sorting technology to isolate high-purity NAT cells from the mixed cell population. S30, Immortification treatment: The isolated and purified primary Teroblastic cells were co-cultured with lentiviral particles containing pGMLV-SV40T-PURO plasmid, and immortalized cell lines were obtained by screening with puromycin. S40. Cell line identification: Morphological observation, detection of specific markers, and functional verification of immortalized cell lines.

2. The construction method as described in claim 1, characterized in that, The in vivo culture time for the matrix plugs described in step S10 is 14-21 days.

3. The construction method as described in claim 1, characterized in that, The experimental animal mentioned in step S10 is a mouse.

4. The construction method as described in claim 1, characterized in that, The CD34 immunomagnetic bead sorting technology described in step S20 adopts a positive sorting strategy, and the sorting purity reaches more than 90%.

5. The construction method as described in claim 1, characterized in that, In step S20, intrathrombus cells are released by enzymatic digestion.

6. The construction method as described in claim 1, characterized in that, The transduction of lentiviral particles in step S30 uses an infection condition with a multiple of infection (MOI) of 40-100 and a transduction time of 12-24 hours.

7. The construction method as described in claim 1, characterized in that, The specific marker mentioned in step S40 is CD34 or Pdgfra.

8. The construction method as described in claim 1, characterized in that, The specific biomarker detection described in step S40 is an immunofluorescence detection.

9. A Tropocell immortalized cell line obtained by constructing any one of claims 1-8.

10. The application of the Terois immortalized cell line of claim 9 in the preparation of tissue engineering models, drug screening platforms, or regenerative medicine research tools.

Images