Multivalent influenza mRNA vaccine

Abstract

The present disclosure provides multivalent influenza vaccine compositions comprising at least three messenger RNAs (mRNA) encoding a combination of influenza A and influenza B hemagglutinin (HA) antigens, and methods of eliciting an immune response by administering the same, wherein the mRNA encoding the HA antigen of the influenza A virus is present in a different ratio (w / w) to the mRNA encoding the influenza B virus. In particular, the disclosure relates to mRNA encoding these antigens formulated into lipid nanoparticles (LNPs).

Description

Cross-references to related applications

[0001] This application claims priority to European Patent Application Serial No. 23315259.4, filed on 28 June 2023, the disclosure of which is hereby incorporated by reference in its entirety. Background Technology

[0002] Messenger RNA (mRNA)-based vaccines offer a promising alternative to traditional subunit vaccines containing pathogen-derived antigenic proteins. Antigenic proteins are typically prepared recombinantly and require bacterial fermentation and / or cell culture, as well as complex purification processes. mRNA-based vaccines can de novo express complex antigens in vaccinated subjects, allowing for appropriate post-translational modifications and presentation of the antigen in its native conformation. Unlike traditional techniques, mRNA vaccine manufacturing does not require complex and expensive bacterial fermentation, tissue culture, and purification processes. Furthermore, once established, mRNA vaccine manufacturing methods can be used for a variety of antigens, enabling rapid development and deployment. Additionally, because mRNA vaccines only transiently express antigens and do not integrate into the host genome, they are inherently safe delivery vectors. Because the antigen encoded by mRNA is produced within the vaccinated individual, mRNA vaccines are particularly effective in inducing humoral and T-cell-mediated immunity.

[0003] Currently, mRNA-based multivalent influenza vaccines under investigation encode hemagglutinin (HA) antigens from both influenza A and influenza B viruses at an equal (w / w) ratio. While these vaccines are immunogenic, ongoing trials have shown that influenza B strains are less immunogenic than influenza A strains, and the immune response to influenza B virus after vaccination with these vaccines is not ideal. Therefore, there is a need for multivalent mRNA-based influenza vaccines with improved immunogenicity against influenza B. Summary of the Invention

[0004] In one aspect, this disclosure provides a composition comprising at least three messenger RNAs (mRNAs), wherein the at least three mRNAs comprise an open reading frame (ORF) encoding a hemagglutinin (HA) antigen, the at least three mRNAs being selected from the group consisting of: (i) a first mRNA encoding the HA antigen of a first influenza A virus; (ii) a second mRNA encoding the HA antigen of a second influenza A virus, wherein the first influenza A virus and the second influenza A virus belong to different subtypes; and (iii) a third mRNA encoding the HA antigen of a first influenza B virus, wherein the mRNA encoding the HA antigen of the influenza A virus and the mRNA encoding the HA antigen of the influenza B virus are present at different ratios (w / w).

[0005] In some embodiments, the composition comprises a fourth mRNA encoding the HA antigen of influenza B virus type 2, wherein the influenza B virus type 1 and the influenza B virus type 2 belong to different lineages.

[0006] In some embodiments, the composition comprises a first mRNA, a second mRNA, and a third mRNA present in a ratio of about 1:1:2 (w / w).

[0007] In some embodiments, the composition comprises a first mRNA, a second mRNA, and a third mRNA present in a ratio of about 1:1:3 (w / w).

[0008] In some embodiments, the composition comprises a first mRNA, a second mRNA, and a third mRNA present in a ratio of about 1:1:4 (w / w).

[0009] In some embodiments, the composition comprises a first mRNA, a second mRNA, and a third mRNA present in a ratio of about 1:1:5 (w / w).

[0010] In some embodiments, the composition comprises a first mRNA, a second mRNA, and a third mRNA present in a ratio of about 1:1:6 (w / w).

[0011] In some embodiments, the composition comprises a first mRNA, a second mRNA, and a third mRNA present in a ratio of about 1:1:7 (w / w).

[0012] In some embodiments, the composition comprises a first mRNA, a second mRNA, and a third mRNA present in a ratio of about 1:1:8 (w / w).

[0013] In some embodiments, the composition comprises a first mRNA, a second mRNA, and a third mRNA present in a ratio of about 1:1:9 (w / w).

[0014] In some embodiments, the composition comprises a first mRNA, a second mRNA, and a third mRNA present in a ratio of about 1:1:10 (w / w).

[0015] In some embodiments, the composition comprises a first mRNA, a second mRNA, and a third mRNA present in a ratio (w / w) of about 1:1:2 to about 1:1:10.

[0016] In some embodiments, the composition comprises a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA present in a ratio of about 1:1:2:2 (w / w).

[0017] In some embodiments, the composition comprises a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA present in a ratio of about 1:1:3:3 (w / w).

[0018] In some embodiments, the composition comprises a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA present in a ratio of about 1:1:4:4 (w / w).

[0019] In some embodiments, the composition comprises a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA present in a ratio of about 1:1:5:5 (w / w).

[0020] In some embodiments, the composition comprises a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA present in a ratio of about 1:1:6:6 (w / w).

[0021] In some embodiments, the composition comprises a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA present in a ratio of about 1:1:7:7 (w / w).

[0022] In some embodiments, the composition comprises a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA present in a ratio of about 1:1:8:8 (w / w).

[0023] In some embodiments, the composition comprises a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA present in a ratio of about 1:1:9:9 (w / w).

[0024] In some embodiments, the composition comprises a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA present in a ratio of about 1:1:10:10 (w / w).

[0025] In some embodiments, the composition comprises a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA present in a ratio (w / w) of about 1:1:2:2 to about 1:1:10:10.

[0026] In some embodiments, the ratio is expressed in micrograms (µg).

[0027] In some embodiments, the composition comprises a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA present in the following ratio (w / w): about 32 micrograms of the first mRNA: about 32 micrograms of the second mRNA: about 64 micrograms of the third mRNA: about 64 micrograms of the fourth mRNA.

[0028] In some embodiments, the composition comprises a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA present in the following ratio (w / w): about 16 micrograms of the first mRNA: about 16 micrograms of the second mRNA: about 64 micrograms of the third mRNA: about 64 micrograms of the fourth mRNA.

[0029] In some embodiments, the composition comprises a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA present in the following ratio (w / w): about 16 micrograms of the first mRNA: about 16 micrograms of the second mRNA: about 96 micrograms of the third mRNA: about 96 micrograms of the fourth mRNA.

[0030] In some embodiments, the composition contains a total of 130 micrograms of mRNA.

[0031] In some embodiments, the composition contains a total of 160 micrograms of mRNA.

[0032] In some embodiments, the composition contains a total of 200 micrograms of mRNA.

[0033] In some embodiments, the composition contains a total of 224 micrograms of mRNA.

[0034] In some embodiments, the composition contains a total of 130 micrograms to 224 micrograms of mRNA.

[0035] In some embodiments, the composition contains a total of less than 100 micrograms of mRNA.

[0036] In some embodiments, the composition contains a total of less than 150 micrograms of mRNA.

[0037] In some embodiments, the composition contains less than 200 micrograms of mRNA in total.

[0038] In some embodiments, the first mRNA, second mRNA, third mRNA, and / or fourth mRNA are not covalently linked to each other.

[0039] In some embodiments, the first mRNA, the second mRNA, the third mRNA, and / or the fourth mRNA are covalently linked to each other.

[0040] In some embodiments, a first mRNA, a second mRNA, a third mRNA, and / or a fourth mRNA are formulated into the LNP.

[0041] In some embodiments, the LNP comprises at least one cationic lipid.

[0042] In some embodiments, the cationic lipids are biodegradable.

[0043] In some embodiments, the cationic lipids are not biodegradable.

[0044] In some embodiments, the cationic lipids are cleavable.

[0045] In some embodiments, the cationic lipids are not cleavable.

[0046] In some embodiments, the cationic lipids are selected from the group consisting of: OF-02, cKK-E10, GL-HEPES-E3-E10-DS-3-E18-1, GL-HEPES-E3-E12-DS-4-E10, GL-HEPES-E3-E12-DS-3-E14, [(4-hydroxybutyl)azanediyl]bis(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315) and IM-001.

[0047] In some embodiments, the cationic lipid is cKK-E10.

[0048] In some embodiments, the cationic lipid is GL-HEPES-E3-E12-DS-4-E10.

[0049] In some embodiments, the cationic lipid is IM-001.

[0050] In some embodiments, the LNP further comprises polyethylene glycol (PEG) conjugated (PEGylated) lipids, cholesterol-based lipids, and auxiliary lipids.

[0051] In some embodiments, the LNP comprises: 35% to 55% cationic lipids; 0.25% to 2.75% polyethylene glycol (PEG) conjugated (PEGylated) lipids; 20% to 45% cholesterol-based lipids; and 5% to 35% auxiliary lipids, wherein all of these molar ratios are relative to the total lipid content of the LNP.

[0052] In some embodiments, the LNP comprises: 40% cationic lipids; 1.5% PEGylated lipids; 28.5% cholesterol-based lipids; and 30% auxiliary lipids, wherein all of these molar ratios are relative to the total lipid content of the LNP.

[0053] In some embodiments, the PEGylated lipid is dimyristicoyl-PEG2000 (DMG-PEG2000) or 2-[(polyethylene glycol)-2000]-N,N-bistetradecylacetamide (ALC-0159).

[0054] In some embodiments, the cholesterol-based lipid is cholesterol.

[0055] In some embodiments, the auxiliary lipid is 1,2-dioleoyl-SN-glycerol-3-phosphate ethanolamine (DOPE) or 1,2-distearate-sn-glycerol-3-phosphate choline (DSPC).

[0056] In some embodiments, the LNP comprises: 40% GL-HEPES-E3-E12-DS-4-E10 in a molar ratio; 1.5% DMG-PEG2000 in a molar ratio; 28.5% cholesterol in a molar ratio; and 30% DOPE in a molar ratio, wherein all of these molar ratios are relative to the total lipid content of the LNP.

[0057] In some embodiments, the LNP comprises: 40% cKK-E10 in molar ratio; 1.5% DMG-PEG2000 in molar ratio; 28.5% cholesterol in molar ratio; and 30% DOPE in molar ratio, wherein all of these molar ratios are relative to the total lipid content of the LNP.

[0058] In some embodiments, the LNP comprises: 40% IM-001; 1.5% DMG-PEG2000; 28.5% cholesterol; and 30% DOPE, wherein all of these molar ratios are relative to the total lipid content of the LNP.

[0059] In some embodiments, the average diameter of the LNP is 30 nm to 200 nm.

[0060] In some embodiments, the average diameter of the LNP is 80 nm to 150 nm.

[0061] In some embodiments, the first mRNA encodes the HA antigen of the influenza A H1N1 subtype.

[0062] In some embodiments, the second mRNA encodes the HA antigen of the influenza A H3N2 subtype.

[0063] In some embodiments, the third mRNA encodes the HA antigen of the Victoria lineage of influenza B.

[0064] In some embodiments, the fourth mRNA encodes the HA antigen of influenza B Yamagata lineage strains.

[0065] In some embodiments, at least one of these mRNAs contains a codon-optimized ORF.

[0066] In some embodiments, at least one of these mRNAs comprises at least one 5' untranslated region (5' UTR), at least one 3' untranslated region (3' UTR), and at least one polyadenylated (poly(A)) sequence.

[0067] In some embodiments, at least one of these mRNAs contains at least one chemical modification.

[0068] In some embodiments, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% of the uracil nucleotides in at least one of these mRNAs are chemically modified.

[0069] In some embodiments, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% of the uracil nucleotides in at least one of these ORFs are chemically modified.

[0070] In some embodiments, the chemical modification is selected from the group consisting of: pseudouridine, N1-methylpseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deazo-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methyluridine, 5-methyluridine, 5-methoxyuridine, and 2'-O-methyluridine.

[0071] In some embodiments, the chemical modification is selected from the group consisting of: pseudouridine, N1-methylpseudouridine, 5-methylcytosine, 5-methoxyuridine, and combinations thereof.

[0072] In some embodiments, the chemical modification is N1-methylpseuuridine.

[0073] In some embodiments, this disclosure provides a method of administering any of the above compositions to a subject in need.

[0074] In some embodiments, this disclosure provides a method for inducing an immune response to influenza A or protecting a subject from influenza A infection, the method comprising administering any of the above-described compositions to the subject.

[0075] In some embodiments, this disclosure provides a method for inducing an immune response to influenza B or protecting a subject from influenza B infection, the method comprising administering any of the above compositions to the subject.

[0076] In some embodiments, subjects administered any of the above compositions have comparable serum concentrations of neutralizing antibodies against influenza A, compared to subjects administered the influenza A protein vaccine.

[0077] In some embodiments, subjects administered any of the above compositions have comparable serum concentrations of neutralizing antibodies against influenza B compared to subjects administered the influenza B protein vaccine.

[0078] In some embodiments, the composition increases the serum concentration of neutralizing antibodies against influenza A in the subject.

[0079] In some embodiments, the composition increases the serum concentration of neutralizing antibodies against influenza B in the subject.

[0080] In some embodiments, the composition increases the serum concentration of neutralizing antibodies against influenza A H1N1 and / or influenza A H3N2 in the subject.

[0081] In some embodiments, the composition increases the serum concentration of neutralizing antibodies against the Yamagata and / or Victoria lineages of influenza B in the subject.

[0082] In some embodiments, this disclosure provides compositions as disclosed herein for use in methods of inducing an immune response to influenza A or protecting a subject from influenza A infection.

[0083] In some embodiments, this disclosure provides compositions as disclosed herein for use in methods of inducing an immune response to influenza B or protecting a subject from influenza B infection.

[0084] In some embodiments, this disclosure provides for the use of any of the compositions described herein in the manufacture of a medicament for inducing an immune response to influenza A or for protecting a subject from infection with influenza A.

[0085] In some embodiments, this disclosure provides for the use of any of the compositions described herein in the manufacture of a medicament for inducing an immune response to influenza B or for protecting a subject from infection with influenza B.

[0086] On the other hand, this disclosure provides a composition comprising at least three messenger RNAs (mRNAs), wherein: (i) a first mRNA encodes a hemagglutinin (HA) antigen of influenza A virus type 1; (ii) a second mRNA encodes a HA antigen of influenza A virus type 2, wherein the influenza A virus type 1 and the influenza A virus type 2 belong to different subtypes; and (iii) a third mRNA encodes a HA antigen of influenza B virus type 1, wherein the mRNA encoding the HA antigen of influenza A virus type 1 and the mRNA encoding the HA antigen of influenza B virus type 2 are present at different ratios (w / w), and wherein the first mRNA, the second mRNA, and the third mRNA are formulated into lipid nanoparticles (LNPs) comprising: OF-02, cKK-E10, and GL-HEPES-E3-E in a molar ratio of 40%. 10-DS-3-E18-1, GL-HEPES-E3-E12-DS-4-E10, GL-HEPES-E3-E12-DS-3-E14, [(4-hydroxybutyl)azanediyl]bis(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315) or IM-001; DMG-PEG2000 at a molar ratio of 1.5%; cholesterol at a molar ratio of 28.5%; and DOPE at a molar ratio of 30%.

[0087] In an embodiment, this disclosure provides a composition comprising at least three messenger RNAs (mRNAs), wherein: (i) a first mRNA encodes a hemagglutinin (HA) antigen of a first influenza A virus; (ii) a second mRNA encodes a HA antigen of a second influenza A virus, wherein the first influenza A virus and the second influenza A virus belong to different subtypes; and (iii) a third mRNA encodes a HA antigen of a first influenza B virus, wherein the mRNA encoding the HA antigen of the influenza A virus and the mRNA encoding the HA antigen of the influenza B virus are present at different ratios (w / w), and wherein the first mRNA, the second mRNA, and the third mRNA are formulated into lipid nanoparticles (LNPs) comprising 40% GL-HEPES-E3-E12-DS-4-E10 in a molar ratio; 1.5% DMG-PEG2000 in a molar ratio; 28.5% cholesterol in a molar ratio; and 30% DOPE in a molar ratio.

[0088] In embodiments, this disclosure provides a composition comprising at least three messenger RNAs (mRNAs), wherein: (i) a first mRNA encodes a hemagglutinin (HA) antigen of a first influenza A virus; (ii) a second mRNA encodes a HA antigen of a second influenza A virus, wherein the first and second influenza A viruses belong to different subtypes; and (iii) The third mRNA encodes the HA antigen of influenza A virus, wherein the mRNA encoding the HA antigen of influenza A virus and the mRNA encoding the HA antigen of influenza B virus exist in different ratios (w / w), wherein the ratio of these mRNAs is 1:1:2 (w / w), and wherein the first mRNA, the second mRNA and the third mRNA are formulated into lipid nanoparticles (LNPs), the lipid nanoparticles containing 40% GL-HEPES-E3-E12-DS-4-E10; 1.5% DMG-PEG2000; 28.5% cholesterol; and 30% DOPE.

[0089] In an embodiment, this disclosure provides a composition comprising at least three messenger RNAs (mRNAs), wherein: (i) a first mRNA encodes a hemagglutinin (HA) antigen of a first influenza A virus; (ii) a second mRNA encodes a HA antigen of a second influenza A virus, wherein the first influenza A virus and the second influenza A virus belong to different subtypes; and (iii) a third mRNA encodes a HA antigen of a first influenza B virus, wherein the mRNA encoding the HA antigen of the influenza A virus and the mRNA encoding the HA antigen of the influenza B virus are present at different ratios (w / w), and wherein the first mRNA, the second mRNA, and the third mRNA are formulated into lipid nanoparticles (LNPs) comprising 40% IM-01; 1.5% DMG-PEG2000; 28.5% cholesterol; and 30% DOPE.

[0090] In an embodiment, this disclosure provides a composition comprising at least three messenger RNAs (mRNAs), wherein: (i) a first mRNA encodes a hemagglutinin (HA) antigen of a first influenza A virus; (ii) a second mRNA encodes a HA antigen of a second influenza A virus, wherein the first influenza A virus and the second influenza A virus belong to different subtypes; and (iii) a third mRNA encodes a HA antigen of a first influenza B virus, wherein the mRNA encoding the HA antigen of the influenza A virus and the mRNA encoding the HA antigen of the influenza B virus are present in different ratios (w / w), wherein the ratio of these mRNAs is 1:1:2 (w / w), and wherein the first mRNA, the second mRNA, and the third mRNA are formulated into lipid nanoparticles (LNPs) comprising 40% IM-01, 1.5% DMG-PEG2000, 28.5% cholesterol, and 30% DOPE.

[0091] In some embodiments, the composition comprises a fourth mRNA encoding the HA antigen of influenza B virus type 2, wherein influenza B virus type 1 and influenza B virus type 2 belong to different lineages, and wherein the first mRNA, second mRNA, third mRNA and fourth mRNA are formulated into lipid nanoparticles (LNPs) comprising: 40% of OF-02, cKK-E10, GL-HEPES-E3-E10-DS-3-E18-1, GL-HEPES-E3-E12-DS-4-E10, GL-HEPES-E3-E12-DS-3-E14, (4-hydroxybutyl)azanidinediyl]bis(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315) or IM-001; 1.5% of DMG-PEG2000; 28.5% of cholesterol; and 30% of DOPE.

[0092] In some embodiments, the composition comprises a first mRNA, a second mRNA, and a third mRNA present in a ratio of about 1:1:2 (w / w).

[0093] In some embodiments, the composition comprises a first mRNA, a second mRNA, and a third mRNA present in a ratio of about 1:1:3 (w / w).

[0094] In some embodiments, the composition comprises a first mRNA, a second mRNA, and a third mRNA present in a ratio of about 1:1:4 (w / w).

[0095] In some embodiments, the composition comprises a first mRNA, a second mRNA, and a third mRNA present in a ratio of about 1:1:5 (w / w).

[0096] In some embodiments, the composition comprises a first mRNA, a second mRNA, and a third mRNA present in a ratio of about 1:1:6 (w / w).

[0097] In some embodiments, the composition comprises a first mRNA, a second mRNA, and a third mRNA present in a ratio of about 1:1:7 (w / w).

[0098] In some embodiments, the composition comprises a first mRNA, a second mRNA, and a third mRNA present in a ratio of about 1:1:8 (w / w).

[0099] In some embodiments, the composition comprises a first mRNA, a second mRNA, and a third mRNA present in a ratio of about 1:1:9 (w / w).

[0100] In some embodiments, the composition comprises a first mRNA, a second mRNA, and a third mRNA present in a ratio of about 1:1:10 (w / w).

[0101] In some embodiments, the composition comprises a first mRNA, a second mRNA, and a third mRNA present in a ratio (w / w) of about 1:1:2 to about 1:1:10.

[0102] In some embodiments, the composition comprises a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA present in a ratio of about 1:1:2:2 (w / w).

[0103] In some embodiments, the composition comprises a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA present in a ratio of about 1:1:3:3 (w / w).

[0104] In some embodiments, the composition comprises a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA present in a ratio of about 1:1:4:4 (w / w).

[0105] In some embodiments, the composition comprises a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA present in a ratio of about 1:1:5:5 (w / w).

[0106] In some embodiments, the composition comprises a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA present in a ratio of about 1:1:6:6 (w / w).

[0107] In some embodiments, the composition comprises a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA present in a ratio of about 1:1:7:7 (w / w).

[0108] In some embodiments, the composition comprises a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA present in a ratio of about 1:1:8:8 (w / w).

[0109] In some embodiments, the composition comprises a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA present in a ratio of about 1:1:9:9 (w / w).

[0110] In some embodiments, the composition comprises a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA present in a ratio of about 1:1:10:10 (w / w).

[0111] In some embodiments, the composition comprises a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA present in a ratio (w / w) of about 1:1:2:2 to about 1:1:10:10.

[0112] In some embodiments, the ratio is expressed in micrograms (µg).

[0113] In some embodiments, the composition comprises a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA present in the following ratio (w / w): about 32 micrograms of the first mRNA: about 32 micrograms of the second mRNA: about 64 micrograms of the third mRNA: about 64 micrograms of the fourth mRNA.

[0114] In some embodiments, the composition comprises a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA present in the following ratio (w / w): about 16 micrograms of the first mRNA: about 16 micrograms of the second mRNA: about 64 micrograms of the third mRNA: about 64 micrograms of the fourth mRNA.

[0115] In some embodiments, the composition comprises a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA present in the following ratio (w / w): about 16 micrograms of the first mRNA: about 16 micrograms of the second mRNA: about 96 micrograms of the third mRNA: about 96 micrograms of the fourth mRNA.

[0116] In some embodiments, the composition contains a total of less than 100 micrograms of mRNA.

[0117] In some embodiments, the composition contains a total of less than 150 micrograms of mRNA.

[0118] In some embodiments, the composition contains less than 200 micrograms of mRNA in total.

[0119] In some embodiments, the composition contains a total of less than 250 micrograms of mRNA.

[0120] In some embodiments, the composition contains a total of 100 to 250 micrograms of mRNA.

[0121] In some embodiments, the first mRNA, second mRNA, third mRNA, and / or fourth mRNA are not covalently linked to each other.

[0122] In some embodiments, the first mRNA, the second mRNA, the third mRNA, and / or the fourth mRNA are covalently linked to each other.

[0123] In some embodiments, the average diameter of the LNP is 30 nm to 200 nm.

[0124] In some embodiments, the average diameter of the LNP is 80 nm to 150 nm.

[0125] In some embodiments, the first mRNA encodes the HA antigen of the influenza A H1N1 subtype.

[0126] In some embodiments, the second mRNA encodes the HA antigen of the influenza A H3N2 subtype.

[0127] In some embodiments, the third mRNA encodes the HA antigen of the Victoria lineage of influenza B.

[0128] In some embodiments, the fourth mRNA encodes the HA antigen of the Yamagata lineage of influenza B.

[0129] In some embodiments, at least one of these mRNAs contains a codon-optimized ORF.

[0130] In some embodiments, at least one of these mRNAs comprises at least one 5' untranslated region (5' UTR), at least one 3' untranslated region (3' UTR), and at least one polyadenylated (poly(A)) sequence.

[0131] In some embodiments, at least one of these mRNAs contains at least one chemical modification.

[0132] In some embodiments, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% of the uracil nucleotides in at least one of these mRNAs are chemically modified.

[0133] In some embodiments, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% of the uracil nucleotides in at least one of these ORFs are chemically modified.

[0134] In some embodiments, the chemical modification is selected from the group consisting of: pseudouridine, N1-methylpseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deazo-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methyluridine, 5-methyluridine, 5-methoxyuridine, and 2'-O-methyluridine.

[0135] In some embodiments, the chemical modification is selected from the group consisting of: pseudouridine, N1-methylpseudouridine, 5-methylcytosine, 5-methoxyuridine, and combinations thereof.

[0136] In some embodiments, the chemical modification is N1-methylpseuuridine.

[0137] In some embodiments, this disclosure provides a method of administering any of the above compositions to a subject in need.

[0138] In some embodiments, this disclosure provides a method for inducing an immune response to influenza A or protecting a subject from influenza A infection, the method comprising administering any of the above-described compositions to the subject.

[0139] In some embodiments, this disclosure provides a method for inducing an immune response to influenza B or protecting a subject from influenza B infection, the method comprising administering any of the above compositions to the subject.

[0140] In some embodiments, subjects administered any of the above compositions have comparable serum concentrations of neutralizing antibodies against influenza A, compared to subjects administered the influenza A protein vaccine.

[0141] In some embodiments, subjects administered any of the above compositions have comparable serum concentrations of neutralizing antibodies against influenza B compared to subjects administered the influenza B protein vaccine.

[0142] In some embodiments, the composition increases the serum concentration of neutralizing antibodies against influenza A in the subject.

[0143] In some embodiments, the composition increases the serum concentration of neutralizing antibodies against influenza B in the subject.

[0144] In some embodiments, the composition increases the serum concentration of neutralizing antibodies against influenza A H1N1 and / or influenza A H3N2 in the subject.

[0145] In some embodiments, the composition increases the serum concentration of neutralizing antibodies against the Yamagata and / or Victoria lineages of influenza B in the subject.

[0146] In some embodiments, this disclosure provides compositions as disclosed herein for use in methods of inducing an immune response to influenza A or protecting a subject from influenza A infection.

[0147] In some embodiments, this disclosure provides compositions as disclosed herein for use in methods of inducing an immune response to influenza B or protecting a subject from influenza B infection.

[0148] In some embodiments, this disclosure provides for the use of any of the compositions described herein in the manufacture of a medicament for inducing an immune response to influenza A or for protecting a subject from infection with influenza A.

[0149] In some embodiments, this disclosure provides for the use of any of the compositions described herein in the manufacture of a medicament for inducing an immune response to influenza B or for protecting a subject from infection with influenza B.

[0150] On the other hand, this disclosure provides a method comprising administering to a human subject a composition comprising at least three messenger RNAs (mRNAs), wherein: (i) a first mRNA encodes a hemagglutinin (HA) antigen of a first influenza A virus; (ii) a second mRNA encodes a HA antigen of a second influenza A virus, wherein the first influenza A virus and the second influenza A virus belong to different subtypes; and (iii) a third mRNA encodes a HA antigen of a first influenza B virus, wherein the mRNA encoding the HA antigen of the influenza A virus and the mRNA encoding the HA antigen of the influenza B virus are present at different ratios (w / w), and wherein the first mRNA, the second mRNA, and the third mRNA are formulated into lipid nanoparticles (LNPs) comprising: OF-02, cKK-E10, and GL-HEPES-E3-E in a molar ratio of 40%. 10-DS-3-E18-1, GL-HEPES-E3-E12-DS-4-E10, GL-HEPES-E3-E12-DS-3-E14, [(4-hydroxybutyl)azanediyl]bis(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315) or IM-001; DMG-PEG2000 at a molar ratio of 1.5%; cholesterol at a molar ratio of 28.5%; and DOPE at a molar ratio of 30%.

[0151] In some embodiments, the method includes administering a composition comprising a fourth mRNA encoding the HA antigen of influenza B virus type 2, wherein influenza B virus type 1 and influenza B virus type 2 belong to different lineages, and wherein the first mRNA, second mRNA, third mRNA and fourth mRNA are formulated into lipid nanoparticles (LNPs) comprising: OF-02, cKK-E10, GL-HEPES-E3- in a molar ratio of 40%. E10-DS-3-E18-1, GL-HEPES-E3-E12-DS-4-E10, GL-HEPES-E3-E12-DS-3-E14, [(4-hydroxybutyl)azanediyl]bis(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315) or IM-001; DMG-PEG2000 at a molar ratio of 1.5%; cholesterol at a molar ratio of 28.5%; and DOPE at a molar ratio of 30%.

[0152] In some embodiments, the composition comprises a first mRNA, a second mRNA, and a third mRNA present in a ratio of about 1:1:2 (w / w).

[0153] In some embodiments, the composition comprises a first mRNA, a second mRNA, and a third mRNA present in a ratio of about 1:1:3 (w / w).

[0154] In some embodiments, the composition comprises a first mRNA, a second mRNA, and a third mRNA present in a ratio of about 1:1:4 (w / w).

[0155] In some embodiments, the composition comprises a first mRNA, a second mRNA, and a third mRNA present in a ratio of about 1:1:5 (w / w).

[0156] In some embodiments, the composition comprises a first mRNA, a second mRNA, and a third mRNA present in a ratio of about 1:1:6 (w / w).

[0157] In some embodiments, the composition comprises a first mRNA, a second mRNA, and a third mRNA present in a ratio of about 1:1:7 (w / w).

[0158] In some embodiments, the composition comprises a first mRNA, a second mRNA, and a third mRNA present in a ratio of about 1:1:8 (w / w).

[0159] In some embodiments, the composition comprises a first mRNA, a second mRNA, and a third mRNA present in a ratio of about 1:1:9 (w / w).

[0160] In some embodiments, the composition comprises a first mRNA, a second mRNA, and a third mRNA present in a ratio of about 1:1:10 (w / w).

[0161] In some embodiments, the composition comprises a first mRNA, a second mRNA, and a third mRNA present in a ratio (w / w) of about 1:1:2 to about 1:1:10.

[0162] In some embodiments, the composition comprises a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA present in a ratio of about 1:1:2:2 (w / w).

[0163] In some embodiments, the composition comprises a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA present in a ratio of about 1:1:3:3 (w / w).

[0164] In some embodiments, the composition comprises a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA present in a ratio of about 1:1:4:4 (w / w).

[0165] In some embodiments, the composition comprises a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA present in a ratio of about 1:1:5:5 (w / w).

[0166] In some embodiments, the composition comprises a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA present in a ratio of about 1:1:6:6 (w / w).

[0167] In some embodiments, the composition comprises a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA present in a ratio of about 1:1:7:7 (w / w).

[0168] In some embodiments, the composition comprises a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA present in a ratio of about 1:1:8:8 (w / w).

[0169] In some embodiments, the composition comprises a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA present in a ratio of about 1:1:9:9 (w / w).

[0170] In some embodiments, the composition comprises a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA present in a ratio of about 1:1:10:10 (w / w).

[0171] In some embodiments, the composition comprises a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA present in a ratio (w / w) of about 1:1:2:2 to about 1:1:10:10.

[0172] In some embodiments, the ratio is expressed in micrograms (µg).

[0173] In some embodiments, the composition comprises a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA present in the following ratio (w / w): about 32 micrograms of the first mRNA: about 32 micrograms of the second mRNA: about 64 micrograms of the third mRNA: about 64 micrograms of the fourth mRNA.

[0174] In some embodiments, the composition comprises a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA present in the following ratio (w / w): about 16 micrograms of the first mRNA: about 16 micrograms of the second mRNA: about 64 micrograms of the third mRNA: about 64 micrograms of the fourth mRNA.

[0175] In some embodiments, the composition comprises a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA present in the following ratio (w / w): about 16 micrograms of the first mRNA: about 16 micrograms of the second mRNA: about 96 micrograms of the third mRNA: about 96 micrograms of the fourth mRNA.

[0176] In some embodiments, the composition contains a total of less than 100 micrograms of mRNA.

[0177] In some embodiments, the composition contains a total of less than 150 micrograms of mRNA.

[0178] In some embodiments, the composition contains less than 200 micrograms of mRNA in total.

[0179] In some embodiments, the composition contains a total of less than 250 micrograms of mRNA.

[0180] In some embodiments, the composition contains a total of 100 to 250 micrograms of mRNA.

[0181] In some embodiments, the first mRNA, second mRNA, third mRNA, and / or fourth mRNA are not covalently linked to each other.

[0182] In some embodiments, the first mRNA, the second mRNA, the third mRNA, and / or the fourth mRNA are covalently linked to each other.

[0183] In some embodiments, the average diameter of the LNP is 30 nm to 200 nm.

[0184] In some embodiments, the average diameter of the LNP is 80 nm to 150 nm.

[0185] In some embodiments, the first mRNA encodes the HA antigen of the influenza A H1N1 subtype.

[0186] In some embodiments, the second mRNA encodes the HA antigen of the influenza A H3N2 subtype.

[0187] In some embodiments, the third mRNA encodes the HA antigen of the Victoria lineage of influenza B.

[0188] In some embodiments, the fourth mRNA encodes the HA antigen of the Yamagata lineage of influenza B.

[0189] In some embodiments, at least one of these mRNAs contains a codon-optimized ORF.

[0190] In some embodiments, at least one of these mRNAs comprises at least one 5' untranslated region (5' UTR), at least one 3' untranslated region (3' UTR), and at least one polyadenylated (poly(A)) sequence.

[0191] In some embodiments, at least one of these mRNAs contains at least one chemical modification.

[0192] In some embodiments, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% of the uracil nucleotides in at least one of these mRNAs are chemically modified.

[0193] In some embodiments, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% of the uracil nucleotides in at least one of these ORFs are chemically modified.

[0194] In some embodiments, the chemical modification is selected from the group consisting of: pseudouridine, N1-methylpseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deazo-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methyluridine, 5-methyluridine, 5-methoxyuridine, and 2'-O-methyluridine.

[0195] In some embodiments, the chemical modification is selected from the group consisting of: pseudouridine, N1-methylpseudouridine, 5-methylcytosine, 5-methoxyuridine, and combinations thereof.

[0196] In some embodiments, the chemical modification is N1-methylpseuuridine.

[0197] In some embodiments, the composition is administered in an effective amount to elicit an immune response to influenza A or to protect a subject from influenza A infection.

[0198] In some embodiments, the composition is administered in an effective amount to elicit an immune response to influenza B or to protect the subject from influenza B infection.

[0199] In some embodiments, subjects administered the composition have comparable serum concentrations of neutralizing antibodies against influenza A compared to subjects administered the influenza A protein vaccine.

[0200] In some embodiments, subjects administered the composition have comparable serum concentrations of neutralizing antibodies against influenza B compared to subjects administered the influenza B protein vaccine.

[0201] In some embodiments, the composition increases the serum concentration of neutralizing antibodies against influenza A in the subject.

[0202] In some embodiments, the composition increases the serum concentration of neutralizing antibodies against influenza B in the subject.

[0203] In some embodiments, the composition increases the serum concentration of neutralizing antibodies against influenza A H1N1 and / or influenza A H3N2 in the subject.

[0204] In some embodiments, the composition increases the serum concentration of neutralizing antibodies against the Yamagata and / or Victoria lineages of influenza B in the subject.

[0205] On the other hand, this disclosure provides a composition comprising at least three messenger RNAs (mRNAs), wherein: (i) a first mRNA encodes a hemagglutinin (HA) antigen of an influenza A virus; (ii) a second mRNA encodes a HA antigen of an influenza A virus, wherein the influenza A virus and the influenza A virus belong to different subtypes; and (iii) The third mRNA encodes the HA antigen of the first influenza B virus, wherein the first mRNA, the second mRNA and the third mRNA are formulated into lipid nanoparticles (LNPs) containing IM-001.

[0206] In some embodiments, the composition comprises a fourth mRNA encoding the HA antigen of influenza B virus type 2, wherein influenza B virus type 1 and influenza B virus type 2 belong to different lineages, and wherein the first mRNA, second mRNA, third mRNA and fourth mRNA are formulated into an LNP containing IM-001.

[0207] In some embodiments, the composition comprises a first mRNA, a second mRNA, and a third mRNA present in a ratio of about 1:1:2 (w / w).

[0208] In some embodiments, the composition comprises a first mRNA, a second mRNA, and a third mRNA present in a ratio of about 1:1:3 (w / w).

[0209] In some embodiments, the composition comprises a first mRNA, a second mRNA, and a third mRNA present in a ratio of about 1:1:4 (w / w).

[0210] In some embodiments, the composition comprises a first mRNA, a second mRNA, and a third mRNA present in a ratio of about 1:1:5 (w / w).

[0211] In some embodiments, the composition comprises a first mRNA, a second mRNA, and a third mRNA present in a ratio of about 1:1:6 (w / w).

[0212] In some embodiments, the composition comprises a first mRNA, a second mRNA, and a third mRNA present in a ratio of about 1:1:7 (w / w).

[0213] In some embodiments, the composition comprises a first mRNA, a second mRNA, and a third mRNA present in a ratio of about 1:1:8 (w / w).

[0214] In some embodiments, the composition comprises a first mRNA, a second mRNA, and a third mRNA present in a ratio of about 1:1:9 (w / w).

[0215] In some embodiments, the composition comprises a first mRNA, a second mRNA, and a third mRNA present in a ratio of about 1:1:10 (w / w).

[0216] In some embodiments, the composition comprises a first mRNA, a second mRNA, and a third mRNA present in a ratio (w / w) of about 1:1:2 to about 1:1:10.

[0217] In some embodiments, the composition comprises a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA present in a ratio of about 1:1:2:2 (w / w).

[0218] In some embodiments, the composition comprises a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA present in a ratio of about 1:1:3:3 (w / w).

[0219] In some embodiments, the composition comprises a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA present in a ratio of about 1:1:4:4 (w / w).

[0220] In some embodiments, the composition comprises a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA present in a ratio of about 1:1:5:5 (w / w).

[0221] In some embodiments, the composition comprises a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA present in a ratio of about 1:1:6:6 (w / w).

[0222] In some embodiments, the composition comprises a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA present in a ratio of about 1:1:7:7 (w / w).

[0223] In some embodiments, the composition comprises a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA present in a ratio of about 1:1:8:8 (w / w).

[0224] In some embodiments, the composition comprises a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA present in a ratio of about 1:1:9:9 (w / w).

[0225] In some embodiments, the composition comprises a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA present in a ratio of about 1:1:10:10 (w / w).

[0226] In some embodiments, the composition comprises a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA present in a ratio (w / w) of about 1:1:2:2 to about 1:1:10:10.

[0227] In some embodiments, the ratio is expressed in micrograms (µg).

[0228] In some embodiments, the composition comprises a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA present in the following ratio (w / w): about 32 micrograms of the first mRNA: about 32 micrograms of the second mRNA: about 64 micrograms of the third mRNA: about 64 micrograms of the fourth mRNA.

[0229] In some embodiments, the composition comprises a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA present in the following ratio (w / w): about 16 micrograms of the first mRNA: about 16 micrograms of the second mRNA: about 64 micrograms of the third mRNA: about 64 micrograms of the fourth mRNA.

[0230] In some embodiments, the composition comprises a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA present in the following ratio (w / w): about 16 micrograms of the first mRNA: about 16 micrograms of the second mRNA: about 96 micrograms of the third mRNA: about 96 micrograms of the fourth mRNA.

[0231] In some embodiments, the composition contains a total of less than 100 micrograms of mRNA.

[0232] In some embodiments, the composition contains a total of less than 150 micrograms of mRNA.

[0233] In some embodiments, the composition contains less than 200 micrograms of mRNA in total.

[0234] In some embodiments, the composition contains a total of less than 250 micrograms of mRNA.

[0235] In some embodiments, the composition contains a total of 100 to 250 micrograms of mRNA.

[0236] In some embodiments, the first mRNA, second mRNA, third mRNA, and / or fourth mRNA are not covalently linked to each other.

[0237] In some embodiments, the first mRNA, the second mRNA, the third mRNA, and / or the fourth mRNA are covalently linked to each other.

[0238] In some embodiments, the LNP further comprises polyethylene glycol (PEG) conjugated (PEGylated) lipids, cholesterol-based lipids, and auxiliary lipids.

[0239] In some embodiments, the LNP comprises: 35% to 55% IM-001 in a molar ratio; 0.25% to 2.75% polyethylene glycol (PEG) conjugated (PEGylated) lipids in a molar ratio; 20% to 45% cholesterol-based lipids in a molar ratio; and 5% to 35% auxiliary lipids in a molar ratio, wherein all of these molar ratios are relative to the total lipid content of the LNP.

[0240] In some embodiments, the LNP comprises: 40% IM-001 in a molar ratio; 1.5% PEGylated lipids in a molar ratio; 28.5% cholesterol-based lipids in a molar ratio; and 30% auxiliary lipids in a molar ratio, wherein all of these molar ratios are relative to the total lipid content of the LNP.

[0241] In some embodiments, the PEGylated lipid is dimyristicoyl-PEG2000 (DMG-PEG2000) or 2-[(polyethylene glycol)-2000]-N,N-bistetradecylacetamide (ALC-0159).

[0242] In some embodiments, the cholesterol-based lipid is cholesterol.

[0243] In some embodiments, the auxiliary lipid is 1,2-dioleoyl-SN-glycerol-3-phosphate ethanolamine (DOPE) or 1,2-distearate-sn-glycerol-3-phosphate choline (DSPC).

[0244] In some embodiments, the average diameter of the LNP is 30 nm to 200 nm.

[0245] In some embodiments, the average diameter of the LNP is 80 nm to 150 nm.

[0246] In some embodiments, the first mRNA encodes the HA antigen of the influenza A H1N1 subtype.

[0247] In some embodiments, the second mRNA encodes the HA antigen of the influenza A H3N2 subtype.

[0248] In some embodiments, the third mRNA encodes the HA antigen of the Victoria lineage of influenza B.

[0249] In some embodiments, the fourth mRNA encodes the HA antigen of the Yamagata lineage of influenza B.

[0250] In some embodiments, at least one of these mRNAs contains a codon-optimized ORF.

[0251] In some embodiments, at least one of these mRNAs comprises at least one 5' untranslated region (5' UTR), at least one 3' untranslated region (3' UTR), and at least one polyadenylated (poly(A)) sequence.

[0252] In some embodiments, at least one of these mRNAs contains at least one chemical modification.

[0253] In some embodiments, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% of the uracil nucleotides in at least one of these mRNAs are chemically modified.

[0254] In some embodiments, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% of the uracil nucleotides in at least one of these ORFs are chemically modified.

[0255] In some embodiments, the chemical modification is selected from the group consisting of: pseudouridine, N1-methylpseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deazo-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methyluridine, 5-methyluridine, 5-methoxyuridine, and 2'-O-methyluridine.

[0256] In some embodiments, the chemical modification is selected from the group consisting of: pseudouridine, N1-methylpseudouridine, 5-methylcytosine, 5-methoxyuridine, and combinations thereof.

[0257] In some embodiments, the chemical modification is N1-methylpseuuridine.

[0258] In some embodiments, this disclosure provides a method of administering any of the above compositions to a subject in need.

[0259] In some embodiments, this disclosure provides a method for inducing an immune response to influenza A or protecting a subject from influenza A infection, the method comprising administering any of the above-described compositions to the subject.

[0260] In some embodiments, this disclosure provides a method for inducing an immune response to influenza B or protecting a subject from influenza B infection, the method comprising administering any of the above compositions to the subject.

[0261] In some embodiments, subjects administered any of the above compositions have comparable serum concentrations of neutralizing antibodies against influenza A, compared to subjects administered the influenza A protein vaccine.

[0262] In some embodiments, subjects administered any of the above compositions have comparable serum concentrations of neutralizing antibodies against influenza B compared to subjects administered the influenza B protein vaccine.

[0263] In some embodiments, the composition increases the serum concentration of neutralizing antibodies against influenza A in the subject.

[0264] In some embodiments, the composition increases the serum concentration of neutralizing antibodies against influenza B in the subject.

[0265] In some embodiments, the composition increases the serum concentration of neutralizing antibodies against influenza A H1N1 and / or influenza A H3N2 in the subject.

[0266] In some embodiments, the composition increases the serum concentration of neutralizing antibodies against the Yamagata and / or Victoria lineages of influenza B in the subject.

[0267] In some embodiments, this disclosure provides compositions as disclosed herein for use in methods of inducing an immune response to influenza A or protecting a subject from influenza A infection.

[0268] In some embodiments, this disclosure provides compositions as disclosed herein for use in methods of inducing an immune response to influenza B or protecting a subject from influenza B infection.

[0269] In some embodiments, this disclosure provides for the use of any of the compositions described herein in the manufacture of a medicament for inducing an immune response to influenza A or for protecting a subject from infection with influenza A.

[0270] In some embodiments, this disclosure provides for the use of any of the compositions described herein in the manufacture of a medicament for inducing an immune response to influenza B or for protecting a subject from infection with influenza B. Attached Figure Description

[0271] The foregoing descriptions and other features and advantages of this disclosure will be more fully understood from the following detailed description of illustrative embodiments, taken in conjunction with the accompanying drawings.

[0272] Figure 1 Interim immunogenicity data from a Phase I / II study (Clinical Trial NCT05624606) of the influenza vaccine MRT5410 (a quadrivalent modified mRNA influenza vaccine that encodes the hemagglutinin (HA) sequences of two influenza A strains (i.e., A / H1N1 and A / H3N2) and two influenza B strains (i.e., B / Yamagata lineage and B / Victoria lineage) in a 1:1:1:1 ratio and is encapsulated in a lipid nanoparticle (LNP) formulation containing cationic lipids GL-HEPES-E3-E12-DS-4-E10) were presented. The vaccine was administered as a single intramuscular injection to adults aged 18–64 years and compared to the following positive controls: (1) Fluzone Quadrivalent®, a quadrivalent inactivated standard-dose influenza vaccine; and (2) Flublok Quadrivalent®, a quadrivalent recombinant influenza vaccine. The geometric mean titer ratio (GMTR) of hemagglutinin inhibition (HAI) and seroconversion rate of influenza strains of the A / H1N1, A / H3N2, B / Yamagata lineage, and B / Victoria lineage were measured for each vaccine.

[0273] Figure 2 Interim immunogenicity data from a Phase I / II study (Clinical Trial NCT 05553301) of the influenza vaccine MRT5410 (a quadrivalent modified mRNA influenza vaccine that encodes the HA sequences of two influenza A strains (i.e., A / H1N1 and A / H3N2) and two influenza B strains (i.e., B / Yamagata lineage and B / Victoria lineage) in a 1:1:1:1 ratio and is encapsulated in an LNP formulation containing the cationic lipid ckk-E10) were presented. The vaccine was administered as a single intramuscular injection at two dose levels (i.e., dose level 1 and dose level 2) to adults aged 18–64 years and compared to the following positive controls: (1) Fluzone Quadrivalent®, a quadrivalent inactivated standard-dose influenza vaccine; and (2) Flublok Quadrivalent®, a quadrivalent recombinant influenza vaccine. The geometric mean titer ratio (GMTR) of hemagglutinin inhibition (HAI) and seroconversion rate of influenza strains of the A / H1N1, A / H3N2, B / Yamagata lineage, and B / Victoria lineage were measured for each vaccine. Detailed Implementation

[0274] This disclosure relates in particular to novel RNA (e.g., mRNA) compositions encoding combinations of influenza A and influenza B hemagglutinin (HA) antigens, and methods for inducing an immune response by administration of said compositions, wherein the mRNA encoding the HA antigen of influenza A virus is present in different ratios (w / w) with the mRNA encoding the influenza B virus. Specifically, this disclosure relates to mRNA encoding these antigens formulated into lipid nanoparticles (LNPs). I. Definition

[0275] Unless otherwise specified herein, scientific and technical terms used in conjunction with this invention shall have the meanings commonly understood by one of ordinary skill in the art. While similar or equivalent methods and materials described herein may also be used in the practice or testing of this invention, exemplary methods and materials are described below. In case of conflict, this specification (including definitions) shall prevail. Generally, the nomenclature and techniques used herein in conjunction with cell and tissue culture, molecular biology, virology, immunology, microbiology, genetics, analytical chemistry, synthetic organic chemistry, medical and medicinal chemistry, protein and nucleic acid chemistry, and hybridization are those well known and commonly used in the art. Enzymatic reactions and purification techniques are performed according to the manufacturer's instructions, as commonly practiced in the art or as described herein. Furthermore, unless the context requires otherwise, singular terms shall include plural terms, and plural terms shall include singular terms. Throughout this specification and embodiments, the terms “have” and “comprise” or variations thereof (such as “has / having” or “comprises / comprising”) should be understood to mean including the stated integers or groups of integers, but not excluding any other integers or groups of integers. All publications and other references mentioned herein are incorporated herein by reference in their entirety. While numerous documents are cited herein, this citation does not imply an admission that any of these documents constitutes part of common general knowledge in the art.

[0276] It should be noted that the terms “a / species (a)” or “an / species (an)” refer to one or more of the entities described; for example, “nucleotide sequence” should be understood to represent one or more nucleotide sequences. Therefore, the terms “a / species (a)” (or “an / species (an)”), “one / species or more / species” and “at least one / species” are used interchangeably herein.

[0277] Furthermore, as used herein, “and / or” is considered a specific disclosure of whether each of the two specified features or components has or does not have the other. Therefore, the term “and / or” as used herein in phrases such as “A and / or B” is intended to include “A and B”, “A or B”, “A” (alone), and “B” (alone). Similarly, the term “and / or” as used herein in phrases such as “A, B, and / or C” is intended to cover each of the following: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0278] It should be understood that, regardless of the circumstances described herein with the language “including,” other similar aspects described with the phrasing “consisting of” and / or “substantially consisting of” are also provided.

[0279] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains. For example, the Concise Dictionary of Biomedicine and Molecular Biology, Juo, Pei-Show, 2nd edition, 2002, CRC Press; The Dictionary of Cell and Molecular Biology, 3rd edition, 1999, Academic Press; and the Oxford Dictionary of Biochemistry and Molecular Biology, revised edition, 2000, Oxford University Press can provide a general dictionary for those skilled in the art of the matter for many of the terms used in this disclosure.

[0280] Units, prefixes, and symbols are all represented in their SI-acceptable form. Numerical ranges include the numbers that define the range. Unless otherwise specified, amino acid sequences are written from left to right, from amino to carboxyl. The headings provided herein are not intended to limit the various aspects of this disclosure. Therefore, the terms immediately following the definitions are defined more fully by referring to the specification (in its entirety).

[0281] The term “about” or “approximately” is used herein to mean approximately, roughly, roughly, or around. When the term “about” is used in conjunction with a numerical range, it modifies the range by extending the upper and lower boundaries of the indicated value. Generally, the term “about” can modify a value to be higher or lower (higher or lower) by variance (e.g., 10%, up or down). In some embodiments, the term represents a deviation from the specified value of ±10%, ±5%, ±4%, ±3%, ±2%, ±1%, ±0.9%, ±0.8%, ±0.7%, ±0.6%, ±0.5%, ±0.4%, ±0.3%, ±0.2%, ±0.1%, ±0.05%, or ±0.01%. In some embodiments, “about” represents a deviation from the indicated value of ±10%. In some embodiments, “about” represents a deviation from the indicated value of ±5%. In some embodiments, “about” represents a deviation from the indicated value of ±4%. In some embodiments, “about” represents a deviation from the indicated value of ±3%. In some embodiments, “about” represents a deviation from the indicated value of ±2%. In some embodiments, “about” represents a deviation from the indicated value of ±1%. In some embodiments, "about" indicates a deviation of ±0.9% from the indicated value. In some embodiments, "about" indicates a deviation of ±0.8% from the indicated value. In some embodiments, "about" indicates a deviation of ±0.7% from the indicated value. In some embodiments, "about" indicates a deviation of ±0.6% from the indicated value. In some embodiments, "about" indicates a deviation of ±0.5% from the indicated value. In some embodiments, "about" indicates a deviation of ±0.4% from the indicated value. In some embodiments, "about" indicates a deviation of ±0.3% from the indicated value. In some embodiments, "about" indicates a deviation of ±0.1% from the indicated value. In some embodiments, "about" indicates a deviation of ±0.05% from the indicated value. In some embodiments, "about" indicates a deviation of ±0.01% from the indicated value.

[0282] As used herein, the term “messenger RNA” or “mRNA” refers to a polynucleotide that encodes at least one polypeptide. As used herein, mRNA encompasses both modified and unmodified RNA. mRNA may contain one or more coding and non-coding regions. The coding region is alternatively referred to as an open reading frame (ORF). Non-coding regions in mRNA include a 5' cap, a 5' untranslated region (UTR), a 3' UTR, and a poly(A) tail. mRNA can be purified from natural sources, produced using recombinant expression systems (e.g., in vitro transcription), and optionally purified or chemically synthesized.

[0283] As used herein, the term "peptide" refers to any amino acid chain, regardless of its length or post-translational modifications (e.g., glycosylation or phosphorylation). "Peptide" applies to amino acid polymers, including naturally occurring and non-naturally occurring amino acid polymers, as well as amino acid polymers in which one or more amino acid residues are non-natural amino acids (e.g., artificial chemical mimics of the corresponding naturally occurring amino acids). "Residue" refers to an amino acid or amino acid mimic incorporated into a peptide via an amide bond or an amide bond mimic. Peptides have an amino terminus (N-terminus) and a carboxyl terminus (C-terminus). "Peptide" is used interchangeably with peptide or protein and is used herein to refer to polymers containing amino acid residues.

[0284] As used herein, the term "immune response" refers to the response of cells of the immune system (such as B cells, T cells, dendritic cells, macrophages, or polymorphonuclear cells) to a stimulus (such as an antigen or vaccine). An immune response can include any cell in the body involved in the host defense response, including, for example, epithelial cells that secrete interferons or cytokines. Immune responses include, but are not limited to, innate and / or adaptive immune responses.

[0285] As used herein, “protective immune response” refers to an immune response that protects a subject from infection (e.g., prevents infection or the occurrence of infection-related diseases). Methods for measuring immune responses include measuring, for example, the proliferation and / or activity of lymphocytes (such as B or T cells), the secretion of cytokines or chemokines, inflammation, antibody production, etc.

[0286] As used in this article, "antibody response" refers to the immune response that produces antibodies.

[0287] As used herein, “antigen” refers to a factor that elicits an immune response; and / or a factor that binds to T cell receptors (e.g., when presented by MHC molecules) or to antibodies (e.g., produced by B cells) when exposed to or administered to an organism. In some embodiments, an antigen elicits a humoral response in an organism (e.g., including the production of antigen-specific antibodies). Alternatively or additionally, in some embodiments, an antigen elicits a cellular response in an organism (e.g., involving T cells whose receptors specifically interact with the antigen). A particular antigen may elicit an immune response in one or more members of a target organism (e.g., mouse, rabbit, primate, human), but not in all members of the target organism species. In some embodiments, an antigen elicits an immune response in at least about 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of members of the target organism species. In some embodiments, the antigen binds to antibodies and / or T-cell receptors and may or may not induce a specific physiological response in an organism. In some embodiments, for example, the antigen may bind to antibodies and / or T-cell receptors in vitro, regardless of whether such interaction occurs in vivo. In some embodiments, the antigen reacts with products of a specific humoral or cellular immune response. The antigen includes hemagglutinin (HA) antigens from both influenza A and influenza B viruses or other influenza viruses as described herein.

[0288] As used herein, “adjuvant” refers to a substance or carrier that enhances the immune response to an antigen. Adjuvants may include, but are not limited to, suspensions of minerals (e.g., alum, aluminum hydroxide, or phosphate) to which antigens are adsorbed; water-in-oil or oil-in-water emulsions of antigen solutions emulsified in mineral oil or water (e.g., Freund's incomplete adjuvant). Sometimes, killed mycobacteria (e.g., Freund's complete adjuvant) are included to further enhance antigenicity. Immunostimulatory oligonucleotides (e.g., CpG motifs) may also be used as adjuvants (e.g., see U.S. Patent Nos. 6,194,388, 6,207,646, 6,214,806, 6,218,371, 6,239,116, 6,339,068, 6,406,705, and 6,429,199). Adjuvants may also include biomolecules such as Toll-like receptor (TLR) agonists and co-stimulatory molecules.

[0289] As used herein, “subject” means any member of the animal kingdom. In some embodiments, “subject” means a human. In some embodiments, “subject” means a non-human animal. In some embodiments, a subject includes, but is not limited to, mammals, birds, reptiles, amphibians, fish, insects, and / or worms. In some embodiments, a non-human subject is a mammal (e.g., rodents, mice, rats, rabbits, monkeys, dogs, cats, sheep, cattle, primates, and / or pigs). In some embodiments, a subject may be a transgenic animal, a genetically engineered animal, and / or a clone. In some embodiments, a subject is an adult, a adolescent, or an infant. In some embodiments, the terms “subject” or “patient” are used and are intended to be used interchangeably with “subject”. In some exemplary embodiments, the subject is a preterm newborn (e.g., less than 37 weeks gestation), a newborn (e.g., 0-27 days old), an infant or toddler (e.g., 28 days to 23 months old), a child (e.g., 2 to 11 years old), an adolescent (e.g., 12 to 17 years old), an adult (e.g., 18 to 50 years old or 18 to 64 years old), or an older adult (e.g., 65 years of age or older). In an exemplary embodiment, the subject is 18 to 50 years of age. In other exemplary embodiments, the subject is an older adult (e.g., an adult 60 years of age or older).

[0290] As used herein, the terms "vaccination" or "administration of a vaccine" refer to the administration of a composition designed to, for example, produce an immune response against a pathogenic factor. Vaccination may be administered before, during, and / or after exposure to a pathogenic factor and / or the occurrence of one or more symptoms, and in some embodiments, shortly before, during, and / or after exposure to a pathogenic factor. In some embodiments, vaccination comprises multiple administrations of a vaccine composition at appropriate intervals.

[0291] This disclosure describes nucleic acid sequences (e.g., DNA and RNA sequences) and amino acid sequences that have a certain degree of identity with a given nucleic acid sequence or amino acid sequence (reference sequence), respectively. II. RNA

[0292] The vaccine disclosed herein may comprise at least three types of RNA, each RNA containing an ORF encoding an influenza hemagglutinin (HA) antigen from influenza A and / or influenza B viruses. In some embodiments, the RNA is messenger RNA (mRNA), each mRNA containing an ORF encoding an HA antigen of influenza A virus I, an HA antigen of influenza A virus II (wherein the influenza A virus I and the influenza A virus II belong to different subtypes), and an HA antigen of influenza B virus. In other embodiments, the RNA is mRNA, each mRNA containing an ORF encoding an HA antigen of influenza A virus I, an HA antigen of influenza A virus II (wherein the influenza A virus I and the influenza A virus II belong to different subtypes), an HA antigen of influenza B virus I, and an HA antigen of influenza B virus II (wherein the influenza B virus I and the influenza B virus II belong to different lineages). In some embodiments, the RNA (e.g., mRNA) further comprises at least one 5' UTR, a 3' UTR, a poly(A) tail, and / or a 5' cap. A.5' cap

[0293] The 5' cap on mRNA can provide resistance to nucleases found in most eukaryotic cells and promote translation efficiency. Several types of 5' caps are known. The 7-methylguanosine cap (also known as "m7G" or "cap-0") contains a guanosine linked to the first transcribed nucleotide via a 5'-5'-triphosphate bond.

[0294] Typically, a 5' cap is added as follows: First, an RNA terminal phosphatase removes one of the terminal phosphate groups from the 5' nucleotide, leaving two terminal phosphate groups; then, guanosine triphosphate (GTP) is added to the terminal phosphate groups via guanylate transferase, resulting in a 5'5'5 triphosphate bond; then, the 7-nitrogen of guanine is methylated by a methyltransferase. Examples of cap structures include, but are not limited to, m7G(5')ppp, (5'(A,G(5')ppp(5')A, and G(5')ppp(5')G. Other cap structures are described in U.S. Publication Nos. US2016 / 0032356 and US2018 / 0125989, which are incorporated herein by reference.

[0295] The 5' capping of polynucleotides can be performed concurrently with in vitro transcription reactions using the following chemical RNA cap analogs, according to the manufacturer's protocol, to produce a 5'-guanosine cap structure: 3'-O-Me-m7G(5')ppp(5')G (ARCA cap); G(5')ppp(5')A; G(5')ppp(5')G; m7G(5')ppp(5')A; m7G(5')ppp(5')G; m7G(5')ppp(5'))(2'OMeA)pG; m7G(5')ppp(5')(2'OMeA)pU; m7G(5')ppp(5')(2'OMeG)pG (New England BioLabs, Ipswich, MA; TriLink Biotechnologies). 5'-Capping of modified RNA can be performed post-transcriptionally using a vaccinia virus capping enzyme to generate a cap 0 structure: m7G(5')ppp(5')G. A cap 1 structure can be generated using both a vaccinia virus capping enzyme and a 2'-O methyltransferase to produce: m7G(5')ppp(5')G-2'-O-methyl. A cap 2 structure can be generated from the cap 1 structure, followed by 2'-O-methylation of the penultimate nucleotide at the 5' end using a 2'-O methyltransferase. A cap 3 structure can be generated from the cap 2 structure, followed by 2'-O-methylation of the fourth penultimate nucleotide at the 5' end using a 2'-O methyltransferase.

[0296] In some embodiments, the mRNA disclosed herein comprises a 5' cap selected from the group consisting of: 3'-O-Me-m7G(5')ppp(5')G (ARCA cap), G(5')ppp(5')A, G(5')ppp(5')G, m7G(5')ppp(5')A, m7G(5')ppp(5')G, m7G(5')ppp(5')(2'OMeA)pG, m7G(5')ppp(5')(2'OMeA)pU, and m7G(5')ppp(5')(2'OMeG)pG.

[0297] In some embodiments, the mRNA disclosed herein comprises the following 5' cap: . B. Untranslated Region (UTR)

[0298] In some embodiments, the mRNA disclosed herein includes a 5' and / or a 3' untranslated region (UTR). In the mRNA, the 5' UTR begins at the transcription start site and continues to the start codon, but does not include the start codon. The 3' UTR begins immediately after the stop codon and continues until the transcription termination signal.

[0299] In some embodiments, the mRNA disclosed herein may include a 5' UTR containing one or more elements that affect the stability or translation of the mRNA. In some embodiments, the 5' UTR may have a length of about 10 to 5,000 nucleotides. In some embodiments, the 5' UTR may have a length of about 50 to 500 nucleotides. In some embodiments, the 5' UTR has a length of at least about 10 nucleotides, about 20 nucleotides, about 30 nucleotides, about 40 nucleotides, about 50 nucleotides, about 100 nucleotides, about 150 nucleotides, about 200 nucleotides, about 250 nucleotides, about 300 nucleotides, about 350 nucleotides, about 400 nucleotides, about 450 nucleotides, about 500 nucleotides, about 550 nucleotides, about 600 nucleotides, or about 650 nucleotides. The lengths are approximately 700 nucleotides, 750 nucleotides, 800 nucleotides, 850 nucleotides, 900 nucleotides, 950 nucleotides, 1,000 nucleotides, 1,500 nucleotides, 2,000 nucleotides, 2,500 nucleotides, 3,000 nucleotides, 3,500 nucleotides, 4,000 nucleotides, 4,500 nucleotides, or 5,000 nucleotides.

[0300] In some embodiments, the mRNA disclosed herein may include a 3' UTR comprising one or more of the following: a polyadenylation signal, a protein binding site affecting the stability of the mRNA's position in the cell, or one or more binding sites of the miRNA. In some embodiments, the 3' UTR may have a length of 50 to 5,000 nucleotides or longer. In some embodiments, the 3' UTR may have a length of 50 to 1,000 nucleotides or longer. In some embodiments, the 3' UTR has a length of at least about 50 nucleotides, about 100 nucleotides, about 150 nucleotides, about 200 nucleotides, about 250 nucleotides, about 300 nucleotides, about 350 nucleotides, about 400 nucleotides, about 450 nucleotides, about 500 nucleotides, about 550 nucleotides, about 600 nucleotides, about 650 nucleotides, about 700 nucleotides, and about... The lengths are approximately 750 nucleotides, approximately 800 nucleotides, approximately 850 nucleotides, approximately 900 nucleotides, approximately 950 nucleotides, approximately 1,000 nucleotides, approximately 1,500 nucleotides, approximately 2,000 nucleotides, approximately 2,500 nucleotides, approximately 3,000 nucleotides, approximately 3,500 nucleotides, approximately 4,000 nucleotides, approximately 4,500 nucleotides, or approximately 5,000 nucleotides.

[0301] In some embodiments, the mRNA disclosed herein may contain a 5' or 3' UTR derived from a gene different from the gene encoded by the mRNA transcript (i.e., the UTR is a heterologous UTR).

[0302] In some embodiments, the 5' and / or 3' UTR sequences may be derived from stable mRNAs (e.g., globin, actin, GAPDH, tubulin, histones, or citrate cycling enzymes) to increase mRNA stability. For example, the 5' UTR sequence may include a portion of the CMV, i.e., the early 1 (IE1) gene or a fragment thereof, to improve the mRNA's nuclease resistance and / or improve its half-life. Including a sequence encoding human growth hormone (hGH) or a fragment thereof at the 3' end or untranslated region of the mRNA is also contemplated. Typically, these modifications, relative to their unmodified counterparts, can improve mRNA stability and / or pharmacokinetic properties (e.g., half-life) and include modifications, for example, to improve mRNA resistance to in vivo nuclease digestion.

[0303] Exemplary 5' UTR includes a sequence derived from the CMV, i.e., the early 1 (IE1) gene (US Publications 2014 / 0206753 and 2015 / 0157565, each of which is incorporated herein by reference) or the sequence GGGAUCCUACC (SEQ ID NO: 1) (US Publication 2016 / 0151409, which is incorporated herein by reference).

[0304] In various embodiments, the 5' UTR may be derived from the 5' UTR of a TOP gene. TOP genes are typically characterized by the presence of a 5'-terminal oligopyrimidine (TOP) bundle. Furthermore, most TOP genes are characterized by growth-related translational regulation. However, TOP genes with tissue-specific translational regulation are also known. In some embodiments, the 5' UTR derived from the 5' UTR of a TOP gene lacks the 5' TOP motif (oligopyrimidine bundle) (e.g., U.S. Publications 2017 / 0029847, 2016 / 0304883, 2016 / 0235864, and 2016 / 0166710, each of which is incorporated herein by reference).

[0305] In some embodiments, 5' UTR is derived from the ribosomal protein large 32 (L32) gene (US Publication No. 2017 / 0029847, ibid.).

[0306] In some embodiments, the 5' UTR is derived from the 5' UTR of the hydroxysteroid (17-b) dehydrogenase 4 gene (HSD17B4) (US Publication No. 2016 / 0166710, ibid.).

[0307] In some embodiments, the 5' UTR is derived from the 5' UTR of the ATP5A1 gene (US Publication No. 2016 / 0166710, ibid.).

[0308] In some embodiments, the internal ribosome entry site (IRES) is used instead of the 5' UTR.

[0309] In some embodiments, the 5' UTR contains the nucleic acid sequence of GGACAGAUCGCCUGGAGACGCCAUCCACGCUGUUUUGACCUCCAUAGAAGACACCGGGACCGAUCCAGCCUCCGCGGCCGGGAACGGUGCAUUGGAACGCGGAUUCCCCGUGCCAAGAGUGACUCACCGUCCUUGACACG (SEQ ID NO:2).

[0310] In some embodiments, the 3' UTR contains the nucleic acid sequence of CGGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAGUUGCCACUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUC (SEQ ID NO: 3).

[0311] The 5'UTR and 3'UTR are described in further detail in International Publication No. WO 2012 / 075040 (incorporated hereby by reference). C. Polyadenylation tail

[0312] As used herein, the terms “poly(A) sequence,” “poly(A) tail,” and “poly(A) region” refer to the adenosine nucleotide sequence at the 3' end of an mRNA molecule. The poly(A) tail can confer stability to mRNA and protect it from exonuclease degradation. The poly(A) tail can enhance translation. In some embodiments, the poly(A) tail is substantially homopolymeric. For example, a 100-adenosine nucleotide poly(A) tail can substantially have a length of 100 nucleotides. In some embodiments, the poly(A) tail can be interrupted by at least one nucleotide different from the adenosine nucleotide (e.g., a nucleotide that is not adenosine nucleotide). For example, a 100-adenosine nucleotide poly(A) tail can have a length exceeding 100 nucleotides (including 100 adenosine nucleotides and at least one nucleotide different from the adenosine nucleotide or a segment of nucleotides). In some embodiments, the poly(A) tail comprises the following sequence: AAAAAAAAAAAAAAAAAAAAAAAAAAAGCAUAUGACUAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (SEQ ID NO: 4).

[0313] As used herein, “A-tail” typically refers to RNA. However, in the context of this disclosure, the term also refers to the corresponding sequence in a DNA molecule (e.g., “T-tail”).

[0314] The poly(A) tail may contain about 10 to about 500 adenosine nucleotides, about 10 to about 200 adenosine nucleotides, about 40 to about 200 adenosine nucleotides, or about 40 to about 150 adenosine nucleotides. The length of the poly(A) tail may be at least about 10, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, or 500 adenosine nucleotides.

[0315] In some embodiments where the nucleic acid is RNA, the poly(A) tail of the nucleic acid is obtained from a DNA template during in vitro transcription of the RNA. In some embodiments, the poly(A) tail is obtained in vitro using conventional chemical synthesis methods without transcription from a DNA template. In various embodiments, the poly(A) tail is generated by enzymatic polyadenylation of RNA (after in vitro transcription of RNA) using commercially available polyadenylation kits and corresponding protocols, or alternatively, by using immobilized poly(A) polymerases, for example, using the methods and means described in International Publication No. WO 2016 / 174271.

[0316] Nucleic acids can contain poly(A) tails obtained by enzymatic polyadenylation, with most nucleic acid molecules containing about 100 (+ / -20) to about 500 (+ / -50) or about 250 (+ / -20) adenosine nucleotides.

[0317] In some embodiments, the nucleic acid may include a poly(A) tail derived from the template DNA, and may additionally include at least one additional poly(A) tail generated by enzymatic polyadenylation, for example as described in International Publication No. WO 2016 / 091391.

[0318] In some embodiments, the nucleic acid contains at least one polyadenylation signal.

[0319] In various embodiments, the nucleic acid may contain at least one poly(C) sequence.

[0320] As used herein, the term "poly(C) sequence" is intended to be a cytosine nucleotide sequence of up to about 200 cytosine nucleotides. In some embodiments, the poly(C) sequence comprises about 10 to about 200 cytosine nucleotides, about 10 to about 100 cytosine nucleotides, about 20 to about 70 cytosine nucleotides, about 20 to about 60 cytosine nucleotides, or about 10 to about 40 cytosine nucleotides. In some embodiments, the poly(C) sequence comprises about 30 cytosine nucleotides. D. Chemical modification

[0321] The mRNA disclosed herein may be modified or unmodified. In some embodiments, the mRNA may contain at least one chemical modification. In some embodiments, the mRNA disclosed herein may contain one or more modifications that typically enhance RNA stability. Exemplary modifications may include backbone modifications, sugar modifications, or base modifications. In some embodiments, the disclosed mRNA may be synthesized from naturally occurring nucleotides and / or nucleotide analogs (modified nucleotides) (including, but not limited to, purines (adenine (A) and guanine (G))) or pyrimidines (thymine (T), cytosine (C), and uracil (U))). In some embodiments, the disclosed mRNA can be synthesized from modified nucleotide analogs or derivatives of purines and pyrimidines, such as, for example, 1-methyl-adenine, 2-methyl-adenine, 2-methylthio-N-6-isopentenyl-adenine, N6-methyl-adenine, N6-isopentenyl-adenine, 2-thio-cytosine, 3-methyl-cytosine, 4-acetyl-cytosine, 5-methyl-cytosine, 2,6-diaminopurine, 1-methyl-guanine, 2-methyl-guanine, 2,2-dimethyl-guanine, 7-methyl-guanine, inosine, 1-methyl-inosine, pseudouracil (5-uracil), dihydrouracil, 2-thio-uracil, 4-thio-uracil, 5-carboxylated... 5-(carboxyhydroxymethyl)-uracil, 5-fluorouracil, 5-bromouracil, 5-carboxymethylaminomethyl-uracil, 5-methyl-2-thiouracil, 5-methyluracil, N-uracil-5-oxyacetic acid methyl ester, 5-methylaminomethyl-uracil, 5-methoxyaminomethyl-2-thiouracil, 5'-methoxycarbonylmethyl-uracil, 5-methoxyuracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (v), 1-methyl-pseudouracil, piracetamidine, β-D-mannosyl-piracetamidine, aminophosphate, thiophosphate, peptide nucleotide, methylphosphonate, 7-deazoguanosine, 5-methylcytosine, and inosine.

[0322] In some embodiments, the disclosed mRNA may contain at least one chemical modification, including but not limited to pseudouridine, N1-methylpseuuridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deazo-pseuuridine, 2-thio-1-methylpseuuridine, 2-thio-5-aza-uridine, 2-thio-dihydropseuuridine, 2-thio-dihydrouridine, 2-thio-pseuuridine, 4-methoxy-2-thio-pseuuridine, 4-methoxy-pseuuridine, 4-thio-1-methylpseuuridine, 4-thio-pseuuridine, 5-aza-uridine, dihydropseuuridine, 5-methyluridine, 5-methyluridine, 5-methoxyuridine, and 2'-O-methyluridine.

[0323] In some embodiments, the chemical modification is selected from the group consisting of: pseudouridine, N1-methylpseudouridine, 5-methylcytosine, 5-methoxyuridine, and combinations thereof.

[0324] In some embodiments, the chemical modification includes N1-methylpseuuridine.

[0325] In some embodiments, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% of the uracil nucleotides in the mRNA are chemically modified.

[0326] In some embodiments, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% of the uracil nucleotides in the ORF are chemically modified.

[0327] Preparation of such analogues is described, for example, in U.S. Patent Nos. 4,373,071, 4,401,796, 4,415,732, 4,458,066, 4,500,707, 4,668,777, 4,973,679, 5,047,524, 5,132,418, 5,153,319, 5,262,530, and 5,700,642. E. mRNA synthesis

[0328] The mRNA disclosed herein can be synthesized according to any of a variety of methods. For example, the mRNA disclosed herein can be synthesized via in vitro transcription (IVT). Some methods for in vitro transcription are described, for example, in Geall et al. (2013) Semin. Immunol. [Journal of Immunology Symposium] 25(2): 152-159; Brunelle et al. (2013) MethodsEnzymol. [Enzymological Methods] 530:101-14. In short, IVT is typically performed using: a linear or circular DNA template containing a promoter, a library of ribonucleoside triphosphates, a buffer system that may include DTT and magnesium ions, a suitable RNA polymerase (e.g., T3, T7, or SP6 RNA polymerase), DNase I, pyrophosphatase, and / or RNase inhibitors. The exact conditions may vary depending on the particular application. The presence of these reagents is generally undesirable in the final mRNA product and can be considered as impurities or contaminants that can be purified or removed to provide uncontaminated and / or homogeneous mRNA suitable for therapeutic use. While in some embodiments it may be desirable to obtain mRNA from an in vitro transcription reaction, mRNA from other sources may be used in accordance with this disclosure, including wild-type mRNA produced by bacteria, fungi, plants and / or animals. III. Combination Influenza mRNA Vaccine Composition

[0329] Influenza is an antisense single-stranded RNA virus belonging to the family Orthomyxoviridae. Every year, influenza viruses infect millions of people worldwide, causing significant mortality and morbidity. Hemagglutinin (HA) is one of the major glycoproteins on the surface of the influenza virus and is a component of influenza infectivity. HA plays a key role in the attachment of the influenza virus to host cells and the fusion of the virus with the host membrane.

[0330] HA is composed of two subunits: HA1 and HA2. HA must be cleaved by cellular proteases to be active as a fusion protein. HA0 is cleaved into HA1 and HA2 to activate viral infectivity and plays a crucial role in the pathogenicity of influenza viruses in humans.

[0331] This article provides RNA (e.g., mRNA) compositions that target three or more influenza HA antigens.

[0332] In some embodiments, the composition comprises mRNA encoding a polypeptide derived from an influenza virus protein selected from hemagglutinins (e.g., hemagglutinin 1 (HA1) and hemagglutinin 2 (HA2), neuraminidase (NA), nucleoprotein (NP), matrix protein 1 (M1), matrix protein 2 (M2), nonstructural protein 1 (NS1), and nonstructural protein 2 (NS2)). In other embodiments, the composition comprises mRNA encoding a polypeptide derived from HA protein, NA protein, or both HA and NA proteins. In still other embodiments, the composition comprises mRNA encoding an antigenic polypeptide derived from a different influenza virus strain.

[0333] In some embodiments, the composition comprises mRNA encoding antigens of influenza A virus, influenza B virus, and / or influenza C virus. In some embodiments, the composition comprises mRNA encoding HA and / or NA antigens of influenza A virus and influenza B virus. In some embodiments, the HA antigen of influenza A virus is selected from subtypes H1, H2, H3, H4, H5, H6, H7, H8, H9, H10, H11, H12, H13, H14, H15, H16, H17, and H18. In other embodiments, the NA antigen of influenza A virus is selected from subtypes N1, N2, N3, N4, N5, N6, N7, N8, N9, N10, and N11. In some embodiments, the HA and NA antigens of influenza B virus are from the influenza B / Yamagata lineage. In some embodiments, the HA and NA antigens of influenza B virus are from the influenza B / Victoria lineage. In some embodiments, the HA and / or NA antigens are derived from influenza virus strains recommended by the World Health Organization (WHO) in its annual recommendations for influenza vaccine formulations.

[0334] In some embodiments, at least one of the one or more influenza virus proteins comprises an influenza virus HA protein having a molecular sequence identified or designed from a machine learning model, and in some embodiments, at least one of the one or more ribonucleic acid molecules encodes one or more influenza virus proteins having a molecular sequence identified or designed from a machine learning model.

[0335] In one embodiment, the composition comprises an mRNA encoding an H1 HA antigen, an mRNA encoding an H3 HA antigen, an mRNA encoding an HA antigen from the influenza B / Yamagata lineage, and an mRNA encoding an HA antigen from the influenza B / Victoria lineage.

[0336] In one embodiment, the composition comprises an mRNA encoding an H1 HA antigen, an mRNA encoding an H3 HA antigen, and an HA antigen from the influenza B / Victoria lineage.

[0337] In another embodiment, the composition further comprises one or more mRNAs encoding a machine learning influenza virus HA having a molecular sequence identified or designed from a machine learning model, wherein the one or more machine learning influenza virus HAs may be selected from H1 HA, H3 HA, HA from the B / Victoria lineage, HA from the B / Yamagata lineage, or a combination thereof.

[0338] When selecting one or more machine learning methods for influenza virus HA, any machine learning algorithm can be used. For example, this paper envisions any machine learning algorithms and methods disclosed in the following: PCT application WO 2021 / 080990 A1 entitled Systems and Methods for Designing Vaccines and WO 2021 / 080999 A1 entitled Systems and Methods for Predicting Biological Responses (both are incorporated herein by reference in their entirety).

[0339] mRNA can be unmodified (i.e., containing only natural ribonucleotides A, U, C, and / or G linked by phosphodiester bonds) or chemically modified (e.g., including nucleotide analogs such as pseudouridine (e.g., N-1-methylpseuuridine), 2'-fluororibonucleotides and 2'-methoxyribonucleotides, and / or phosphate thioester bonds). The mRNA molecule may contain a 5' cap and a poly-A tail.

[0340] In some embodiments, the composition comprises at least three messenger RNAs (mRNAs), wherein the at least three mRNAs contain an open reading frame (ORF) encoding a hemagglutinin (HA) antigen, the at least three mRNAs being selected from the group consisting of: (i) a first mRNA encoding the HA antigen of a first influenza A virus; (ii) a second mRNA encoding the HA antigen of a second influenza A virus, wherein the first influenza A virus and the second influenza A virus belong to different subtypes; and (iii) a third mRNA encoding the HA antigen of a first influenza B virus, wherein the mRNA encoding the HA antigen of the influenza A virus and the mRNA encoding the HA antigen of the influenza B virus are present at different ratios (w / w).

[0341] In some embodiments, the composition comprises at least three mRNAs, wherein: (i) a first mRNA encodes the HA antigen of a first influenza A virus; (ii) a second mRNA encodes the HA antigen of a second influenza A virus, wherein the first influenza A virus and the second influenza A virus belong to different subtypes; and (iii) a third mRNA encodes the HA antigen of a first influenza B virus, wherein the mRNA encoding the HA antigen of the influenza A virus and the mRNA encoding the HA antigen of the influenza B virus are present at different ratios (w / w), and wherein the first mRNA, the second mRNA, and the third mRNA are formulated into lipid nanoparticles (LNPs) comprising: OF-02, cKK-E10, and GL-HEPES-E3-E in a molar ratio of 40%. 10-DS-3-E18-1, GL-HEPES-E3-E12-DS-4-E10, GL-HEPES-E3-E12-DS-3-E14, [(4-hydroxybutyl)azanediyl]bis(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315) or IM-001; DMG-PEG2000 at a molar ratio of 1.5%; cholesterol at a molar ratio of 28.5%; and DOPE at a molar ratio of 30%.

[0342] In some embodiments, the composition comprises at least three mRNAs, wherein: (i) a first mRNA encodes the HA antigen of a first influenza A virus; (ii) a second mRNA encodes the HA antigen of a second influenza A virus, wherein the first influenza A virus and the second influenza A virus belong to different subtypes; and (iii) a third mRNA encodes the HA antigen of a first influenza B virus, wherein the first mRNA, the second mRNA and the third mRNA are formulated into an LNP containing IM-001.

[0343] The compositions in any of the embodiments herein may contain a fourth mRNA encoding the HA antigen of influenza B virus type 2, wherein influenza B virus type 1 and influenza B virus type 2 belong to different lineages.

[0344] The compositions of any of the embodiments herein may comprise a first mRNA, a second mRNA, a third mRNA, and / or a fourth mRNA that are not covalently linked to each other.

[0345] The compositions of any of the embodiments herein may comprise a first mRNA, a second mRNA, a third mRNA, and / or a fourth mRNA covalently linked to each other.

[0346] The compositions of any of the embodiments herein may contain a first mRNA encoding the HA antigen of the influenza A H1N1 subtype.

[0347] The compositions of any of the embodiments herein may contain a second mRNA encoding the HA antigen of the influenza A H3N2 subtype.

[0348] The composition of any embodiment herein may contain a third mRNA encoding the HA antigen of the Victoria lineage of influenza B.

[0349] The compositions in any of the embodiments described herein may contain a fourth mRNA encoding the HA antigen of influenza B Yamagata lineage strains.

[0350] The compositions in any of the embodiments described herein may comprise at least one mRNA containing a codon-optimized ORF.

[0351] The composition of any embodiment herein may comprise at least one mRNA comprising at least one 5' UTR, at least one 3' UTR and at least one poly(A) sequence.

[0352] The composition of any of the embodiments herein may contain at least one mRNA having at least one chemical modification.

[0353] The compositions of any of the embodiments herein may comprise at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% of chemically modified uracil nucleotides in at least one of these mRNAs.

[0354] The compositions of any of the embodiments herein may comprise at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% of chemically modified uracil nucleotides in at least one of these ORFs.

[0355] The compositions in any of the embodiments herein may comprise chemical modifications selected from the group consisting of: pseudouridine, N1-methylpseuuridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deazo-pseuuridine, 2-thio-1-methyl-pseuuridine, 2-thio-5-aza-uridine, 2-thio-dihydropseuuridine, 2-thio-dihydrouridine, 2-thio-pseuuridine, 4-methoxy-2-thio-pseuuridine, 4-methoxy-pseuuridine, 4-thio-1-methyl-pseuuridine, 4-thio-pseuuridine, 5-aza-uridine, dihydropseuuridine, 5-methyluridine, 5-methyluridine, 5-methoxyuridine, and 2'-O-methyluridine.

[0356] The compositions in any of the embodiments herein may contain chemical modifications selected from the group consisting of: pseudouridine, N1-methylpseudouridine, 5-methylcytosine, 5-methoxyuridine, and combinations thereof.

[0357] The compositions in any of the embodiments described herein may contain chemically modified N1-methylpseuuridine.

[0358] The compositions of any of the embodiments herein may contain a first mRNA, a second mRNA, a third mRNA, and / or a fourth mRNA formulated into an LNP.

[0359] The compositions in any of the embodiments herein may contain an LNP, wherein the LNP contains at least one cationic lipid.

[0360] The compositions in any of the embodiments described herein may contain LNPs, wherein the cationic lipids are biodegradable.

[0361] The compositions in any of the embodiments described herein may contain LNPs, wherein the cationic lipids are not biodegradable.

[0362] The compositions in any of the embodiments described herein may comprise LNPs, wherein the cationic lipids are cleavable.

[0363] The compositions in any of the embodiments described herein may contain LNPs, wherein the cationic lipids are not cleavable.

[0364] The compositions of any of the embodiments herein may comprise LNPs, wherein the cationic lipids are selected from the group consisting of: OF-02, cKK-E10, GL-HEPES-E3-E10-DS-3-E18-1, GL-HEPES-E3-E12-DS-4-E10, GL-HEPES-E3-E12-DS-3-E14, [(4-hydroxybutyl)azanidinediyl]bis(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315) and IM-001.

[0365] The compositions in any of the embodiments herein may comprise LNP, wherein the cationic lipid is cKK-E10.

[0366] The compositions in any of the embodiments herein may comprise LNPs, wherein the cationic lipid is GL-HEPES-E3-E12-DS-4-E10.

[0367] The compositions in any of the embodiments herein may comprise LNP, wherein the cationic lipid is IM-001.

[0368] The compositions in any of the embodiments herein may comprise LNPs, wherein the LNPs further comprise polyethylene glycol (PEG) conjugated (PEGylated) lipids, cholesterol-based lipids, and auxiliary lipids.

[0369] The composition of any embodiment herein may comprise an LNP, wherein the LNP comprises: 35% to 55% cationic lipids in a molar ratio; 0.25% to 2.75% polyethylene glycol (PEG) conjugated (PEGylated) lipids in a molar ratio; 20% to 45% cholesterol-based lipids in a molar ratio; and 5% to 35% auxiliary lipids in a molar ratio, wherein all of these molar ratios are relative to the total lipid content of the LNP.

[0370] The composition of any embodiment herein may comprise an LNP, wherein the LNP comprises: 40% cationic lipids; 1.5% PEGylated lipids; 28.5% cholesterol-based lipids; and 30% accessory lipids, wherein all of these molar ratios are relative to the total lipid content of the LNP.

[0371] The compositions in any of the embodiments herein may comprise LNP, wherein the PEGylated lipid is dimyristic-PEG2000 (DMG-PEG2000) or 2-[(polyethylene glycol)-2000]-N,N-bistetradecylacetamide (ALC-0159).

[0372] The compositions in any of the embodiments herein may contain LNP, wherein the cholesterol-based lipid is cholesterol.

[0373] The compositions in any of the embodiments herein may comprise LNPs, wherein the auxiliary lipid is 1,2-dioleoyl-SN-glycerol-3-phosphate ethanolamine (DOPE) or 1,2-distearate-sn-glycerol-3-phosphate choline (DSPC).

[0374] The composition of any embodiment herein may comprise an LNP, wherein the LNP comprises: 40% GL-HEPES-E3-E12-DS-4-E10 in a molar ratio; 1.5% DMG-PEG2000 in a molar ratio; 28.5% cholesterol in a molar ratio; and 30% DOPE in a molar ratio, wherein all of these molar ratios are relative to the total lipid content of the LNP.

[0375] The composition of any embodiment herein may comprise an LNP, wherein the LNP comprises: 40% cKK-E10 in a molar ratio; 1.5% DMG-PEG2000 in a molar ratio; 28.5% cholesterol in a molar ratio; and 30% DOPE in a molar ratio, wherein all of these molar ratios are relative to the total lipid content of the LNP.

[0376] The composition of any embodiment herein may comprise an LNP, wherein the LNP comprises: 40% IM-001 in a molar ratio; 1.5% DMG-PEG2000 in a molar ratio; 28.5% cholesterol in a molar ratio; and 30% DOPE in a molar ratio, wherein all of these molar ratios are relative to the total lipid content of the LNP.

[0377] The composition of any embodiment herein may comprise an LNP, wherein the LNP has an average diameter of 30 nm to 200 nm.

[0378] The composition of any embodiment herein may comprise an LNP, wherein the LNP has an average diameter of 80 nm to 150 nm.

[0379] Section IV of this specification further describes the LNPs that can be formulated together with the combined influenza mRNA vaccine compositions discussed herein and are incorporated herein. A. Ratio of influenza HA mRNA

[0380] As discussed in the examples, currently investigated mRNA-based multivalent influenza vaccines encode hemagglutinin (HA) antigens from both influenza A and influenza B viruses at an equal (w / w) ratio. While these vaccines are immunogenic, ongoing trials have shown that influenza B strains are less immunogenic than influenza A strains, and the immune response to influenza B virus after vaccination with these vaccines is not ideal. An exemplary strategy to improve the immune response to influenza B strains is to increase the amount / ratio of mRNA encoding one or more HA sequences of one or more influenza B viruses compared to mRNA encoding HA sequences of influenza A virus.

[0381] The composition of any embodiment herein may comprise an HA antigen of a first influenza A virus, an HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), and an HA antigen of an influenza B virus, with an mRNA ratio (w / w) of about 1:1:2.

[0382] The composition of any embodiment herein may comprise an HA antigen of a first influenza A virus, an HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), and an HA antigen of an influenza B virus, with an mRNA ratio (w / w) of about 1:1:3.

[0383] The composition of any embodiment herein may comprise an HA antigen of a first influenza A virus, an HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), and an HA antigen of an influenza B virus, with an mRNA ratio (w / w) of about 1:1:4.

[0384] The composition of any embodiment herein may comprise an HA antigen of a first influenza A virus, an HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), and an HA antigen of an influenza B virus, with an mRNA ratio (w / w) of about 1:1:5.

[0385] The composition of any embodiment herein may comprise an HA antigen of a first influenza A virus, an HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), and an HA antigen of an influenza B virus, with an mRNA ratio (w / w) of about 1:1:6.

[0386] The composition of any embodiment herein may comprise an HA antigen of a first influenza A virus, an HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), and an HA antigen of an influenza B virus, with an mRNA ratio (w / w) of about 1:1:7.

[0387] The composition of any embodiment herein may comprise an HA antigen of a first influenza A virus, an HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), and an HA antigen of an influenza B virus, with an mRNA ratio (w / w) of about 1:1:8.

[0388] The composition of any embodiment herein may comprise an HA antigen of a first influenza A virus, an HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), and an HA antigen of an influenza B virus, with an mRNA ratio (w / w) of about 1:1:9.

[0389] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), and the HA antigen of an influenza B virus, with an mRNA ratio (w / w) of about 1:1:10.

[0390] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes) and the HA antigen of an influenza B virus, in an mRNA ratio (w / w) of 1:1:2.

[0391] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes) and the HA antigen of an influenza B virus, in an mRNA ratio (w / w) of 1:1:3.

[0392] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes) and the HA antigen of an influenza B virus, in an mRNA ratio (w / w) of 1:1:4.

[0393] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes) and the HA antigen of an influenza B virus in an mRNA ratio (w / w) of 1:1:5.

[0394] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes) and the HA antigen of an influenza B virus, in an mRNA ratio (w / w) of 1:1:6.

[0395] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes) and the HA antigen of an influenza B virus, with an mRNA ratio (w / w) of 1:1:7.

[0396] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes) and the HA antigen of an influenza B virus, with an mRNA ratio (w / w) of 1:1:8.

[0397] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes) and the HA antigen of an influenza B virus, in an mRNA ratio (w / w) of 1:1:9.

[0398] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes) and the HA antigen of an influenza B virus, with an mRNA ratio (w / w) of 1:1:10.

[0399] The compositions of any of the embodiments herein may comprise a first mRNA, a second mRNA, and a third mRNA in a ratio (w / w) of about 1:1:2.

[0400] The compositions of any of the embodiments herein may comprise a first mRNA, a second mRNA, and a third mRNA in a ratio (w / w) of about 1:1:3.

[0401] The compositions of any of the embodiments herein may comprise a first mRNA, a second mRNA, and a third mRNA in a ratio (w / w) of about 1:1:4.

[0402] The compositions of any of the embodiments herein may comprise a first mRNA, a second mRNA, and a third mRNA in a ratio (w / w) of about 1:1:5.

[0403] The compositions of any of the embodiments herein may comprise a first mRNA, a second mRNA, and a third mRNA in a ratio (w / w) of about 1:1:6.

[0404] The composition of any of the embodiments herein may comprise a first mRNA, a second mRNA, and a third mRNA in a ratio (w / w) of about 1:1:7.

[0405] The compositions of any of the embodiments herein may comprise a first mRNA, a second mRNA, and a third mRNA in a ratio (w / w) of about 1:1:8.

[0406] The compositions of any of the embodiments herein may comprise a first mRNA, a second mRNA, and a third mRNA in a ratio (w / w) of about 1:1:9.

[0407] The compositions of any of the embodiments herein may comprise a first mRNA, a second mRNA, and a third mRNA in a ratio (w / w) of about 1:1:10.

[0408] The composition of any embodiment herein may comprise a first mRNA, a second mRNA, and a third mRNA in a ratio (w / w) of 1:1:2.

[0409] The composition of any embodiment herein may comprise a first mRNA, a second mRNA, and a third mRNA in a ratio (w / w) of 1:1:3.

[0410] The composition of any embodiment herein may comprise a first mRNA, a second mRNA, and a third mRNA in a ratio (w / w) of 1:1:4.

[0411] The composition of any embodiment herein may comprise a first mRNA, a second mRNA, and a third mRNA in a ratio (w / w) of 1:1:5.

[0412] The composition of any embodiment herein may comprise a first mRNA, a second mRNA, and a third mRNA in a ratio (w / w) of 1:1:6.

[0413] The composition of any embodiment herein may comprise a first mRNA, a second mRNA, and a third mRNA in a ratio (w / w) of 1:1:7.

[0414] The composition of any embodiment herein may comprise a first mRNA, a second mRNA, and a third mRNA in a ratio (w / w) of 1:1:8.

[0415] The composition of any embodiment herein may comprise a first mRNA, a second mRNA, and a third mRNA in a ratio (w / w) of 1:1:9.

[0416] The composition of any embodiment herein may comprise a first mRNA, a second mRNA, and a third mRNA in a ratio (w / w) of 1:1:10.

[0417] The compositions of any of the embodiments herein may comprise a first mRNA, a second mRNA, and a third mRNA in a ratio (w / w) of about 1:1:2 to about 1:1:10.

[0418] The compositions of any of the embodiments herein may contain a first mRNA, a second mRNA, and a third mRNA in a ratio of mRNA expressed in micrograms (µg).

[0419] The composition of any embodiment herein may comprise an HA antigen of a first influenza A virus, an HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), an HA antigen of a first influenza B virus, and an HA antigen of a second influenza B virus (wherein the first and second influenza B viruses belong to different lineages) with an mRNA ratio (w / w) of about 1:1:2:2.

[0420] The composition of any embodiment herein may comprise an HA antigen of a first influenza A virus, an HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), an HA antigen of a first influenza B virus, and an HA antigen of a second influenza B virus (wherein the first and second influenza B viruses belong to different lineages) with an mRNA ratio (w / w) of about 1:1:3:3.

[0421] The composition of any embodiment herein may comprise an HA antigen of a first influenza A virus, an HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), an HA antigen of a first influenza B virus, and an HA antigen of a second influenza B virus (wherein the first and second influenza B viruses belong to different lineages) with an mRNA ratio (w / w) of about 1:1:4:4.

[0422] The composition of any embodiment herein may comprise an HA antigen of a first influenza A virus, an HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), an HA antigen of a first influenza B virus, and an HA antigen of a second influenza B virus (wherein the first and second influenza B viruses belong to different lineages) with an mRNA ratio (w / w) of about 1:1:5:5.

[0423] The composition of any embodiment herein may comprise an HA antigen of a first influenza A virus, an HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), an HA antigen of a first influenza B virus, and an HA antigen of a second influenza B virus (wherein the first and second influenza B viruses belong to different lineages) with an mRNA ratio (w / w) of about 1:1:6:6.

[0424] The composition of any embodiment herein may comprise an HA antigen of a first influenza A virus, an HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), an HA antigen of a first influenza B virus, and an HA antigen of a second influenza B virus (wherein the first and second influenza B viruses belong to different lineages) with an mRNA ratio (w / w) of about 1:1:7:7.

[0425] The composition of any embodiment herein may comprise an HA antigen of a first influenza A virus, an HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), an HA antigen of a first influenza B virus, and an HA antigen of a second influenza B virus (wherein the first and second influenza B viruses belong to different lineages) with an mRNA ratio (w / w) of about 1:1:8:8.

[0426] The composition of any embodiment herein may comprise an HA antigen of a first influenza A virus, an HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), an HA antigen of a first influenza B virus, and an HA antigen of a second influenza B virus (wherein the first and second influenza B viruses belong to different lineages) with an mRNA ratio (w / w) of about 1:1:9:9.

[0427] The composition of any embodiment herein may comprise an HA antigen of a first influenza A virus, an HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), an HA antigen of a first influenza B virus, and an HA antigen of a second influenza B virus (wherein the first and second influenza B viruses belong to different lineages) with an mRNA ratio (w / w) of about 1:1:10:10.

[0428] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), the HA antigen of a first influenza B virus, and the HA antigen of a second influenza B virus (wherein the first and second influenza B viruses belong to different lineages) with an mRNA ratio (w / w) of 1:1:2:2.

[0429] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), the HA antigen of a first influenza B virus, and the HA antigen of a second influenza B virus (wherein the first and second influenza B viruses belong to different lineages) with an mRNA ratio (w / w) of 1:1:3:3.

[0430] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), the HA antigen of a first influenza B virus, and the HA antigen of a second influenza B virus (wherein the first and second influenza B viruses belong to different lineages) with an mRNA ratio (w / w) of 1:1:4:4.

[0431] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), the HA antigen of a first influenza B virus, and the HA antigen of a second influenza B virus (wherein the first and second influenza B viruses belong to different lineages) with an mRNA ratio (w / w) of 1:1:5:5.

[0432] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), the HA antigen of a first influenza B virus, and the HA antigen of a second influenza B virus (wherein the first and second influenza B viruses belong to different lineages) with an mRNA ratio (w / w) of 1:1:6:6.

[0433] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), the HA antigen of a first influenza B virus, and the HA antigen of a second influenza B virus (wherein the first and second influenza B viruses belong to different lineages) with an mRNA ratio (w / w) of 1:1:7:7.

[0434] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), the HA antigen of a first influenza B virus, and the HA antigen of a second influenza B virus (wherein the first and second influenza B viruses belong to different lineages) with an mRNA ratio (w / w) of 1:1:8:8.

[0435] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), the HA antigen of a first influenza B virus, and the HA antigen of a second influenza B virus (wherein the first and second influenza B viruses belong to different lineages) with an mRNA ratio (w / w) of 1:1:9:9.

[0436] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), the HA antigen of a first influenza B virus, and the HA antigen of a second influenza B virus (wherein the first and second influenza B viruses belong to different lineages) with an mRNA ratio (w / w) of 1:1:10:10.

[0437] The compositions of any of the embodiments herein may comprise a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA in a ratio (w / w) of about 1:1:2:2.

[0438] The compositions of any of the embodiments herein may comprise a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA in a ratio (w / w) of about 1:1:3:3.

[0439] The compositions of any of the embodiments herein may comprise a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA in a ratio (w / w) of about 1:1:4:4.

[0440] The compositions of any of the embodiments herein may comprise a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA in a ratio (w / w) of about 1:1:5:5.

[0441] The compositions of any of the embodiments herein may comprise a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA in a ratio (w / w) of about 1:1:6:6.

[0442] The compositions of any of the embodiments herein may comprise a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA in a ratio (w / w) of about 1:1:7:7.

[0443] The compositions of any of the embodiments herein may comprise a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA in a ratio (w / w) of about 1:1:8:8.

[0444] The compositions of any of the embodiments herein may comprise a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA in a ratio (w / w) of about 1:1:9:9.

[0445] The compositions of any of the embodiments herein may comprise a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA in a ratio (w / w) of about 1:1:10:10.

[0446] The composition of any embodiment herein may comprise a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA in a ratio (w / w) of 1:1:2:2.

[0447] The composition of any embodiment herein may comprise a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA in a ratio (w / w) of 1:1:3:3.

[0448] The composition of any embodiment herein may comprise a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA in a ratio (w / w) of 1:1:4:4.

[0449] The compositions of any of the embodiments herein may comprise a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA in a ratio (w / w) of 1:1:5:5.

[0450] The composition of any embodiment herein may comprise a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA in a ratio (w / w) of 1:1:6:6.

[0451] The composition of any embodiment herein may comprise a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA in a ratio (w / w) of 1:1:7:7.

[0452] The composition of any embodiment herein may comprise a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA in a ratio (w / w) of 1:1:8:8.

[0453] The composition of any embodiment herein may comprise a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA in a ratio (w / w) of 1:1:9:9.

[0454] The composition of any embodiment herein may comprise a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA in a ratio (w / w) of 1:1:10:10.

[0455] The compositions of any of the embodiments herein may comprise a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA in a ratio (w / w) of about 1:1:2:2 to about 1:1:10:10.

[0456] The compositions of any of the embodiments herein may contain a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA in a ratio of mRNA expressed in micrograms (µg).

[0457] The composition of any embodiment herein may contain a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA in a ratio (w / w) of about 32 micrograms of first mRNA: about 32 micrograms of second mRNA: about 64 micrograms of third mRNA: about 64 micrograms of fourth mRNA.

[0458] The composition of any embodiment herein may contain a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA in a ratio (w / w) of about 16 micrograms of first mRNA: about 16 micrograms of second mRNA: about 64 micrograms of third mRNA: about 64 micrograms of fourth mRNA.

[0459] The compositions of any of the embodiments herein may contain a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA in a ratio (w / w) of about 16 micrograms of first mRNA: about 16 micrograms of second mRNA: about 96 micrograms of third mRNA: about 96 micrograms of fourth mRNA.

[0460] The composition of any embodiment herein may contain a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA in a ratio (w / w) of about 32 micrograms of first mRNA, about 32 micrograms of second mRNA, about 64 micrograms of third mRNA, and about 64 micrograms of fourth mRNA.

[0461] The compositions of any of the embodiments herein may contain a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA in a ratio (w / w) of about 16 micrograms of first mRNA, about 16 micrograms of second mRNA, about 64 micrograms of third mRNA, and about 64 micrograms of fourth mRNA.

[0462] The compositions of any of the embodiments herein may contain a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA in a ratio (w / w) of about 16 micrograms of first mRNA, about 16 micrograms of second mRNA, about 96 micrograms of third mRNA, and about 96 micrograms of fourth mRNA.

[0463] The composition of any of the embodiments described herein may contain a total of 130 micrograms of mRNA.

[0464] The composition of any of the embodiments described herein may contain a total of 160 micrograms of mRNA.

[0465] The composition of any of the embodiments described herein may contain a total of 200 micrograms of mRNA.

[0466] The composition of any of the embodiments described herein may contain a total of 224 micrograms of mRNA.

[0467] The compositions in any of the embodiments described herein may contain a total of 130 micrograms to 224 micrograms of mRNA.

[0468] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), and the HA antigen of an influenza B virus in a ratio of about 1:1:2 of mRNA (e.g., µg).

[0469] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), and the HA antigen of an influenza B virus in a ratio of about 1:1:3 of mRNA (e.g., µg).

[0470] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), and the HA antigen of an influenza B virus in a ratio of about 1:1:4 of mRNA (e.g., µg).

[0471] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes) in a ratio of about 1:1:5 with mRNA (e.g., µg) and the HA antigen of an influenza B virus.

[0472] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes) in a ratio of about 1:1:6 with mRNA (e.g., µg) and the HA antigen of an influenza B virus.

[0473] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), and the HA antigen of an influenza B virus in a ratio of about 1:1:7 of mRNA (e.g., µg).

[0474] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), and the HA antigen of an influenza B virus in a ratio of about 1:1:8 of mRNA (e.g., µg).

[0475] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes) in a ratio of about 1:1:9 with mRNA (e.g., µg) and the HA antigen of an influenza B virus.

[0476] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes) in a ratio of about 1:1:10 with mRNA (e.g., µg) and the HA antigen of an influenza B virus.

[0477] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), and the HA antigen of an influenza B virus in a 1:1:2 ratio of mRNA (e.g., µg).

[0478] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), and the HA antigen of an influenza B virus in a 1:1:3 ratio of mRNA (e.g., µg).

[0479] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), and the HA antigen of an influenza B virus in a 1:1:4 ratio of mRNA (e.g., µg).

[0480] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes) in a ratio of 1:1:5 with mRNA (e.g., µg) and the HA antigen of an influenza B virus.

[0481] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), and the HA antigen of an influenza B virus in a 1:1:6 ratio of mRNA (e.g., µg).

[0482] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes) in a 1:1:7 ratio of mRNA (e.g., µg) and the HA antigen of an influenza B virus.

[0483] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes) in a ratio of 1:1:8 to the mRNA (e.g., µg) of the first influenza A virus and the second influenza A virus, and the HA antigen of an influenza B virus.

[0484] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), and the HA antigen of an influenza B virus in a ratio of mRNA (e.g., µg) of 1:1:9.

[0485] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), and the HA antigen of an influenza B virus in a ratio of mRNA (e.g., µg) of 1:1:10.

[0486] The composition of any of the embodiments herein may contain a first mRNA, a second mRNA, and a third mRNA (e.g., µg) in a ratio of about 1:1:2.

[0487] The composition of any of the embodiments herein may contain a first mRNA, a second mRNA, and a third mRNA (e.g., µg) in a ratio of about 1:1:3.

[0488] The composition of any of the embodiments herein may contain a first mRNA, a second mRNA, and a third mRNA (e.g., µg) in a ratio of about 1:1:4.

[0489] The composition of any of the embodiments herein may contain a first mRNA, a second mRNA, and a third mRNA (e.g., µg) in a ratio of about 1:1:5.

[0490] The composition of any of the embodiments herein may contain a first mRNA, a second mRNA, and a third mRNA (e.g., µg) in a ratio of about 1:1:6.

[0491] The composition of any of the embodiments herein may contain a first mRNA, a second mRNA, and a third mRNA (e.g., µg) in a ratio of about 1:1:7.

[0492] The composition of any of the embodiments herein may contain a first mRNA, a second mRNA, and a third mRNA (e.g., µg) in a ratio of about 1:1:8.

[0493] The composition of any of the embodiments herein may contain a first mRNA, a second mRNA, and a third mRNA (e.g., µg) in a ratio of about 1:1:9.

[0494] The composition of any of the embodiments herein may contain a first mRNA, a second mRNA, and a third mRNA (e.g., µg) in a ratio of about 1:1:10.

[0495] The composition of any of the embodiments herein may contain a first mRNA, a second mRNA, and a third mRNA (e.g., µg) in a ratio of 1:1:2.

[0496] The composition of any of the embodiments herein may contain a first mRNA, a second mRNA, and a third mRNA (e.g., µg) in a ratio of 1:1:3.

[0497] The composition of any of the embodiments herein may contain a first mRNA, a second mRNA, and a third mRNA (e.g., µg) in a ratio of 1:1:4.

[0498] The composition of any of the embodiments herein may contain a first mRNA, a second mRNA, and a third mRNA (e.g., µg) in a ratio of 1:1:5.

[0499] The composition of any of the embodiments herein may contain a first mRNA, a second mRNA, and a third mRNA (e.g., µg) in a ratio of 1:1:6.

[0500] The composition of any of the embodiments herein may contain a first mRNA, a second mRNA, and a third mRNA (e.g., µg) in a ratio of 1:1:7.

[0501] The composition of any of the embodiments herein may contain a first mRNA, a second mRNA, and a third mRNA (e.g., µg) in a ratio of 1:1:8.

[0502] The composition of any of the embodiments herein may contain a first mRNA, a second mRNA, and a third mRNA (e.g., µg) in a ratio of 1:1:9.

[0503] The composition of any of the embodiments herein may contain a first mRNA, a second mRNA, and a third mRNA (e.g., µg) in a ratio of 1:1:10.

[0504] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), the HA antigen of a first influenza B virus, and the HA antigen of a second influenza B virus (wherein the first and second influenza B viruses belong to different lineages) in an mRNA (e.g., µg) ratio of about 1:1:2:2.

[0505] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), the HA antigen of a first influenza B virus, and the HA antigen of a second influenza B virus (wherein the first and second influenza B viruses belong to different lineages) in an mRNA (e.g., µg) ratio of about 1:1:3:3.

[0506] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), the HA antigen of a first influenza B virus, and the HA antigen of a second influenza B virus (wherein the first and second influenza B viruses belong to different lineages) in an mRNA (e.g., µg) ratio of about 1:1:4:4.

[0507] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), the HA antigen of a first influenza B virus, and the HA antigen of a second influenza B virus (wherein the first and second influenza B viruses belong to different lineages) in an mRNA (e.g., µg) ratio of about 1:1:5:5.

[0508] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), the HA antigen of a first influenza B virus, and the HA antigen of a second influenza B virus (wherein the first and second influenza B viruses belong to different lineages) in an mRNA (e.g., µg) ratio of about 1:1:6:6.

[0509] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), the HA antigen of a first influenza B virus, and the HA antigen of a second influenza B virus (wherein the first and second influenza B viruses belong to different lineages) in an mRNA (e.g., µg) ratio of about 1:1:7:7.

[0510] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), the HA antigen of a first influenza B virus, and the HA antigen of a second influenza B virus (wherein the first and second influenza B viruses belong to different lineages) in an mRNA (e.g., µg) ratio of about 1:1:8:8.

[0511] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), the HA antigen of a first influenza B virus, and the HA antigen of a second influenza B virus (wherein the first and second influenza B viruses belong to different lineages) in an mRNA (e.g., µg) ratio of about 1:1:9:9.

[0512] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), the HA antigen of a first influenza B virus, and the HA antigen of a second influenza B virus (wherein the first and second influenza B viruses belong to different lineages) in an mRNA (e.g., µg) ratio of about 1:1:10:10.

[0513] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), the HA antigen of a first influenza B virus, and the HA antigen of a second influenza B virus (wherein the first and second influenza B viruses belong to different lineages) in a ratio of 1:1:2:2.

[0514] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), the HA antigen of a first influenza B virus, and the HA antigen of a second influenza B virus (wherein the first and second influenza B viruses belong to different lineages) in a ratio of 1:1:3:3.

[0515] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), the HA antigen of a first influenza B virus, and the HA antigen of a second influenza B virus (wherein the first and second influenza B viruses belong to different lineages) in a ratio of 1:1:4:4.

[0516] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), the HA antigen of a first influenza B virus, and the HA antigen of a second influenza B virus (wherein the first and second influenza B viruses belong to different lineages) in a ratio of 1:1:5:5 with mRNA (e.g., µg).

[0517] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), the HA antigen of a first influenza B virus, and the HA antigen of a second influenza B virus (wherein the first and second influenza B viruses belong to different lineages) in an mRNA (e.g., µg) ratio of 1:1:6:6.

[0518] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), the HA antigen of a first influenza B virus, and the HA antigen of a second influenza B virus (wherein the first and second influenza B viruses belong to different lineages) in a ratio of 1:1:7:7.

[0519] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), the HA antigen of a first influenza B virus, and the HA antigen of a second influenza B virus (wherein the first and second influenza B viruses belong to different lineages) in an mRNA (e.g., µg) ratio of 1:1:8:8.

[0520] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), the HA antigen of a first influenza B virus, and the HA antigen of a second influenza B virus (wherein the first and second influenza B viruses belong to different lineages) in a ratio of 1:1:9:9.

[0521] The composition of any embodiment herein may comprise the HA antigen of a first influenza A virus, the HA antigen of a second influenza A virus (wherein the first and second influenza A viruses belong to different subtypes), the HA antigen of a first influenza B virus, and the HA antigen of a second influenza B virus (wherein the first and second influenza B viruses belong to different lineages) in a ratio of 1:1:10:10 with mRNA (e.g., µg).

[0522] The composition of any embodiment herein may contain a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA (e.g., µg) in a ratio of about 1:1:2:2.

[0523] The composition of any embodiment herein may contain a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA (e.g., µg) in a ratio of about 1:1:3:3.

[0524] The composition of any embodiment herein may contain a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA (e.g., µg) in a ratio of about 1:1:4:4.

[0525] The composition of any embodiment herein may contain a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA (e.g., µg) in a ratio of about 1:1:5:5.

[0526] The composition of any embodiment herein may contain a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA (e.g., µg) in a ratio of about 1:1:6:6.

[0527] The composition of any of the embodiments herein may contain a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA (e.g., µg) in a ratio of about 1:1:7:7.

[0528] The composition of any embodiment herein may contain a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA (e.g., µg) in a ratio of about 1:1:8:8.

[0529] The composition of any embodiment herein may contain a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA (e.g., µg) in a ratio of about 1:1:9:9.

[0530] The composition of any embodiment herein may contain a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA (e.g., µg) in a ratio of about 1:1:10:10.

[0531] The composition of any embodiment herein may contain a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA (e.g., µg) in a ratio of 1:1:2:2.

[0532] The composition of any embodiment herein may contain a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA (e.g., µg) in a ratio of 1:1:3:3.

[0533] The composition of any embodiment herein may contain a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA (e.g., µg) in a ratio of 1:1:4:4.

[0534] The composition of any embodiment herein may contain a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA (e.g., µg) in a ratio of 1:1:5:5.

[0535] The composition of any embodiment herein may contain a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA (e.g., µg) in a ratio of 1:1:6:6.

[0536] The composition of any embodiment herein may contain a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA (e.g., µg) in a ratio of 1:1:7:7.

[0537] The composition of any embodiment herein may contain a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA (e.g., µg) in a ratio of 1:1:8:8.

[0538] The composition of any embodiment herein may contain a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA (e.g., µg) in a ratio of 1:1:9:9.

[0539] The composition of any embodiment herein may contain a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA (e.g., µg) in a ratio of 1:1:10:10.

[0540] The composition of any embodiment herein may contain a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA in a ratio of about 32 micrograms of first mRNA: about 32 micrograms of second mRNA: about 64 micrograms of third mRNA: about 64 micrograms of fourth mRNA.

[0541] The composition of any embodiment herein may contain a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA in a ratio of about 16 micrograms of first mRNA: about 16 micrograms of second mRNA: about 64 micrograms of third mRNA: about 64 micrograms of fourth mRNA.

[0542] The composition of any embodiment herein may contain a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA in a ratio of about 16 micrograms of first mRNA: about 16 micrograms of second mRNA: about 96 micrograms of third mRNA: about 96 micrograms of fourth mRNA.

[0543] The composition of any embodiment herein may contain a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA in a ratio of about 32 micrograms of first mRNA, about 32 micrograms of second mRNA, about 64 micrograms of third mRNA, and about 64 micrograms of fourth mRNA.

[0544] The composition of any embodiment herein may contain a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA in a ratio of about 16 micrograms of first mRNA, about 16 micrograms of second mRNA, about 64 micrograms of third mRNA, and about 64 micrograms of fourth mRNA.

[0545] The composition of any embodiment herein may contain a first mRNA, a second mRNA, a third mRNA, and a fourth mRNA in a ratio of about 16 micrograms of first mRNA, about 16 micrograms of second mRNA, about 96 micrograms of third mRNA, and about 96 micrograms of fourth mRNA.

[0546] The composition of any of the embodiments described herein may contain a total of 130 micrograms of mRNA.

[0547] The composition of any of the embodiments described herein may contain a total of 160 micrograms of mRNA.

[0548] The composition of any of the embodiments described herein may contain a total of 200 micrograms of mRNA.

[0549] The composition of any of the embodiments described herein may contain a total of 224 micrograms of mRNA.

[0550] The compositions in any of the embodiments described herein may contain a total of 130 micrograms to 224 micrograms of mRNA.

[0551] The compositions in any of the embodiments herein may include ratios, for example, expressed in picograms (pg), nanograms (ng), micrograms (μg), milligrams (mg). IV. Lipid nanoparticles (LNP)

[0552] The LNP disclosed herein comprises four classes of lipids: (i) ionizable lipids (e.g., cationic lipids); (ii) PEGylated lipids; (iii) cholesterol-based lipids; and (iv) accessory lipids. A. Cationic lipids

[0553] Ionizable lipids promote mRNA encapsulation and can be cationic lipids. Cationic lipids provide a positively charged environment at low pH to promote the efficient encapsulation of negatively charged mRNA drug substances. Exemplary cationic lipids are shown in Table 1 below.

[0554] Table 1 - Cationic Lipids

[0555] Cationic lipids may be selected from the group consisting of: [ckkE10] / [OF-02], [(6Z,9Z,28Z,31Z)-heptadec-6,9,28,31-tetraen-19-yl]4-(dimethylamino)butyrate (D-Lin-MC3-DMA); 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA); 1,2-dilinoleyloxy-N,N-dimethyl-3-aminopropane (DLin-DMA); 9-((4-(dimethylamino)butyryl)oxy)heptadecanoic acid di((Z)-non-2-en-1-yl) ester (L319); 8-{(2-hydroxyethyl [6-oxo-6-(undecyloxy)hexyl]amino}octanoic acid 9-heptadecyl ester (SM-102); [(4-hydroxybutyl)azanidinediyl]di(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315); (Z)-octadec-9-enoic acid [3-(dimethylamino)-2-[(Z)-octadec-9-enoyl]oxypropyl] ester (DODAP); 2,5-bis(3-aminopropylamino)-N-[2-[di(heptadecyl)amino]-2-oxoethyl]pentanamide (DOGS); N-[2-(dimethylamino)ethyl]carbamate [(3S,8S,9S,10R,13R,14S,17R)- 10,13-Dimethyl-17-[(2R)-6-methylheptane-2-yl]-2,3,4,7,8,9,11,12,14,15,16,17-dodecylhydro-1H-cyclopentadien[a]phenanthrene-3-yl] ester (DC-Chol); Tetra(8-methylnonyl)3,3',3'',3'''-(((methylazanediyl)bis(propane-3,1diyl)) ester (306Oi10); (2-(dioctylammonium)ethyl)decyl phosphate (9A1P9); 5,5-Di((Z)-heptadec-8-en-1-yl)-1-(3-(pyrrolidine-1-yl)propyl)-2,5-dihydro-1H-imidazolium -2-Carboxyethyl ester (A2-Iso5-2DC18); 3,3'-((3-methyl-9-oxo-10-oxa-13,14-dithia-3,6-diazatrichol)azanediyl)dipropionate bis(2-(dodecyldithioyl)ethyl) ester (BAME-O16B); 1,1'-((2-(4-(2-((2-(bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)amino)ethyl)piperazin-1-yl)ethyl)azanediyl)bis(dodecyl-2-ol) (C12-200); 3,6-bis(4-(bis(2-hydroxydodecyl)amino)butyl)piperazin-2,5-dione (cKK-E12);Tris(azanetriyl))hexanonanoic acid hexa(octane-3-yl)9,9′,9′′,9′′′,9′′′′,9′′′′-((((benzene-1,3,5-tricarbonyl)tri(azanediyl))tri(propane-3,1-diyl)) ester (FTT5); (9Z,9′Z,9″Z,9′′′Z,12Z,12′Z,12″Z,12′′′Z)-tetra(octadec-9,12-dienoic acid(((3,6-dioxopiperazine-2,5-diyl)bis(butane-4,1-diyl))bis(azanetriyl))tetra(ethane-2,1 -diyl) ester) (OF-Deg-Lin); TT3; N1,N3,N5-tris(3-(eicosylamino)propyl)phenyl-1,3,5-tricarboxamide; N1-[2-((1S)-1-[(3-aminopropyl)amino]-4-[di(3-aminopropyl)amino]butylformylamino)ethyl]-3,4-di[oleyloxy]-benzamide (MVL5); 8-((2-hydroxyethyl)(8-(nonoxy)-8-oxooctyl)amino)octanoic acid heptadecanyl-9-yl ester (lipid 5); IM-001; and combinations thereof.

[0556] In some embodiments, the cationic lipids are biodegradable.

[0557] In various embodiments, the cationic lipids are not biodegradable.

[0558] In some embodiments, the cationic lipid is cleavable.

[0559] In some embodiments, the cationic lipids are not cleavable.

[0560] Cationic lipids are described in further detail in Dong et al. (PNAS. Proceedings of the National Academy of Sciences 111(11):3955-60. 2014); Fenton et al. (Adv. Mater. Advanced Materials 28:2939. 2016); U.S. Patent No. 9,512,073; and U.S. Patent No. 10,201,618, each of which is incorporated herein by reference. B. PEGylated lipids

[0561] PEGylated lipid components provide control over the particle size and stability of nanoparticles. The addition of such components can prevent complex aggregation and provides a means to increase cycle life and delivery of lipid-nucleic acid drug compositions to target tissues (Klibanov et al., FEBS Letters [Federation of European Biochemical Societies Letters] 268(1):235-7, 1990). These components can be selected for rapid exchange from the drug composition in vivo (see, for example, US Patent No. 5,885,613).

[0562] The PEGylated lipids under consideration include, but are not limited to, polyethylene glycol (PEG) chains up to 5 kDa in length, covalently linked to one or more alkyl chains having a length of C6-C20 (e.g., C8, C10, C12, C14, C16, or C18), such as derivatized ceramides (e.g., N-octanoyl-sphingosine-1-[succinyl(methoxy)polyethylene glycol)] (C8 PEG ceramide)). In some embodiments, the PEGylated lipids are 1,2-dimyristoyl-racemic-glycerol-3-methoxy polyethylene glycol (DMG-PEG); 1,2-distearyl-sn-glycerol-3-phosphate ethanolamine-polyethylene glycol (DSPE-PEG); 1,2-dilauryl-sn-glycerol-3-phosphate ethanolamine-polyethylene glycol (DLPE-PEG); or 1,2-distearyl-racemic-glycerol-polyethylene glycol (DSG-PEG); PEG-DAG; PEG-PE; PEG-S-DAG; PEG-S-DMG; PEG-cer; PEG-dialkoxypropylcarbamate; 2-[(polyethylene glycol)-2000]-N,N-bistetradecylacetamide (ALC-0159); and combinations thereof.

[0563] In some embodiments, the PEG has a high molecular weight, for example, 2000-2400 g / mol. In some embodiments, the PEG is PEG2000 (or PEG-2K). In some embodiments, the PEGylated lipids described herein are DMG-PEG2000, DSPE-PEG2000, DLPE-PEG2000, DSG-PEG2000, C8 PEG2000, or ALC-0159 (2-[(polyethylene glycol)-2000]-N,N-bistetradecylacetamide). In some embodiments, the PEGylated lipids described herein are DMG-PEG2000. C. Cholesterol-based lipids

[0564] The cholesterol component provides stability to the lipid bilayer structure within the nanoparticles. In some embodiments, the LNP comprises one or more cholesterol-based lipids. Suitable cholesterol-based lipids include, for example: DC-Choi (N,N-dimethyl-N-ethylformamidocholesterol), 1,4-bis(3-N-oleenylaminopropyl)piperazine (Gao et al., BiochemBiophys Res Comm. [Biochemistry and Biophysics Research Communications] (1991) 179:280; Wolf et al., BioTechniques [Biotechnology] (1997) 23:139; US Patent 5,744,335), and imidazole cholesterol ester (“ICE”; WO 2011 / 068810), sitosterol (22,23-dihydrostigmasterol), β-stigmasterol, sitosterol, fucosterol, stigmasterol (stigmasterane-5,22-dien-3-ol), ergosterol; 3β-hydroxy-5,24-cholestadiene; lanosterol (8,24-lanosterdien-3β-ol); 7-dehydrocholesterol (Δ5,7-cholesterol); dihydrolanosterol (24,25-dihydrolanosterol); yeast sterol (5α-cholest-8,24-dien-3β-ol); cholesterol Lathosterol (5α-cholesterol-7-en-3β-ol); diosgenin ((3β,25R)-spirost-5-en-3-ol); campesterol (campesterol-5-en-3β-ol); campestanol (5α-campestanol-3β-ol); 24-methylene cholesterol (5,24(28)-cholestadien-24-methylen-3β-ol); cholesterol margarate (cholesterol-5-en-3β-yl margarate); cholesterol oleate; cholesterol stearate; and other modified forms of cholesterol. In some embodiments, the cholesterol-based lipids used in the LNP are cholesterol. D. Helper lipids

[0565] The assisting lipid enhances the structural stability of the LNP and facilitates its escape from the endosome. It improves the uptake and release of the mRNA drug payload. In some embodiments, the assisting lipid is a zwitterionic lipid with fusion-promoting properties for enhancing the uptake and release of the drug payload. Examples of accessory lipids are 1,2-dioleoyl-SN-glycerol-3-phosphate ethanolamine (DOPE); 1,2-distearyl-sn-glycerol-3-phosphate choline (DSPC); 1,2-dioleoyl-sn-glycerol-3-phosphate-L-serine (DOPS); 1,2-ditransoleoyl-sn-glycerol-3-phosphate ethanolamine (DEPE); and 1,2-dioleoyl-sn-glycerol-3-phosphate choline (DPOC), dipalmitoylphosphatidylcholine (DPPC), DMPC, 1,2-dilauroyl-sn-glycerol-3-phosphate choline (DLPC), 1,2-distearylphosphatidylethanolamine (DSPE), and 1,2-dilauroyl-sn-glycerol-3-phosphate ethanolamine (DLPE).

[0566] Other exemplary cofactor lipids are dioleoylphosphatidylcholine (DOPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine 4-(N-maleiminomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphatidylethanolamine (DMPE), phosphatidylserine, sphingolipids, sphingomyelin, ceramides, cerebrosides, gangliosides, 16-O-monomethylPE, 16-O-dimethylPE, 18-1-transPE, 1-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE), or combinations thereof. In some embodiments, the cofactor lipid is DOPE. In some embodiments, the cofactor lipid is DSPC.

[0567] In various embodiments, the LNP of the present invention comprises (i) a cationic lipid selected from OF-02, cKK-E10, GL-HEPES-E3-E10-DS-3-E18-1, GL-HEPES-E3-E12-DS-4-E10 or GL-HEPES-E3-E12-DS-3-E14; (ii) DMG-PEG2000; (iii) cholesterol; and (iv) DOPE. E. Molar ratio of lipid components

[0568] The molar ratios of the components described are important for the effectiveness of LNPs in delivering mRNA. The molar ratio of cationic lipids, PEGylated lipids, cholesterol-based lipids, and cofactor lipids is A:B:C:D, where A + B + C + D = 100%. In some embodiments, the molar ratio of cationic lipids to total lipids (i.e., A) in the LNP is 35%-55%, such as 35%-50% (e.g., 38%-42%, such as 40% or 45%-50%). In some embodiments, the molar ratio of the PEGylated lipid component to total lipids (i.e., B) is 0.25%-2.75% (e.g., 1%-2%, such as 1.5%). In some embodiments, the molar ratio of cholesterol-based lipids to total lipids (i.e., C) is 20%-50% (e.g., 27%-30%, such as 28.5% or 38%-43%). In some embodiments, the molar ratio of the auxiliary lipids to the total lipids (i.e., D) is 5%-35% (e.g., 28%-32%, such as 30% or 8%-12%, such as 10%). In some embodiments, the (PEGylated lipids + cholesterol) component has the same molar amount as the auxiliary lipids. In some embodiments, the molar ratio of the cationic lipids to the auxiliary lipids contained in the LNP is greater than 1.

[0569] In some embodiments, the LNP disclosed herein includes:

[0570] Cationic lipids with a molar ratio of 35% to 55% or 40% to 50% (e.g., cationic lipids with molar ratios of 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54% or 55%).

[0571] A polyethylene glycol (PEG) conjugated (PEGylated) lipid in a molar ratio of 0.25% to 2.75% or 1.00% to 2.00% (e.g., PEGylated lipids in molar ratios of 0.25%, 0.50%, 0.75%, 1.00%, 1.25%, 1.50%, 1.75%, 2.00%, 2.25%, 2.50%, or 2.75%).

[0572] Cholesterol-based lipids with molar ratios of 20% to 45%, 20% to 50%, 25% to 45%, or 28.5% to 43% (e.g., cholesterol-based lipids with molar ratios of 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, or 50%); and

[0573] The auxiliary lipids are in the molar ratio of 5% to 35%, 8% to 30%, or 10% to 30% (e.g., auxiliary lipids in the molar ratio of 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, or 35%).

[0574] All of these molar ratios are relative to the total lipid content of the LNP.

[0575] In some embodiments, the LNP comprises: 40% cationic lipids; 1.5% PEGylated lipids; 28.5% cholesterol-based lipids; and 30% auxiliary lipids.

[0576] In some embodiments, the PEGylated lipid is dimyristicoyl-PEG2000 (DMG-PEG2000).

[0577] In various embodiments, the cholesterol-based lipid is cholesterol.

[0578] In some embodiments, the auxiliary lipid is 1,2-dioleoyl-SN-glycerol-3-phosphate ethanolamine (DOPE).

[0579] In some embodiments, the LNP comprises: OF-02 in a molar ratio of 35% to 55%; DMG-PEG2000 in a molar ratio of 0.25% to 2.75%; cholesterol in a molar ratio of 20% to 50%; and DOPE in a molar ratio of 5% to 35%.

[0580] In some embodiments, the LNP comprises: cKK-E10 in a molar ratio of 35% to 55%; DMG-PEG2000 in a molar ratio of 0.25% to 2.75%; cholesterol in a molar ratio of 20% to 50%; and DOPE in a molar ratio of 5% to 35%.

[0581] In some embodiments, the LNP comprises: GL-HEPES-E3-E10-DS-3-E18-1 in a molar ratio of 35% to 55%; DMG-PEG2000 in a molar ratio of 0.25% to 2.75%; cholesterol in a molar ratio of 20% to 50%; and DOPE in a molar ratio of 5% to 35%.

[0582] In some embodiments, the LNP comprises: GL-HEPES-E3-E12-DS-4-E10 in a molar ratio of 35% to 55%; DMG-PEG2000 in a molar ratio of 0.25% to 2.75%; cholesterol in a molar ratio of 20% to 50%; and DOPE in a molar ratio of 5% to 35%.

[0583] In some embodiments, the LNP comprises: GL-HEPES-E3-E12-DS-3-E14 in a molar ratio of 35% to 55%; DMG-PEG2000 in a molar ratio of 0.25% to 2.75%; cholesterol in a molar ratio of 20% to 50%; and DOPE in a molar ratio of 5% to 35%.

[0584] In some embodiments, the LNP comprises: SM-102 in a molar ratio of 35% to 55%; DMG-PEG2000 in a molar ratio of 0.25% to 2.75%; cholesterol in a molar ratio of 20% to 50%; and DSPC in a molar ratio of 5% to 35%.

[0585] In some embodiments, the LNP comprises: ALC-0315 in a molar ratio of 35% to 55%; ALC-0159 in a molar ratio of 0.25% to 2.75%; cholesterol in a molar ratio of 20% to 50%; and DSPC in a molar ratio of 5% to 35%.

[0586] In some embodiments, the LNP comprises: 40% OF-02 in a molar ratio; 1.5% DMG-PEG2000 in a molar ratio; 28.5% cholesterol in a molar ratio; and 30% DOPE in a molar ratio. This LNP formulation is designated herein as "Lipid A".

[0587] In some embodiments, the LNP comprises: 40% cKK-E10 in molar ratio; 1.5% DMG-PEG2000 in molar ratio; 28.5% cholesterol in molar ratio; and 30% DOPE in molar ratio. This LNP formulation is designated herein as "Lipid B".

[0588] In some embodiments, the LNP comprises: 40% GL-HEPES-E3-E10-DS-3-E18-1 in a molar ratio; 1.5% DMG-PEG2000 in a molar ratio; 28.5% cholesterol in a molar ratio; and 30% DOPE in a molar ratio. This LNP formulation is designated herein as "Lipid C".

[0589] In some embodiments, the LNP comprises: 40% GL-HEPES-E3-E12-DS-4-E10 in a molar ratio; 1.5% DMG-PEG2000 in a molar ratio; 28.5% cholesterol in a molar ratio; and 30% DOPE in a molar ratio. This LNP formulation is designated herein as "Lipid D".

[0590] In some embodiments, the LNP comprises: 40% GL-HEPES-E3-E12-DS-3-E14 in a molar ratio; 1.5% DMG-PEG2000 in a molar ratio; 28.5% cholesterol in a molar ratio; and 30% DOPE in a molar ratio. This LNP formulation is designated herein as "Lipid E".

[0591] In some embodiments, the LNP comprises: 50% of 9-heptadecyl 8-{(2-hydroxyethyl)[6-oxo-6-(undecyloxy)hexyl]amino}octanoate (SM-102); 10% of 1,2-distearyl-sn-glycerol-3-phosphocholine (DSPC); 38.5% of cholesterol; and 1.5% of 1,2-dimyristoyl-racemic-glycerol-3-methoxy polyethylene glycol-2000 (DMG-PEG2000).

[0592] In some embodiments, the LNP comprises: 46.3% molar amount of [(4-hydroxybutyl)azonyl]bis(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315); 9.4% molar amount of 1,2-distearyl-sn-glycerol-3-phosphocholine (DSPC); 42.7% molar amount of cholesterol; and 1.6% molar amount of 2-[(polyethylene glycol)-2000]-N,N-bistetradecylacetamide (ALC-0159).

[0593] In some embodiments, the LNP comprises: 47.4% molar amount of [(4-hydroxybutyl)azanidinediyl]bis(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315); 10% molar amount of 1,2-distearyl-sn-glycerol-3-phosphocholine (DSPC); 40.9% molar amount of cholesterol; and 1.7% molar amount of 2-[(polyethylene glycol)-2000]-N,N-bistetradecylacetamide (ALC-0159).

[0594] In some embodiments, the LNP comprises: 40% IM-001; 1.5% DMG-PEG2000; 28.5% cholesterol; and 30% DOPE.

[0595] To calculate the actual amount of each lipid to be incorporated into the LNP formulation, the molar amount of the cationic lipid is first determined based on the desired N / P ratio, where N is the number of nitrogen atoms in the cationic lipid and P is the number of phosphate groups in the mRNA to be transported by LNP. Next, the molar amount of each other lipid is calculated based on the molar amount of the cationic lipid and the selected molar ratio. These molar amounts are then converted to weight using the molecular weight of each lipid. F. Buffer and other components

[0596] To stabilize nucleic acids and / or LNPs (e.g., to extend the shelf life of vaccine products), to facilitate the administration of LNP pharmaceutical compositions, and / or to enhance the in vivo expression of nucleic acids, nucleic acids and / or LNPs may be formulated in combination with one or more carriers, targeting ligands, stabilizing agents (e.g., preservatives and antioxidants), and / or other pharmaceutically acceptable excipients. Examples of such excipients include parabens, thimerosal, sodium thiomersal, chlorobutanol, benzalkonium chloride, and chelating agents (e.g., EDTA).

[0597] The LNP compositions disclosed herein can be provided in either a cryo-liquid or lyophilized form. Various cryoprotectants can be used, including, but not limited to, sucrose, trehalose, glucose, mannitol, mannose, dextrose, etc. The cryoprotectant can constitute 5%-30% (w / v) of the LNP composition. In some embodiments, the LNP composition contains trehalose, for example, 5%-30% (e.g., 10%) (w / v). Once formulated with a cryoprotectant, the LNP composition can be frozen (or lyophilized and cryopreserved) at -20°C to -80°C.

[0598] The LNP composition can be provided to the patient in an aqueous buffer solution: if previously frozen, it is thawed, or if previously lyophilized, it is reconstituted at the bedside in an aqueous buffer solution. The buffer solution is preferably isotonic and suitable for, for example, intramuscular or intradermal injection. In some embodiments, the buffer solution is phosphate-buffered saline (PBS). V. Methods for manufacturing LNP vaccines

[0599] The LNPs of the present invention can be prepared using various techniques known in the art. For example, multilayer vesicles (MLVs) can be prepared according to conventional techniques, such as by depositing selected lipids onto the inner wall of a suitable container or vessel (by dissolving the lipids in a suitable solvent and then evaporating the solvent to leave a thin film inside the vessel) or by spray drying. An aqueous phase can then be added to the vessel with vortex motion, which allows the MLV to form. A single-layer vesicle (ULV) can then be formed by homogenizing, sonicating, or extruding the multilayer vesicles. Alternatively, a detergent removal technique can be used to form single-layer vesicles.

[0600] Several methods are described in patent application publications US 2011 / 0244026, US 2016 / 0038432, US 2018 / 0153822, US 2018 / 0125989, and US 2021 / 0046192, and can be used to prepare LNP vaccines. One exemplary method requires encapsulating mRNA by mixing a mixture of mRNA and lipids without first pre-forming the lipids into lipid nanoparticles, as described in patent application publication US 2016 / 0038432. Another exemplary method requires encapsulating mRNA by mixing pre-formed LNPs with mRNA, as described in patent application publication US 2018 / 0153822.

[0601] In some embodiments, a method for preparing LNPs loaded with mRNA includes heating one or more solutions to a temperature above ambient temperature, wherein the one or more solutions are a solution containing pre-formed lipid nanoparticles, a solution containing mRNA, and a mixed solution containing mRNA encapsulated with LNPs. In some embodiments, the method includes heating one or both of the mRNA solution and the pre-formed LNP solution prior to a mixing step. In some embodiments, the method includes heating one or more of the solution containing the pre-formed LNPs, the solution containing mRNA, and the solution containing mRNA encapsulated with LNPs during a mixing step. In some embodiments, the method includes heating the LNP-encapsulated mRNA after a mixing step. In some embodiments, the one or more solutions are heated to or above the following temperatures: about 30°C, 37°C, 40°C, 45°C, 50°C, 55°C, 60°C, 65°C, or 70°C. In some embodiments, one or more solutions are heated to the following temperature ranges: about 25°C-70°C, about 30°C-70°C, about 35°C-70°C, about 40°C-70°C, about 45°C-70°C, about 50°C-70°C, or about 60°C-70°C. In some embodiments, the temperature is about 65°C.

[0602] Various methods can be used to prepare mRNA solutions suitable for the present invention. In some embodiments, mRNA can be directly dissolved in the buffer solution described herein. In some embodiments, the mRNA solution can be generated by mixing the mRNA stock solution with the buffer solution prior to mixing with the lipid solution for encapsulation. In some embodiments, the mRNA solution can be generated by mixing the mRNA stock solution with the buffer solution immediately prior to mixing with the lipid solution for encapsulation. In some embodiments, a suitable mRNA stock solution may contain mRNA at a concentration in water or buffer of about 0.2 mg / ml, 0.4 mg / ml, 0.5 mg / ml, 0.6 mg / ml, 0.8 mg / ml, 1.0 mg / ml, 1.2 mg / ml, 1.4 mg / ml, 1.5 mg / ml, or 1.6 mg / ml, 2.0 mg / ml, 2.5 mg / ml, 3.0 mg / ml, 3.5 mg / ml, 4.0 mg / ml, 4.5 mg / ml, or 5.0 mg / ml.

[0603] In some embodiments, a pump is used to mix the mRNA stock solution with the buffer solution. Exemplary pumps include, but are not limited to, gear pumps, peristaltic pumps, and centrifugal pumps. Typically, the buffer solution is mixed at a rate greater than that of the mRNA stock solution. For example, the buffer solution may be mixed at a rate of at least 1x, 2x, 3x, 4x, 5x, 6x, 7x, 8x, 9x, 10x, 15x, or 20x that of the mRNA stock solution. In some embodiments, the buffer solution is mixed at a flow rate in the range of about 100-6000 ml / min (e.g., about 100-300 ml / min, 300-600 ml / min, 600-1200 ml / min, 1200-2400 ml / min, 2400-3600 ml / min, 3600-4800 ml / min, 4800-6000 ml / min, or 60-420 ml / min). In some embodiments, the buffer solution is mixed at a flow rate of about 60 ml / min, 100 ml / min, 140 ml / min, 180 ml / min, 220 ml / min, 260 ml / min, 300 ml / min, 340 ml / min, 380 ml / min, 420 ml / min, 480 ml / min, 540 ml / min, 600 ml / min, 1200 ml / min, 2400 ml / min, 3600 ml / min, 4800 ml / min, or 6000 ml / min.

[0604] In some embodiments, the mRNA stock solution is mixed at a flow rate ranging from about 10 to 600 ml / min (e.g., about 5 to 50 ml / min, about 10 to 30 ml / min, about 30 to 60 ml / min, about 60 to 120 ml / min, about 120 to 240 ml / min, about 240 to 360 ml / min, about 360 to 480 ml / min, or about 480 to 600 ml / min). In some embodiments, the mRNA stock solution is mixed at a flow rate of about 5 ml / min, 10 ml / min, 15 ml / min, 20 ml / min, 25 ml / min, 30 ml / min, 35 ml / min, 40 ml / min, 45 ml / min, 50 ml / min, 60 ml / min, 80 ml / min, 100 ml / min, 200 ml / min, 300 ml / min, 400 ml / min, 500 ml / min, or 600 ml / min.

[0605] The process of incorporating desired mRNA into lipid nanoparticles is referred to as “addition”. An exemplary method is described in Lasic et al., FEBS Lett. [FEBS Communications] (1992) 312:255-8. The nucleic acid incorporated into the LNP can be entirely or partially located within the internal space of the lipid nanoparticle, within the bilayer of the lipid nanoparticle membrane, or associated with the outer surface of the lipid nanoparticle membrane. Incorporating mRNA into lipid nanoparticles is also referred to herein as “encapsulation,” in which the nucleic acid is completely or substantially contained within the internal space of the lipid nanoparticle.

[0606] Suitable LNPs can be prepared in various sizes. In some embodiments, reduced lipid nanoparticle size is associated with more efficient mRNA delivery. The selection of an appropriate LNP size can take into account the target cell or tissue site and, to some extent, the application for which the lipid nanoparticles will be used.

[0607] Several methods known in the art can be used to regulate the size of lipid nanoparticle clusters. The preferred method described herein utilizes the Zetasizer Nano ZS (Malvern Panalytical) to measure LNP particle size. In one protocol, 10 μl of an LNP sample is mixed with 990 μl of 10% trehalose. This solution is placed in a cuvette and then placed in the Zetasizer machine. The z-mean diameter (nm), or cumulative mean, is considered to be the average size of the LNPs in the sample. The Zetasizer machine can also be used to measure the polydispersity index (PDI) using dynamic light scattering (DLS) and cumulative analysis of autocorrelation functions. The average LNP diameter can be reduced by sonicating the formed LNPs. Intermittent sonication cycles can be alternated with quasi-elastic light scattering (QELS) assessments to guide efficient lipid nanoparticle synthesis.

[0608] In some embodiments, the majority of purified LNPs (i.e., LNPs with a purity greater than about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%) have a size of about 70–150 nm (e.g., about 145 nm, about 140 nm, about 135 nm, about 130 nm, about 125 nm, about 120 nm, about 115 nm, about 110 nm, about 105 nm, about 100 nm, about 95 nm, about 90 nm, about 85 nm, or about 80 nm). In some embodiments, substantially all (e.g., more than 80% or 90%) of the purified lipid nanoparticles are about 70-150 nm in size (e.g., about 145 nm, about 140 nm, about 135 nm, about 130 nm, about 125 nm, about 120 nm, about 115 nm, about 110 nm, about 105 nm, about 100 nm, about 95 nm, about 90 nm, about 85 nm, or about 80 nm).

[0609] In some embodiments, the average diameter of the LNP is 30-200 nm.

[0610] In various embodiments, the average diameter of the LNP is 80-150 nm.

[0611] In some embodiments, the average size of the LNP in the composition of the present invention is less than 150 nm, less than 120 nm, less than 100 nm, less than 90 nm, less than 80 nm, less than 70 nm, less than 60 nm, less than 50 nm, less than 30 nm, or less than 20 nm.

[0612] In some embodiments, the size of more than 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the LNPs in the compositions of the present invention ranges from about 40-90 nm (e.g., about 45-85 nm, about 50-80 nm, about 55-75 nm, about 60-70 nm) or about 50-70 nm (e.g., 55-65 nm), which is particularly suitable for lung delivery via nebulization.

[0613] In some embodiments, in the pharmaceutical compositions provided by the present invention, the dispersion or molecular size heterogeneity (PDI) of LNPs is less than about 0.5. In some embodiments, the PDI of LNPs is less than about 0.5, less than about 0.4, less than about 0.3, less than about 0.28, less than about 0.25, less than about 0.23, less than about 0.20, less than about 0.18, less than about 0.16, less than about 0.14, less than about 0.12, less than about 0.10, or less than about 0.08. The PDI can be measured using a Zetasizer machine as described above.

[0614] In some embodiments, greater than about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the purified LNPs in the pharmaceutical compositions provided herein encapsulate mRNA within each individual particle. In some embodiments, substantially all (e.g., greater than 80% or 90%) of the purified lipid nanoparticles in the pharmaceutical compositions encapsulate mRNA within each individual particle. In some embodiments, the encapsulation efficiency of the lipid nanoparticles is 50% to 99%; or greater than about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 92%, 95%, 98%, or 99%. Typically, the encapsulation efficiency of the lipid nanoparticles used herein is at least 90% (e.g., at least 91%, 92%, 93%, 94%, or 95%).

[0615] In some embodiments, the N / P ratio of the LNP is between 1 and 10. In some embodiments, the N / P ratio of the lipid nanoparticles is greater than 1, about 1, about 2, about 3, about 4, about 5, about 6, about 7, or about 8. In other embodiments, the typical N / P ratio of the LNPs described herein is 4.

[0616] In some embodiments, the pharmaceutical composition according to the invention contains at least about 0.5 μg, 1 μg, 5 μg, 10 μg, 100 μg, 500 μg, or 1000 μg of encapsulated mRNA. In some embodiments, the pharmaceutical composition contains about 0.1 μg to 1000 μg, at least about 0.5 μg, at least about 0.8 μg, at least about 1 μg, at least about 5 μg, at least about 8 μg, at least about 10 μg, at least about 50 μg, at least about 100 μg, at least about 500 μg, or at least about 1000 μg of encapsulated mRNA.

[0617] In some embodiments, mRNA can be prepared by chemical synthesis or by in vitro transcription (IVT) of a DNA template. An exemplary method for preparing and purifying mRNA is described in Example 1. In this method, during IVT, a cDNA template is used to generate mRNA transcripts, and the DNA template is degraded by a DNase. The transcripts are purified by deep filtration and tangential flow filtration (TFF). The purified transcripts are further modified by adding a cap and tail, and the modified RNA is purified again by deep filtration and TFF.

[0618] The mRNA is then prepared in an aqueous buffer and mixed with an amphiphilic solution containing the lipid components of the LNP. The amphiphilic solution for dissolving the four lipid components of the LNP can be an alcohol solution. In some embodiments, the alcohol is ethanol. The aqueous buffer can be, for example, a citrate, phosphate, acetate, or succinate buffer and can have a pH of about 3.0–7.0 (e.g., about 3.5, about 4.0, about 4.5, about 5.0, about 5.5, about 6.0, or about 6.5). The buffer may contain other components, such as salts (e.g., sodium, potassium, and / or calcium salts). In a particular embodiment, the aqueous buffer has 1 mM citrate, 150 mM NaCl, and a pH of 4.5.

[0619] An exemplary non-limiting method for preparing mRNA-LNP compositions involves mixing a buffered mRNA solution with an ethanol solution of lipids in a controlled, homogeneous manner, wherein the lipid:mRNA ratio is maintained throughout the mixing process. In this illustrative example, the mRNA is presented in an aqueous buffer containing citrate monohydrate, trisodium citrate dihydrate, and sodium chloride. The mRNA solution is added to a solution (1 mM citrate buffer, 150 mM NaCl, pH 4.5). A lipid mixture of four lipids (e.g., cationic lipids, PEGylated lipids, cholesterol-based lipids, and accessory lipids) is dissolved in ethanol. The aqueous mRNA solution and the ethanol lipid solution are mixed at a 4:1 volume ratio in a T-shaped mixer with a near-pulseless pump system. The resulting mixture is then subjected to downstream purification and buffer exchange. Buffer exchange can be performed using a dialysis cassette or a TFF system. A TFF can be used to concentrate and buffer exchange the resulting nascent LNPs immediately following formation via the T-mixing process. The percolation process is a continuous operation, maintaining a constant volume by adding appropriate buffer at the same rate as the percolation stream. VI. Packaging and Use of mRNA-LNP Vaccines

[0620] mRNA-LNP vaccines can be formulated or packaged for parenteral (e.g., intramuscular, intradermal, or subcutaneous) or nasopharyngeal (e.g., intranasal) administration. In various embodiments, mRNA-LNP vaccines can be formulated or packaged for pulmonary administration. In various embodiments, mRNA-LNP vaccines can be formulated or packaged for intravenous administration. The vaccine composition can be in the form of a ready-to-use formulation, wherein the LNP composition is lyophilized and reconstituted with physiological buffer (e.g., PBS) just before use. The vaccine composition can also be shipped and provided as an aqueous solution or a frozen aqueous solution and can be administered directly to the subject without reconstitution (or after thawing if previously frozen).

[0621] Therefore, this disclosure provides an article of manufacture (such as a kit) that provides an mRNA-LNP vaccine in a single container, or provides an mRNA-LNP vaccine in one container (e.g., a first container) and physiological buffer for reconstitution in another container (e.g., a second container). The one or more containers may contain a single-use dose or a multiple-use dose. The one or more containers may be pretreated glass vials or ampoules. The article of manufacture may also include instructions for use.

[0622] In some embodiments, the mRNA-LNP vaccine is provided for use in an intramuscular (IM) injection. The vaccine may be injected into the deltoid muscle of the subject, for example, in his / her upper arm. In some embodiments, the vaccine is provided in a pre-filled syringe or injector (e.g., single-chambered or multi-chambered). In some embodiments, the vaccine is provided for use in inhalation and is provided in a pre-filled pump, nebulizer, or inhaler.

[0623] mRNA-LNP vaccines can be administered to subjects in need at a preventative effective dose, which is an amount that provides sufficient immune protection against the target pathogen for a sustained duration (e.g., one year, two years, five years, ten years, or a lifetime). Sufficient immune protection can be, for example, prevention or reduction of symptoms associated with pathogen infection. In some embodiments, multiple doses (e.g., two doses) of the vaccine are administered (e.g., by injection) to subjects in need to achieve the desired preventative effect. The doses (e.g., a primary dose and a booster dose) can be spaced at intervals of at least, for example, 2 weeks, 3 weeks, 4 weeks, one month, two months, three months, four months, five months, six months, one year, two years, five years, or ten years. VII. Carrier

[0624] In one aspect, this document discloses vectors including the mRNA compositions disclosed herein. RNA sequences encoding target proteins (e.g., mRNA encoding influenza HA protein) can be cloned into many types of vectors. For example, nucleic acids can be cloned into vectors, including but not limited to plasmids, phage particles, phage derivatives, animal viruses, and granules. Specific target vectors can include expression vectors, replication vectors, probe-generating vectors, sequencing vectors, and vectors optimized for in vitro transcription.

[0625] In some embodiments, the vector can be used to express mRNA in host cells. In various embodiments, the vector can be used as a template for IVT. The construction of the optimally translated IVT mRNA for therapeutic use is disclosed in detail in Sahin et al. (2014). Nat. Rev. Drug Discov. 13, 759-780; Weissman (2015). Expert Rev. Vaccines 14, 265-281.

[0626] In some embodiments, the vectors disclosed herein may include at least the following from 5' to 3': an RNA polymerase promoter; a polynucleotide sequence encoding a 5' UTR; a polynucleotide sequence encoding an ORF; a polynucleotide sequence encoding a 3' UTR; and a polynucleotide sequence encoding at least one RNA aptamer. In some embodiments, the vectors disclosed herein may contain polynucleotide sequences encoding a poly(A) sequence and / or a polyadenylation signal.

[0627] Various RNA polymerase promoters are known. In some embodiments, the promoter may be the T7 RNA polymerase promoter. Other useful promoters may include, but are not limited to, the T3 and SP6 RNA polymerase promoters. Common nucleotide sequences for the T7, T3, and SP6 promoters are known.

[0628] This article also discloses host cells (e.g., mammalian cells, such as human cells) including the vectors or RNA compositions disclosed herein.

[0629] Polynucleotides can be introduced into target cells using any of a variety of different methods, such as commercially available methods, including but not limited to electroporation (Amaxa Nucleofector-II (Amaxa Biosystems, Cologne, Germany)), (ECM 830 (BTX) (Harvard Instruments, Boston, Massachusetts) or Gene Pulser II (BioRad, Denver, Colorado)), Multiporator (Eppendorf, Hamburg, Germany), cationic liposome-mediated transfection using lipid transfection, polymer encapsulation, peptide-mediated transfection, biological projectile particle delivery systems (such as “gene guns”) (see, for example, Nishikawa et al. (2001). Hum Gene Ther. [Human Gene Therapy] 12(8): 861-70) or TransIT-RNA transfection kit (Mirus, Madison, WI).

[0630] Chemical means for introducing polynucleotides into host cells include colloidal dispersion systems such as macromolecular complexes, nanocapsules, microspheres, beads, and lipid-based systems (including oil-in-water emulsions, micelles, mixed micelles, and liposomes). An exemplary colloidal system used as a delivery carrier in vitro and in vivo is a liposome (e.g., an artificial membrane capsule).

[0631] Regardless of the method used to introduce exogenous nucleic acids into host cells or otherwise expose cells to the inhibitors disclosed herein, various measurements can be performed to confirm the presence of mRNA sequences in host cells. VIII. Self-replicating RNA and trans-replicating RNA

[0632] Self-replicating RNA:

[0633] On one hand, this paper discloses self-replicating RNAs encoding influenza proteins, such as influenza HA protein.

[0634] Self-replicating RNA can be generated by using replication elements derived from, for example, alphaviruses and replacing structural viral proteins with nucleotide sequences encoding target proteins (e.g., influenza HA proteins). Self-replicating RNA is typically a positive-strand molecule that can be directly translated upon delivery to the cell, and this translation provides an RNA-dependent RNA polymerase that then produces both antisense and sense transcripts from the delivered RNA. Thus, the delivered RNA results in the production of multiple daughter RNAs. These daughter RNAs, along with collinear subgenomic transcripts, can be self-translated to provide in situ expression of the encoded antigen (i.e., the influenza HA protein antigen), or they can be transcribed to provide additional transcripts with the same meaning as the delivered RNA, which are then translated to provide in situ expression of the antigen. The overall result of this transcriptional sequence is a significant amplification of the number of introduced replicant RNAs, and thus the encoded antigen becomes the major polypeptide product of the cell.

[0635] A suitable system for self-replication in this manner is the use of alphavirus-based replicons. These replicons are positive-strand (sense-strand) RNAs that, upon delivery to the cell, cause translation by a replicase (or replicase-transcriptionase). The replicase is translated into a polyprotein that is automatically cleaved to provide a replication complex, which produces a genomic strand copy of the positive-strand delivered RNA. These negative-strand transcripts can themselves be transcribed to produce further copies of the positive-strand parent RNA and also produce subgenomic transcripts encoding the antigen. Thus, the translation of the subgenomic transcripts enables the infected cell to express the antigen in situ. Suitable alphavirus replicons can use replicases from Sindbis virus, Semliki forest virus, eastern equine encephalitis virus, Venezuelan equine encephalitis virus, etc. Mutant or wild-type viral sequences can be used; for example, the attenuated TC83 mutant of VEEV has been used in replicons, see the following reference: International Publication No. WO 2005 / 113782, which is incorporated herein by reference.

[0636] In one embodiment, each self-replicating RNA described herein encodes (i) an RNA-dependent RNA polymerase, which can transcribe RNA from the self-replicating RNA molecule, and (ii) an influenza HA protein antigen. The polymerase may be an alphavirus replicase, for example, including one or more of alphavirus proteins nsP1, nsP2, nsP3, and nsP4. Although the natural alphavirus genome encodes structural virion proteins in addition to non-structural replicase polymerases, in some embodiments, the self-replicating RNA molecule does not encode alphavirus structural proteins. Therefore, the self-replicating RNA may result in the production of copies of its own genomic RNA within the cell, but not in the production of RNA-containing virions. The inability to produce these virions means that, unlike wild-type alphavirus, the self-replicating RNA molecule cannot permanently persist itself in an infectious form. The alphavirus structural proteins necessary for permanent persistence in wild-type virus are not present in the self-replicating RNA disclosed herein, and their positions are replaced by one or more genes encoding a target immunogen, such that the subgenomic transcript encodes an immunogen, rather than alphavirus structural virion proteins. The self-replicating RNA is further described in detail in International Publication No. WO 2011005799, which is incorporated herein by reference.

[0637] Trans-replicating RNA:

[0638] On one hand, this article discloses the trans-replicating RNA encoding influenza proteins.

[0639] Trans-replicating RNA has elements similar to those of the self-replicating RNA described above. However, for trans-replicating RNA, two separate RNA molecules are used. The first RNA molecule encodes the aforementioned RNA replicase (e.g., alphavirus replicase), and the second RNA molecule encodes the target protein (e.g., influenza protein antigen). The RNA replicase can replicate one or both of the first and second RNA molecules, thereby significantly increasing the copy number of the RNA molecule encoding the target protein. Trans-replicating RNA is further described in detail in International Publication No. WO 2017162265, which is incorporated herein by reference. IX. Pharmaceutical Compositions

[0640] The purified RNA according to this disclosure can be used as a component in pharmaceutical compositions, for example, as vaccines. These compositions will typically contain RNA and a pharmaceutically acceptable carrier. The pharmaceutical compositions disclosed herein may also contain one or more additional components, such as small molecule immune enhancers (e.g., TLR agonists). The pharmaceutical compositions disclosed herein may also contain a delivery system for RNA, such as liposomes, oil-in-water emulsions, or microparticles. In some embodiments, the pharmaceutical composition comprises lipid nanoparticles (LNPs). In some embodiments, the composition comprises a nucleic acid molecule encoding an antigen encapsulated within an LNP. X. Vaccination methods

[0641] The influenza mRNA vaccine composition disclosed herein can be administered to subjects to induce an immune response against one or more influenza proteins, wherein the anti-antigen antibody titer increases in subjects after vaccination relative to those not vaccinated with the influenza mRNA vaccine composition disclosed herein or relative to alternative vaccines against influenza. "Anti-antigen antibody" is a serum antibody that specifically binds to an antigen.

[0642] In one aspect, this disclosure provides a method for inducing an immune response to influenza or protecting a subject from influenza infection, the method comprising administering the influenza mRNA vaccine composition described herein to the subject. In another aspect, this disclosure provides a composition for use in inducing an immune response to influenza or protecting a subject from influenza infection, the use being performed by administering the influenza mRNA vaccine composition described herein to the subject. This disclosure also provides the influenza mRNA vaccine composition described herein for use in the manufacture of a vaccine for inducing an immune response to influenza or protecting a subject from influenza infection.

[0643] In one aspect, this disclosure provides a method for inducing an immune response to influenza A or protecting a subject from influenza A infection by administering the influenza mRNA vaccine composition described herein to the subject. In another aspect, this disclosure provides a method for inducing an immune response to influenza B or protecting a subject from influenza B infection by administering the influenza mRNA vaccine composition described herein to the subject.

[0644] In one aspect, this disclosure provides compositions as disclosed herein for use in methods of inducing an immune response to influenza A or protecting a subject from infection with influenza A. In another aspect, this disclosure provides compositions as disclosed herein for use in methods of inducing an immune response to influenza B or protecting a subject from infection with influenza B.

[0645] This disclosure also provides the influenza mRNA vaccine composition described herein for use in the manufacture of a medicine for inducing an immune response to influenza A or protecting a subject from influenza A infection. This disclosure further provides the influenza mRNA vaccine composition described herein for use in the manufacture of a medicine for inducing an immune response to influenza B or protecting a subject from influenza B infection.

[0646] In another aspect, the present invention provides a method for inducing immunity in a subject against one or more influenza viruses in the subject's body. The present invention further provides a method for inducing an immune response against one or more influenza viruses in a subject. In some embodiments, the method of the present invention includes administering to the subject an effective amount of the influenza mRNA vaccine composition described herein.

[0647] In some embodiments, subjects administered the influenza mRNA vaccine composition described herein have the same or higher serum concentrations of neutralizing antibodies against influenza A compared to subjects administered a single antigenic composition comprising mRNA encoding influenza proteins. In some embodiments, subjects administered the influenza mRNA vaccine composition described herein have the same or higher serum concentrations of neutralizing antibodies against influenza B compared to subjects administered a single antigenic composition comprising mRNA encoding influenza proteins.

[0648] In some embodiments, subjects administered the influenza mRNA vaccine composition described herein have comparable serum concentrations of neutralizing antibodies against influenza A compared to subjects administered an influenza A protein vaccine. In some embodiments, subjects administered the influenza mRNA vaccine composition described herein have comparable serum concentrations of neutralizing antibodies against influenza B compared to subjects administered an influenza B protein vaccine.

[0649] In some embodiments, the influenza mRNA vaccine composition described herein increases the serum concentration of neutralizing antibodies against influenza A in subjects. In some embodiments, the influenza mRNA vaccine composition described herein increases the serum concentration of neutralizing antibodies against influenza B in subjects.

[0650] In some embodiments, the influenza mRNA vaccine composition described herein increases the serum concentration of neutralizing antibodies against influenza A H1N1 and / or influenza A H3N2 in subjects. In some embodiments, the influenza mRNA vaccine composition described herein increases the serum concentration of neutralizing antibodies against influenza B Yamagata lineage and / or Victoria lineage in subjects.

[0651] In some embodiments, the compositions described herein increase the serum concentration of neutralizing antibodies in subjects with pre-existing influenza immunity.

[0652] In various embodiments, the immunization methods provided herein elicit a broad protective immune response against multiple epitopes within one or more influenza viruses. In various embodiments, the immunization methods provided herein elicit a broad neutralizing immune response against one or more influenza viruses. In some embodiments, the immune response includes an antibody response. Therefore, in various embodiments, the influenza mRNA vaccine compositions described herein can provide broad cross-protection against different types of influenza viruses. In some embodiments, the influenza mRNA vaccine compositions described herein provide cross-protection against avian influenza viruses, swine influenza viruses, seasonal influenza viruses, and / or pandemic influenza viruses. In some embodiments, the influenza mRNA vaccine compositions described herein provide cross-protection against one or more subtypes of influenza A, influenza B, or influenza C. In some embodiments, the influenza mRNA vaccine compositions described herein provide cross-protection against multiple strains of influenza A H1 subtype virus (e.g., H1N1), influenza A H3 subtype virus (e.g., H3N2), influenza A H5 subtype virus (e.g., H5N1), and / or influenza B virus (e.g., Yamagata lineage, Victoria lineage).

[0653] In some embodiments, the method of the present invention is capable of eliciting an improved immune response against one or more seasonal influenza strains. Exemplary seasonal strains include, but are not limited to, A / Puerto Rico / 8 / 1934, A / Monmouthburg / 1 / 1947, A / Chile / 1 / 1983, A / Texas / 36 / 1991, A / Singapore / 6 / 1986, A / Beijing / 32 / 1992, A / New Caledonia / 20 / 1999, A / Solomon Islands / 03 / 2006, A / Brisbane / 59 / 2007, A (H3N2) virus antigenic-like cell-propagating prototype virus A / Victoria / 361 / 2011, A / Beijing / 262 / 95 (H1N1)-like virus, A / Brisbane / 02 / 2018 (H1N1) pdm09-like virus, A / Brisbane... Lisbon / 10 / 2007 (H3N2)-like virus, A / California / 7 / 2004 (H3N2)-like virus, A / California / 7 / 2009 (H1N1)-like virus, A / California / 7 / 2009 (H1N1) pdm09-like virus, A / Cambodia / e0826360 / 2020 (H3N2)-like virus, A / Darwin / 6 / 2021 (H3N2)-like virus, A / Fujian / 411 / 2002 (H3N2)-like virus, A / Fujian / 411 / 2002 (H3N2)-like virus, A / Guangdong-Maonan / SWL1536 / 2019 (H1N1) pdm09-like virus-like disease Virus, A / Hawaii / 70 / 2019 (H1N1) pdm09-like virus, A / Hong Kong / 2671 / 2019 (H3N2)-like virus, A / Hong Kong / 45 / 2019 (H3N2)-like virus, A / Hong Kong / 4801 / 2014 (H3N2)-like virus, A / Kansas / 14 / 2017 (H3N2)-like virus, A / Michigan / 45 / 2015 (H1N1) pdm09-like virus, A / Moscow / 10 / 99 (H3N2)-like virus, A / New Caledonia / 20 / 99 (H1N1)-like virus, A / Perth / 16 / 2009 (H3N2)-like virus, A / Singapore / INFI MH-16-0019 / 2016 (H3N2)-like virus, A / Solomon Islands / 3 / 2006 (H1N1)-like virus, A / South Australia / 34 / 2019 (H3N2)-like virus, A / Switzerland / 8060 / 2017 (H3N2)-like virus, A / Switzerland / 9715293 / 2013 (H3N2)-like virus, A / Sydney / 5 / 97 (H3N2)-like virus, A / Texas / 50 / 2012 (H3N2)-like virus, A / Victoria / 2570 / 2019 (H1N1)pdm09-like virus, A / Victoria / 2570 / 2019 (H1N1)pdm09-like virus,A / Victoria / 361 / 2011 (H3N2)-like virus, A / Wellington / 1 / 2004 (H3N2)-like virus, A / Wisconsin / 588 / 2019 (H1N1) pdm09-like virus, A / Wisconsin / 588 / 2019 (H1N1) pdm09-like virus, A / Wisconsin / 67 / 2005 (H3N2)-like virus, B / Austria / 1359417 / 20121 (B / Victoria lineage)-like virus, B / Beijing / 184 / 93-like virus, B / Brisbane / 60 / 2008-like virus, B / Colorado / 06 / 2017-like virus (B / Victoria / 2 / 87 lineage), B / Florida / 4 / 2006-like virus, B / Hong Kong / 330 / 2001-like virus Virus, B / Malaysia / 2506 / 2004-like virus, B / Massachusetts / 2 / 2012-like virus, B / Phuket / 3073 / 2013 (B / Yamagata lineage)-like virus, B / Phuket / 3073 / 2013-like virus, B / Phuket / 3073 / 2013-like virus (B / Yamagata / 16 / 88 lineage), B / Shandong / 7 / 97-like virus, B / Shanghai / 361 / 2002-like virus, B / Sichuan / 379 / 99-like virus, B / Washington / 02 / 2019 (B / Victoria lineage)-like virus, B / Washington / 02 / 2019-like (B / Victoria lineage) virus, A / Wisconsin / 588 / 2019 (H1N1) pdm09-like virus and B / Wisconsin / 1 / 2010-like virus. In some embodiments, the method of the present invention is capable of eliciting an improved immune response against one or more pandemic influenza strains. Exemplary pandemic strains include, but are not limited to, A / California / 07 / 2009, A / California / 04 / 2009, A / Belgium / 145 / 2009, A / South Carolina / 01 / 1918, and A / New Jersey / 1976. Pandemic subtypes particularly include H1N1, H5N1, H2N2, H3N2, H9N2, H7N7, H7N3, H7N9, and H10N7 subtypes. In some embodiments, the method of the present invention is capable of eliciting an improved immune response against one or more swine influenza strains. Exemplary swine strains include, but are not limited to, the A / New Jersey / 1976 isolate and A / California / 07 / 2009. In some embodiments, the method of the present invention is capable of eliciting an improved immune response against one or more avian influenza strains. Exemplary avian strains include, but are not limited to, H5N1, H7N3, H7N7, H7N9, and H9N2. Other pandemic influenza, seasonal influenza, avian influenza, and / or swine influenza strains are known in this art.

[0654] In some embodiments, the present invention provides methods for preventing or treating influenza infection, which are carried out by administering the influenza mRNA vaccine composition described herein to a subject in need. In some embodiments, the subject has or is susceptible to influenza infection. In some embodiments, the subject is considered to have influenza infection if he / she exhibits one or more symptoms commonly associated with influenza infection. In some embodiments, the subject is known or believed to have been exposed to the influenza virus. In some embodiments, the subject is considered susceptible to influenza infection if the subject is known or believed to have been exposed to the influenza virus. In some embodiments, the subject is known or believed to have been exposed to the influenza virus if he / she has been in contact with other individuals known or suspected to be infected with the influenza virus and / or if the subject is present or has been present in a place where influenza infection is known or believed to be prevalent.

[0655] In various embodiments, the influenza mRNA vaccine composition described herein may be administered before or after the onset of one or more symptoms of influenza infection. In some embodiments, the influenza mRNA vaccine composition described herein may be administered as a prophylactic agent. In such embodiments, the method of the present invention effectively prevents or protects subjects from influenza virus infection. In some embodiments, the influenza mRNA vaccine composition described herein may be used as a component of seasonal and / or pandemic influenza vaccines, or as part of an influenza vaccination regimen designed to confer durable (multi-seasonal) protection. In some embodiments, the influenza mRNA vaccine composition described herein may be used to treat symptoms of influenza infection.

[0656] In some embodiments, the subject is a non-human mammal. In some embodiments, the subject is a farm animal or pet (e.g., a dog, cat, sheep, cow, and / or pig). In some embodiments, the subject is a non-human primate. In some embodiments, the subject is a bird (e.g., a chicken).

[0657] In some embodiments, the subject is a human being. In some embodiments, the subject is an adult, adolescent, or infant. In some embodiments, the human subject is less than 6 months old. In some embodiments, the human subject is 6 months or older, 6 months to 35 months, 36 months to 8 or 9 years or older. In some embodiments, the human subject is an elderly person aged 55 years or older (e.g., 60 years or older, or 65 years or older). The invention also contemplates the performance of methods for administering the composition intrauterinely and / or for treating intrauterinely.

[0658] The invention is further defined with reference to the following numbered paragraphs: 1. A composition comprising at least three messenger RNAs (mRNAs), wherein the at least three mRNAs contain an open reading frame (ORF) encoding a hemagglutinin (HA) antigen, the at least three mRNAs being selected from the group consisting of: (i) The first mRNA encoding the HA antigen of influenza A virus; (ii) A second mRNA encoding the HA antigen of influenza A virus type 2, wherein the influenza A virus type 1 and the influenza A virus type 2 belong to different subtypes; and (iii) The third mRNA encoding the HA antigen of influenza B virus, The mRNA encoding the HA antigen of the influenza A virus and the mRNA encoding the HA antigen of the influenza B virus exist at different ratios (w / w). 2. The composition of claim 1, further comprising a fourth mRNA encoding the HA antigen of influenza B virus type 2, wherein the influenza B virus type 1 and the influenza B virus type 2 belong to different lineages. 3. The composition as described in paragraph 1, wherein the first mRNA, the second mRNA, and the third mRNA are present in a ratio of about 1:1:2 (w / w). 4. The composition as described in paragraph 1, wherein the first mRNA, the second mRNA, and the third mRNA are present in a ratio of about 1:1:3 (w / w). 5. The composition as described in paragraph 1, wherein the first mRNA, the second mRNA, and the third mRNA are present in a ratio of about 1:1:4 (w / w). 6. The composition as described in paragraph 1, wherein the first mRNA, the second mRNA, and the third mRNA are present in a ratio of about 1:1:5 (w / w). 7. The composition as described in paragraph 1, wherein the first mRNA, the second mRNA, and the third mRNA are present in a ratio of about 1:1:6 (w / w). 8. The composition as described in paragraph 1, wherein the first mRNA, the second mRNA, and the third mRNA are present in a ratio of about 1:1:7 (w / w). 9. The composition as described in paragraph 1, wherein the first mRNA, the second mRNA, and the third mRNA are present in a ratio of about 1:1:8 (w / w). 10. The composition as described in paragraph 1, wherein the first mRNA, the second mRNA, and the third mRNA are present in a ratio of about 1:1:9 (w / w). 11. The composition as described in paragraph 1, wherein the first mRNA, the second mRNA, and the third mRNA are present in a ratio of about 1:1:10 (w / w). 12. The composition as described in paragraph 1, wherein the first mRNA, the second mRNA and the third mRNA are present in a ratio (w / w) of about 1:1:2 to about 1:1:10. 13. The composition as described in paragraph 2, wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are present in a ratio of about 1:1:2:2 (w / w). 14. The composition as described in paragraph 2, wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are present in a ratio of about 1:1:3:3 (w / w). 15. The composition as described in paragraph 2, wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are present in a ratio of about 1:1:4:4 (w / w). 16. The composition as described in paragraph 2, wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are present in a ratio of about 1:1:5:5 (w / w). 17. The composition as described in paragraph 2, wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are present in a ratio of about 1:1:6:6 (w / w). 18. The composition as described in paragraph 2, wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are present in a ratio of about 1:1:7:7 (w / w). 19. The composition as described in paragraph 2, wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are present in a ratio of about 1:1:8:8 (w / w). 20. The composition as described in paragraph 2, wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are present in a ratio of about 1:1:9:9 (w / w). 21. The composition as described in paragraph 2, wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are present in a ratio of about 1:1:10:10 (w / w). 22. The composition as described in paragraph 2, wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are present in a ratio (w / w) of about 1:1:2:2 to about 1:1:10:10. 23. The composition as described in any one of paragraphs 1-22, wherein the ratio is expressed in micrograms (µg). 24. The composition as described in paragraph 13, wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are present in a ratio (w / w) of about 32 micrograms of the first mRNA: about 32 micrograms of the second mRNA: about 64 micrograms of the third mRNA: about 64 micrograms of the fourth mRNA. 25. The composition as described in paragraph 15, wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are present in a ratio (w / w) of about 16 micrograms of the first mRNA: about 16 micrograms of the second mRNA: about 64 micrograms of the third mRNA: about 64 micrograms of the fourth mRNA. 26. The composition as described in paragraph 17, wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are present in a ratio (w / w) of about 16 micrograms of the first mRNA: about 16 micrograms of the second mRNA: about 96 micrograms of the third mRNA: about 96 micrograms of the fourth mRNA. 27. The composition as described in any one of paragraphs 13-23, wherein the composition comprises a total of 130 micrograms of the mRNA. 28. The composition as described in any one of paragraphs 13-23, wherein the composition comprises a total of 160 micrograms of the mRNA. 29. The composition as described in any one of paragraphs 13-23, wherein the composition comprises a total of 200 micrograms of the mRNA. 30. The composition as described in any one of paragraphs 13-23, wherein the composition comprises a total of 224 micrograms of the mRNA. 31. The composition as described in any one of paragraphs 13-23, wherein the composition comprises a total of 130 micrograms to 224 micrograms of the mRNA. 32. The composition as described in any of the preceding paragraphs, wherein the first mRNA, the second mRNA, the third mRNA and / or the fourth mRNA are not covalently linked to each other. 33. The composition as described in any one of paragraphs 1-31, wherein one or more of the first mRNA, the second mRNA, the third mRNA and / or the fourth mRNA are covalently linked to each other. 34. The composition as described in any of the preceding paragraphs, wherein the first mRNA, the second mRNA, the third mRNA and / or the fourth mRNA are formulated into the LNP. 35. The composition as described in paragraph 34, wherein the LNP comprises at least one cationic lipid. 36. The composition as described in paragraph 35, wherein the cationic lipid is biodegradable. 37. The composition as described in paragraph 35, wherein the cationic lipid is not biodegradable. 38. The composition as described in paragraph 35, wherein the cationic lipid is cleavable. 39. The composition as described in paragraph 35, wherein the cationic lipid is not cleavable. 40. The composition as described in paragraph 35, wherein the cationic lipid is selected from the group consisting of: OF-02, cKK-E10, GL-HEPES-E3-E10-DS-3-E18-1, GL-HEPES-E3-E12-DS-4-E10, GL-HEPES-E3-E12-DS-3-E14, [(4-hydroxybutyl)azanediyl]bis(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315) and IM-001. 41. The composition as described in paragraph 40, wherein the cationic lipid is cKK-E10. 42. The composition as described in paragraph 40, wherein the cationic lipid is GL-HEPES-E3-E12-DS-4-E10. 43. The composition as described in paragraph 40, wherein the cationic lipid is IM-001. 44. The composition of any one of paragraphs 34-43, wherein the LNP further comprises polyethylene glycol (PEG) conjugated (PEGylated) lipids, cholesterol-based lipids, and auxiliary lipids. 45. The composition as described in any one of paragraphs 34-44, wherein the LNP comprises: Cationic lipids with a molar ratio of 35% to 55%; A polyethylene glycol (PEG) conjugated (PEGylated) lipid in a molar ratio of 0.25% to 2.75%; Cholesterol-based lipids with a molar ratio of 20% to 45%; and The molar ratio of auxiliary lipids is 5% to 35%. All of these molar ratios are relative to the total lipid content of the LNP. 46. ​​The composition as described in paragraph 45, wherein the LNP comprises: Cationic lipids with a molar ratio of 40%; PEGylated lipids with a molar ratio of 1.5%; Cholesterol-based lipids with a molar ratio of 28.5%; and The auxiliary lipid has a molar ratio of 30%. All of these molar ratios are relative to the total lipid content of the LNP. 47. The composition of any one of paragraphs 44-46, wherein the PEGylated lipid is dimyristoyl-PEG2000 (DMG-PEG2000) or 2-[(polyethylene glycol)-2000]-N,N-bistetradecylacetamide (ALC-0159). 48. The composition of any one of paragraphs 44-47, wherein the cholesterol-based lipid is cholesterol. 49. The composition of any one of paragraphs 44-48, wherein the auxiliary lipid is 1,2-dioleoyl-SN-glycerol-3-phosphate ethanolamine (DOPE) or 1,2-distearate-sn-glycerol-3-phosphate choline (DSPC). 50. The composition of any one of paragraphs 34-49, wherein the LNP comprises: GL-HEPES-E3-E12-DS-4-E10 with a molar ratio of 40%; DMG-PEG2000 with a molar ratio of 1.5%; Cholesterol with a molar ratio of 28.5%; and DOPE with a molar ratio of 30%, All of these molar ratios are relative to the total lipid content of the LNP. 51. The composition as described in any one of paragraphs 34-49, wherein the LNP comprises: cKK-E10 with a molar ratio of 40%; DMG-PEG2000 with a molar ratio of 1.5%; Cholesterol with a molar ratio of 28.5%; and DOPE with a molar ratio of 30%, All of these molar ratios are relative to the total lipid content of the LNP. 52. The composition of any one of paragraphs 34-49, wherein the LNP comprises: IM-001 with a molar ratio of 40%; DMG-PEG2000 with a molar ratio of 1.5%; Cholesterol with a molar ratio of 28.5%; and DOPE with a molar ratio of 30%, All of these molar ratios are relative to the total lipid content of the LNP. 53. The composition of any one of paragraphs 34-52, wherein the average diameter of the LNP is 30 nm to 200 nm. 54. The composition as described in paragraph 53, wherein the average diameter of the LNP is 80 nm to 150 nm. 55. The composition as described in any of the preceding paragraphs, wherein the first mRNA encodes the HA antigen of the influenza A H1N1 subtype. 56. The composition as described in any of the preceding paragraphs, wherein the second mRNA encodes the HA antigen of the influenza A H3N2 subtype. 57. The composition as described in any of the preceding paragraphs, wherein the third mRNA encodes the HA antigen of the Victoria lineage of influenza B. 58. The composition as described in any one of paragraphs 2-57, wherein the fourth mRNA encodes the HA antigen of the Yamagata lineage of influenza B. 59. The composition as described in any of the preceding paragraphs, wherein at least one of these mRNAs comprises a codon-optimized ORF. 60. The composition as described in any of the preceding paragraphs, wherein at least one of the mRNAs comprises at least one 5' untranslated region (5' UTR), at least one 3' untranslated region (3' UTR), and at least one polyadenylated (poly(A)) sequence. 61. The composition as described in any of the preceding paragraphs, wherein at least one of these mRNAs comprises at least one chemical modification. 62. The composition as described in any of the preceding paragraphs, wherein at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% of the uracil nucleotides in at least one of these mRNAs are chemically modified. 63. The composition as described in any of the preceding paragraphs, wherein at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% of the uracil nucleotides in at least one of these ORFs are chemically modified. 64. The composition as described in any one of paragraphs 50-52, wherein the chemical modification is selected from the group consisting of: pseudouridine, N1-methylpseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deazo-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methyluridine, 5-methyluridine, 5-methoxyuridine, and 2'-O-methyluridine. 65. The composition as described in paragraph 64, wherein the chemical modification is selected from the group consisting of: pseudouridine, N1-methylpseudouridine, 5-methylcytosine, 5-methoxyuridine, and combinations thereof. 66. The composition as described in paragraph 65, wherein the chemical modification is N1-methylpseuuridine. 67. A method comprising administering to a subject in need the composition as described in any one of paragraphs 1-66. 68. A method for inducing an immune response to influenza A or protecting a subject from infection with influenza A, the method comprising administering to the subject a composition as described in any one of paragraphs 1-66. 69. A method for inducing an immune response to influenza B or protecting a subject from infection with influenza B, the method comprising administering to the subject a composition as described in any one of paragraphs 1-66. 70. The method as described in paragraph 68, wherein the subject who has received the composition has a comparable serum concentration of neutralizing antibodies against influenza A, relative to the subject who has received the influenza A protein vaccine. 71. The method as described in paragraph 69, wherein the subject who has received the composition has a comparable serum concentration of neutralizing antibodies against influenza B, relative to the subject who has received the influenza B protein vaccine. 72. The method as described in paragraph 68, wherein the composition increases the serum concentration of neutralizing antibodies against influenza A in the subject. 73. The method as described in paragraph 69, wherein the composition increases the serum concentration of neutralizing antibodies against influenza B in the subject. 74. The method as described in paragraph 72, wherein the composition increases the serum concentration of neutralizing antibodies against influenza A H1N1 and / or influenza A H3N2 in the subject. 75. The method as described in paragraph 73, wherein the composition increases the serum concentration of neutralizing antibodies against the Yamagata lineage and / or Victoria lineage of influenza B in the subject. 76. The composition of any one of paragraphs 1-66, for use in a method of inducing an immune response to influenza A or protecting a subject from infection with influenza A. 77. The composition of any one of paragraphs 1-66, for use in a method of inducing an immune response to influenza B or protecting a subject from infection with influenza B. 78. Use of the composition of any one of paragraphs 1-66 in the manufacture of a medicament for inducing an immune response to influenza A or for protecting a subject from infection with influenza A. 79. Use of the composition as described in any one of paragraphs 1-66 in the manufacture of a medicament for inducing an immune response to influenza B or for protecting a subject from infection with influenza B. 80. A composition comprising at least three messenger RNAs (mRNAs), wherein: (i) The first mRNA encodes the hemagglutinin (HA) antigen of the first influenza A virus; (ii) The second mRNA encodes the HA antigen of the second influenza A virus, wherein the first and second influenza A viruses belong to different subtypes; and (iii) The third mRNA encodes the HA antigen of influenza B virus type 1. The mRNA encoding the HA antigen of the influenza A virus and the mRNA encoding the HA antigen of the influenza B virus exist at different ratios (w / w), and The first mRNA, the second mRNA, and the third mRNA are formulated into lipid nanoparticles (LNPs), which contain: OF-02, cKK-E10, GL-HEPES-E3-E10-DS-3-E18-1, GL-HEPES-E3-E12-DS-4-E10, GL-HEPES-E3-E12-DS-3-E14 or IM-001 with a molar ratio of 40%; DMG-PEG2000 with a molar ratio of 1.5%; Cholesterol with a molar ratio of 28.5%; and DOPE with a molar ratio of 30%. 81. The composition as described in paragraph 80, further comprising a fourth mRNA encoding the HA antigen of influenza B virus type 2, wherein the influenza B virus type 1 and the influenza B virus type 2 belong to different lineages, and wherein the first mRNA, the second mRNA, the third mRNA, and the fourth mRNA are formulated into lipid nanoparticles (LNPs), the lipid nanoparticles comprising: OF-02, cKK-E10, GL-HEPES-E3-E10-DS-3-E18-1, GL-HEPES-E3-E12-DS-4-E10, GL-HEPES-E3-E12-DS-3-E14 or IM-001 with a molar ratio of 40%; DMG-PEG2000 with a molar ratio of 1.5%; Cholesterol with a molar ratio of 28.5%; and DOPE with a molar ratio of 30%. 82. The composition as described in paragraph 80, wherein the first mRNA, the second mRNA, and the third mRNA are present in a ratio of about 1:1:2 (w / w). 83. The composition as described in paragraph 80, wherein the first mRNA, the second mRNA, and the third mRNA are present in a ratio of about 1:1:3 (w / w). 84. The composition as described in paragraph 80, wherein the first mRNA, the second mRNA, and the third mRNA are present in a ratio of about 1:1:4 (w / w). 85. The composition as described in paragraph 80, wherein the first mRNA, the second mRNA, and the third mRNA are present in a ratio of about 1:1:5 (w / w). 86. The composition as described in paragraph 80, wherein the first mRNA, the second mRNA, and the third mRNA are present in a ratio of about 1:1:6 (w / w). 87. The composition as described in paragraph 80, wherein the first mRNA, the second mRNA, and the third mRNA are present in a ratio of about 1:1:7 (w / w). 88. The composition as described in paragraph 80, wherein the first mRNA, the second mRNA, and the third mRNA are present in a ratio of about 1:1:8 (w / w). 89. The composition as described in paragraph 80, wherein the first mRNA, the second mRNA, and the third mRNA are present in a ratio of about 1:1:9 (w / w). 90. The composition as described in paragraph 80, wherein the first mRNA, the second mRNA, and the third mRNA are present in a ratio of about 1:1:10 (w / w). 91. The composition as described in paragraph 80, wherein the first mRNA, the second mRNA, and the third mRNA are present in a ratio (w / w) of about 1:1:2 to about 1:1:10. 92. The composition as described in paragraph 81, wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are present in a ratio of about 1:1:2:2 (w / w). 93. The composition as described in paragraph 81, wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are present in a ratio of about 1:1:3:3 (w / w). 94. The composition as described in paragraph 81, wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are present in a ratio of about 1:1:4:4 (w / w). 95. The composition as described in paragraph 81, wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are present in a ratio of about 1:1:5:5 (w / w). 96. The composition as described in paragraph 81, wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are present in a ratio of about 1:1:6:6 (w / w). 97. The composition as described in paragraph 81, wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are present in a ratio of about 1:1:7:7 (w / w). 98. The composition as described in paragraph 81, wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are present in a ratio of about 1:1:8:8 (w / w). 99. The composition as described in paragraph 81, wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are present in a ratio of about 1:1:9:9 (w / w). 100. The composition as described in paragraph 81, wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are present in a ratio of about 1:1:10:10 (w / w). 101. The composition as described in paragraph 81, wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are present in a ratio (w / w) of about 1:1:2:2 to about 1:1:10:10. 102. The composition as described in any one of paragraphs 80-101, wherein the ratio is expressed in micrograms (µg). 103. The composition as described in paragraph 92, wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are present in a ratio (w / w) of about 32 micrograms of the first mRNA: about 32 micrograms of the second mRNA: about 64 micrograms of the third mRNA: about 64 micrograms of the fourth mRNA. 104. The composition as described in paragraph 94, wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are present in a ratio (w / w) of about 16 micrograms of the first mRNA: about 16 micrograms of the second mRNA: about 64 micrograms of the third mRNA: about 64 micrograms of the fourth mRNA. 105. The composition as described in paragraph 96, wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are present in a ratio (w / w) of about 16 micrograms of the first mRNA: about 16 micrograms of the second mRNA: about 96 micrograms of the third mRNA: about 96 micrograms of the fourth mRNA. 106. The composition as described in any one of paragraphs 92-102, wherein the composition comprises a total of 130 micrograms of the mRNA. 107. The composition as described in any one of paragraphs 92-102, wherein the composition comprises a total of 160 micrograms of the mRNA. 108. The composition as described in any one of paragraphs 92-102, wherein the composition comprises a total of 200 micrograms of the mRNA. 109. The composition as described in any one of paragraphs 92-102, wherein the composition comprises a total of 224 micrograms of the mRNA. 110. The composition as described in any one of paragraphs 92-102, wherein the composition comprises a total of 130 micrograms to 224 micrograms of the mRNA. 111. The composition as described in any one of paragraphs 80-110, wherein at least one of these mRNAs comprises a codon-optimized open reading frame (ORF). 112. The composition as described in any one of paragraphs 80-111, wherein at least one of these mRNAs comprises at least one 5' untranslated region (5' UTR), at least one 3' untranslated region (3' UTR), and at least one polyadenylated (poly(A)) sequence. 113. The composition as described in any one of paragraphs 80-112, wherein at least one of these mRNAs contains at least one chemical modification. 114. The composition as described in any one of paragraphs 80-113, wherein the first mRNA, the second mRNA, the third mRNA and / or the fourth mRNA are not covalently linked to each other. 115. The composition as described in any one of paragraphs 80-113, wherein one or more of the first mRNA, the second mRNA, the third mRNA and / or the fourth mRNA are covalently linked to each other. 116. The composition as described in any one of paragraphs 80-115, wherein the average diameter of the LNP is 30 nm to 200 nm. 117. The composition as described in paragraph 116, wherein the average diameter of the LNP is 80 nm to 150 nm. 118. The composition as described in any one of paragraphs 80-117, wherein the first mRNA encodes the HA antigen of the influenza A H1N1 subtype. 119. The composition as described in any one of paragraphs 80-118, wherein the second mRNA encodes the HA antigen of the influenza A H3N2 subtype. 120. The composition as described in any one of paragraphs 80-119, wherein the third mRNA encodes the HA antigen of the Victoria lineage of influenza B. 121. The composition as described in any one of paragraphs 81-120, wherein the fourth mRNA encodes the HA antigen of the Yamagata lineage of influenza B. 122. A method comprising administering to a subject in need the composition as described in any one of paragraphs 80-121. 123. A method for inducing an immune response to influenza A or protecting a subject from influenza A infection, the method comprising administering to the subject a composition as described in any one of paragraphs 80-121. 124. A method for inducing an immune response to influenza B or protecting a subject from influenza B infection, the method comprising administering to the subject a composition as described in any one of paragraphs 80-121. 125. The method as described in paragraph 123, wherein the subject who has received the composition has a comparable serum concentration of neutralizing antibodies against influenza A, relative to the subject who has received the influenza A protein vaccine. 126. The method as described in paragraph 124, wherein the subject who has received the composition has a comparable serum concentration of neutralizing antibodies against influenza B, relative to the subject who has received the influenza B protein vaccine. 127. The method as described in paragraph 123, wherein the composition increases the serum concentration of neutralizing antibodies against influenza A in the subject. 128. The method as described in paragraph 124, wherein the composition increases the serum concentration of neutralizing antibodies against influenza B in the subject. 129. The method as described in paragraph 123, wherein the composition increases the serum concentration of neutralizing antibodies against influenza A H1N1 and / or influenza A H3N2 in the subject. 130. The method as described in paragraph 124, wherein the composition increases the serum concentration of neutralizing antibodies against the Yamagata lineage and / or Victoria lineage of influenza B in the subject. 131. The composition as described in any one of paragraphs 80-121, for use in a method of inducing an immune response to influenza A or protecting a subject from infection with influenza A. 132. The composition as described in any one of paragraphs 80-121, for use in a method of inducing an immune response to influenza B or protecting a subject from infection with influenza B. 133. Use of the composition as described in any one of paragraphs 80-121 in the manufacture of a medicament for inducing an immune response to influenza A or for protecting a subject from infection with influenza A. 134. Use of the composition as described in any one of paragraphs 80-121 in the manufacture of a medicament for inducing an immune response to influenza B or for protecting a subject from infection with influenza B. 135. A method comprising administering to a human subject a composition comprising at least three messenger RNAs (mRNAs), wherein: (i) The first mRNA encodes the hemagglutinin (HA) antigen of the first influenza A virus; (ii) The second mRNA encodes the HA antigen of the second influenza A virus, wherein the first and second influenza A viruses belong to different subtypes; and (iii) The third mRNA encodes the HA antigen of influenza B virus type 1. The mRNA encoding the HA antigen of the influenza A virus and the mRNA encoding the HA antigen of the influenza B virus exist at different ratios (w / w), and the first mRNA, the second mRNA, and the third mRNA are formulated into lipid nanoparticles (LNPs), the lipid nanoparticles comprising: OF-02, cKK-E10, GL-HEPES-E3-E10-DS-3-E18-1, GL-HEPES-E3-E12-DS-4-E10, GL-HEPES-E3-E12-DS-3-E14 or IM-001 with a molar ratio of 40%; DMG-PEG2000 with a molar ratio of 1.5%; Cholesterol with a molar ratio of 28.5%; and DOPE with a molar ratio of 30%. 136. The method of paragraph 135, wherein the composition comprises a fourth mRNA encoding the HA antigen of influenza B virus type 2, wherein the influenza B virus type 1 and the influenza B virus type 2 belong to different lineages, and wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are formulated into lipid nanoparticles (LNPs), the lipid nanoparticles comprising: OF-02, cKK-E10, GL-HEPES-E3-E10-DS-3-E18-1, GL-HEPES-E3-E12-DS-4-E10, GL-HEPES-E3-E12-DS-3-E14 or IM-001 with a molar ratio of 40%; DMG-PEG2000 with a molar ratio of 1.5%; Cholesterol with a molar ratio of 28.5%; and DOPE with a molar ratio of 30%. 137. The composition as described in paragraph 135, wherein the first mRNA, the second mRNA, and the third mRNA are present in a ratio of about 1:1:2 (w / w). 138. The composition as described in paragraph 135, wherein the first mRNA, the second mRNA, and the third mRNA are present in a ratio of about 1:1:3 (w / w). 139. The composition as described in paragraph 135, wherein the first mRNA, the second mRNA, and the third mRNA are present in a ratio of about 1:1:4 (w / w). 140. The composition as described in paragraph 135, wherein the first mRNA, the second mRNA, and the third mRNA are present in a ratio of about 1:1:5 (w / w). 141. The composition as described in paragraph 135, wherein the first mRNA, the second mRNA, and the third mRNA are present in a ratio of about 1:1:6 (w / w). 142. The composition as described in paragraph 135, wherein the first mRNA, the second mRNA, and the third mRNA are present in a ratio of about 1:1:7 (w / w). 143. The composition as described in paragraph 135, wherein the first mRNA, the second mRNA, and the third mRNA are present in a ratio of about 1:1:8 (w / w). 144. The composition as described in paragraph 135, wherein the first mRNA, the second mRNA, and the third mRNA are present in a ratio of about 1:1:9 (w / w). 145. The composition as described in paragraph 135, wherein the first mRNA, the second mRNA, and the third mRNA are present in a ratio of about 1:1:10 (w / w). 146. The composition as described in paragraph 135, wherein the first mRNA, the second mRNA and the third mRNA are present in a ratio (w / w) of about 1:1:2 to about 1:1:10. 147. The method as described in paragraph 136, wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are present in a ratio of approximately 1:1:2:2 (w / w). 148. The method as described in paragraph 136, wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are present in a ratio of approximately 1:1:3:3 (w / w). 149. The method as described in paragraph 136, wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are present in a ratio of approximately 1:1:4:4 (w / w). 150. The method as described in paragraph 136, wherein the first mRNA, the second mRNA, the third mRNA, and the fourth mRNA are present in a ratio of approximately 1:1:5:5 (w / w). 151. The method as described in paragraph 136, wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are present in a ratio of approximately 1:1:6:6 (w / w). 152. The composition as described in paragraph 136, wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are present in a ratio of about 1:1:7:7 (w / w). 153. The composition as described in paragraph 136, wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are present in a ratio of about 1:1:8:8 (w / w). 154. The composition as described in paragraph 136, wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are present in a ratio of about 1:1:9:9 (w / w). 155. The composition as described in paragraph 136, wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are present in a ratio of about 1:1:10:10 (w / w). 156. The composition as described in paragraph 136, wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are present in a ratio (w / w) of about 1:1:2:2 to about 1:1:10:10. 157. The method as described in any one of paragraphs 135-156, wherein the ratio is expressed in micrograms (µg). 158. The method as described in paragraph 147, wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are present in a ratio (w / w) of about 32 micrograms of the first mRNA: about 32 micrograms of the second mRNA: about 64 micrograms of the third mRNA: about 64 micrograms of the fourth mRNA. 159. The method as described in paragraph 149, wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are present at a ratio (w / w) of about 16 micrograms of the first mRNA: about 16 micrograms of the second mRNA: about 64 micrograms of the third mRNA: about 64 micrograms of the fourth mRNA. 160. The method as described in paragraph 151, wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are present at a ratio (w / w) of about 16 micrograms of the first mRNA: about 16 micrograms of the second mRNA: about 96 micrograms of the third mRNA: about 96 micrograms of the fourth mRNA. 161. The method as described in any one of paragraphs 147-157, wherein the composition comprises a total of 130 micrograms of the mRNA. 162. The method as described in any one of paragraphs 147-157, wherein the composition comprises a total of 160 micrograms of the mRNA. 163. The method of any one of paragraphs 147-157, wherein the composition comprises a total of 200 micrograms of the mRNA. 164. The method as described in any one of paragraphs 147-157, wherein the composition comprises a total of 224 micrograms of the mRNA. 165. The method as described in any one of paragraphs 147-157, wherein the composition comprises a total of 130 micrograms to 224 micrograms of the mRNA. 166. The method as described in any one of paragraphs 135-165, wherein at least one of these mRNAs contains a codon-optimized open reading frame (ORF). 167. The method as described in any one of paragraphs 135-166, wherein at least one of these mRNAs comprises at least one 5' untranslated region (5' UTR), at least one 3' untranslated region (3' UTR), and at least one polyadenylated (poly(A)) sequence. 168. The method as described in any one of paragraphs 135-167, wherein at least one of these mRNAs contains at least one chemical modification. 169. The method as described in any one of paragraphs 135-168, wherein the first mRNA, the second mRNA, the third mRNA and / or the fourth mRNA are not covalently linked to each other. 170. The method as described in any one of paragraphs 135-168, wherein one or more of the first mRNA, the second mRNA, the third mRNA and / or the fourth mRNA are covalently linked to each other. 171. The method as described in any one of paragraphs 135-170, wherein the average diameter of the LNP is from 30 nm to 200 nm. 172. The method as described in paragraph 171, wherein the average diameter of the LNP is 80 nm to 150 nm. 173. The method as described in any one of paragraphs 135-172, wherein the first mRNA encodes the HA antigen of the influenza A H1N1 subtype. 174. The method as described in any one of paragraphs 135-173, wherein the second mRNA encodes the HA antigen of the influenza A H3N2 subtype. 175. The method as described in any one of paragraphs 135-174, wherein the third mRNA encodes the HA antigen of the Victoria lineage of influenza B. 176. The method as described in any one of paragraphs 136-175, wherein the fourth mRNA encodes the HA antigen of the Yamagata lineage of influenza B. 177. The method of any one of paragraphs 135-176, wherein the composition is administered in an effective amount to elicit an immune response to influenza A or to protect the subject from infection with influenza A. 178. The method of any one of paragraphs 135-176, wherein the composition is administered in an effective amount to elicit an immune response to influenza B or to protect the subject from infection with influenza B. 179. The method as described in any one of paragraphs 135-176, wherein the subject following administration of the composition has a comparable serum concentration of neutralizing antibodies against influenza A, relative to the subject administered the influenza A protein vaccine. 180. The method as described in any one of paragraphs 135-176, wherein the subject following administration of the composition has a comparable serum concentration of neutralizing antibodies against influenza B, relative to the subject administered the influenza B protein vaccine. 181. The method as described in any one of paragraphs 135-176, wherein the composition increases the serum concentration of neutralizing antibodies against influenza A in the subject. 182. The method as described in any one of paragraphs 135-176, wherein the composition increases the serum concentration of neutralizing antibodies against influenza B in the subject. 183. The method as described in paragraph 181, wherein the composition increases the serum concentration of neutralizing antibodies against influenza A H1N1 and / or influenza A H3N2 in the subject. 184. The method as described in paragraph 182, wherein the composition increases the serum concentration of neutralizing antibodies against the Yamagata lineage and / or Victoria lineage of influenza B in the subject. 185. A composition comprising at least three messenger RNAs (mRNAs), wherein: (i) The first mRNA encodes the hemagglutinin (HA) antigen of the first influenza A virus; (ii) The second mRNA encodes the HA antigen of the second influenza A virus, wherein the first and second influenza A viruses belong to different subtypes; and (iii) The third mRNA encodes the HA antigen of influenza B virus type 1. The first mRNA, the second mRNA, and the third mRNA were formulated into lipid nanoparticles (LNPs) containing IM-001. 186. The composition as described in paragraph 185, further comprising a fourth mRNA encoding the HA antigen of influenza B virus type 2, wherein the influenza B virus type 1 and the influenza B virus type 2 belong to different lineages, and wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are formulated into an LNP containing IM-001. 187. The composition as described in paragraph 185, wherein the first mRNA, the second mRNA, and the third mRNA are present in a ratio of about 1:1:2 (w / w). 188. The composition as described in paragraph 185, wherein the first mRNA, the second mRNA, and the third mRNA are present in a ratio of about 1:1:3 (w / w). 189. The composition as described in paragraph 185, wherein the first mRNA, the second mRNA, and the third mRNA are present in a ratio of about 1:1:4 (w / w). 190. The composition as described in paragraph 185, wherein the first mRNA, the second mRNA, and the third mRNA are present in a ratio of about 1:1:5 (w / w). 191. The composition as described in paragraph 185, wherein the first mRNA, the second mRNA, and the third mRNA are present in a ratio of about 1:1:6 (w / w). 192. The composition as described in paragraph 185, wherein the first mRNA, the second mRNA, and the third mRNA are present in a ratio of about 1:1:7 (w / w). 193. The composition as described in paragraph 185, wherein the first mRNA, the second mRNA, and the third mRNA are present in a ratio of about 1:1:8 (w / w). 194. The composition as described in paragraph 185, wherein the first mRNA, the second mRNA, and the third mRNA are present in a ratio of about 1:1:9 (w / w). 195. The composition as described in paragraph 185, wherein the first mRNA, the second mRNA, and the third mRNA are present in a ratio of about 1:1:10 (w / w). 196. The composition as described in paragraph 185, wherein the first mRNA, the second mRNA, and the third mRNA are present in a ratio (w / w) of about 1:1:2 to about 1:1:10. 197. The composition as described in paragraph 186, wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are present in a ratio of about 1:1:2:2 (w / w). 198. The composition as described in paragraph 186, wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are present in a ratio of about 1:1:3:3 (w / w). 199. The composition as described in paragraph 186, wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are present in a ratio of about 1:1:4:4 (w / w). 200. The composition as described in paragraph 186, wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are present in a ratio of about 1:1:5:5 (w / w). 201. The composition as described in paragraph 186, wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are present in a ratio of about 1:1:6:6 (w / w). 202. The composition as described in paragraph 186, wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are present in a ratio of about 1:1:7:7 (w / w). 203. The composition as described in paragraph 186, wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are present in a ratio of about 1:1:8:8 (w / w). 204. The composition as described in paragraph 186, wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are present in a ratio of about 1:1:9:9 (w / w). 205. The composition as described in paragraph 186, wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are present in a ratio of about 1:1:10:10 (w / w). 206. The composition as described in paragraph 186, wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are present in a ratio (w / w) of about 1:1:2:2 to about 1:1:10:10. 207. The composition as described in any one of paragraphs 187-205, wherein the ratio is expressed in micrograms (µg). 208. The composition as described in paragraph 197, wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are present in a ratio (w / w) of about 32 micrograms of the first mRNA: about 32 micrograms of the second mRNA: about 64 micrograms of the third mRNA: about 64 micrograms of the fourth mRNA. 209. The composition as described in paragraph 199, wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are present in a ratio (w / w) of about 16 micrograms of the first mRNA: about 16 micrograms of the second mRNA: about 64 micrograms of the third mRNA: about 64 micrograms of the fourth mRNA. 210. The composition as described in paragraph 201, wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are present in a ratio (w / w) of about 16 micrograms of the first mRNA: about 16 micrograms of the second mRNA: about 96 micrograms of the third mRNA: about 96 micrograms of the fourth mRNA. 211. The composition as described in any one of paragraphs 187-207, wherein the composition comprises a total of 130 micrograms of the mRNA. 212. The composition as described in any one of paragraphs 187-207, wherein the composition comprises a total of 160 micrograms of the mRNA. 213. The composition as described in any one of paragraphs 187-207, wherein the composition comprises a total of 200 micrograms of the mRNA. 214. The composition as described in any one of paragraphs 187-207, wherein the composition comprises a total of 224 micrograms of the mRNA. 215. The composition as described in any one of paragraphs 187-207, wherein the composition comprises a total of 130 micrograms to 224 micrograms of the mRNA. 216. The composition as described in any of the preceding paragraphs, wherein the first mRNA, the second mRNA, the third mRNA and / or the fourth mRNA are not covalently linked to each other. 217. The composition as described in any one of paragraphs 185-215, wherein one or more of the first mRNA, the second mRNA, the third mRNA and / or the fourth mRNA are covalently linked to each other. 218. The composition as described in any of the preceding paragraphs, wherein the LNP further comprises polyethylene glycol (PEG) conjugated (PEGylated) lipids, cholesterol-based lipids, and auxiliary lipids. 219. The composition as described in any of the preceding paragraphs, wherein the LNP comprises: IM-001 with a molar ratio of 35% to 55%; A polyethylene glycol (PEG) conjugated (PEGylated) lipid in a molar ratio of 0.25% to 2.75%; Cholesterol-based lipids with a molar ratio of 20% to 45%; and The molar ratio of auxiliary lipids is 5% to 35%. All of these molar ratios are relative to the total lipid content of the LNP. 220. The composition as described in paragraph 219, wherein the LNP comprises: IM-001 with a molar ratio of 40%; PEGylated lipids with a molar ratio of 1.5%; Cholesterol-based lipids with a molar ratio of 28.5%; and The auxiliary lipid has a molar ratio of 30%. All of these molar ratios are relative to the total lipid content of the LNP. 221. The composition of any one of paragraphs 218-220, wherein the PEGylated lipid is dimyristoyl-PEG2000 (DMG-PEG2000) or 2-[(polyethylene glycol)-2000]-N,N-bistetradecylacetamide (ALC-0159). 222. The composition as described in any one of paragraphs 218-221, wherein the cholesterol-based lipid is cholesterol. 223. The composition of any one of paragraphs 218-222, wherein the auxiliary lipid is 1,2-dioleoyl-SN-glycerol-3-phosphate ethanolamine (DOPE) or 1,2-distearate-sn-glycerol-3-phosphate choline (DSPC). 224. The composition as described in any of the preceding paragraphs, wherein the average diameter of the LNP is 30 nm to 200 nm. 225. The composition as described in paragraph 224, wherein the average diameter of the LNP is from 80 nm to 150 nm. 226. The composition as described in any one of paragraphs 185-225, wherein the first mRNA encodes the HA antigen of the influenza A H1N1 subtype. 227. The composition as described in any one of paragraphs 185-226, wherein the second mRNA encodes the HA antigen of the influenza A H3N2 subtype. 228. The composition as described in any one of paragraphs 185-227, wherein the third mRNA encodes the HA antigen of the Victoria lineage of influenza B. 229. The composition as described in any one of paragraphs 186-229, wherein the fourth mRNA encodes the HA antigen of the Yamagata lineage of influenza B. 230. The composition as described in any one of paragraphs 185-229, wherein at least one of these mRNAs comprises a codon-optimized ORF. 231. The composition as described in any one of paragraphs 185-230, wherein at least one of these mRNAs comprises at least one 5' untranslated region (5' UTR), at least one 3' untranslated region (3' UTR), and at least one polyadenylated (poly(A)) sequence. 232. The composition as described in any one of paragraphs 185-231, wherein at least one of these mRNAs comprises at least one chemical modification. 233. The composition as described in any one of paragraphs 185-232, wherein at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% of the uracil nucleotides in at least one of these mRNAs are chemically modified. 234. The composition of any one of paragraphs 185-233, wherein at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% of the uracil nucleotides in at least one of these ORFs are chemically modified. 235. The composition of any one of paragraphs 232-234, wherein the chemical modification is selected from the group consisting of: pseudouridine, N1-methylpseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deazo-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methyluridine, 5-methyluridine, 5-methoxyuridine, and 2'-O-methyluridine. 236. The composition as described in paragraph 235, wherein the chemical modification is selected from the group consisting of: pseudouridine, N1-methylpseudouridine, 5-methylcytosine, 5-methoxyuridine, and combinations thereof. 237. The composition as described in paragraph 236, wherein the chemical modification is N1-methylpseuuridine. 238. A method comprising administering to a subject in need the composition as described in any one of paragraphs 185-237. 239. A method for inducing an immune response to influenza A or protecting a subject from infection with influenza A, the method comprising administering to the subject a composition as described in any one of paragraphs 185-237. 240. A method for inducing an immune response to influenza B or protecting a subject from infection with influenza B, the method comprising administering to the subject any one of paragraphs 185-237. 241. The method as described in paragraph 239, wherein the subject who has received the composition has a comparable serum concentration of neutralizing antibodies against influenza A, relative to the subject who has received the influenza A protein vaccine. 242. The method as described in paragraph 240, wherein the subject who has received the composition has a comparable serum concentration of neutralizing antibodies against influenza B, relative to the subject who has received the influenza B protein vaccine. 243. The method as described in paragraph 239, wherein the composition increases the serum concentration of neutralizing antibodies against influenza A in the subject. 244. The method as described in paragraph 240, wherein the composition increases the serum concentration of neutralizing antibodies against influenza B in the subject. 245. The method as described in paragraph 243, wherein the composition increases the serum concentration of neutralizing antibodies against influenza A H1N1 and / or influenza A H3N2 in the subject. 246. The method as described in paragraph 244, wherein the composition increases the serum concentration of neutralizing antibodies against the Yamagata lineage and / or Victoria lineage of influenza B in the subject. 247. The composition as described in any one of paragraphs 185-237, for use in a method of inducing an immune response to influenza A or protecting a subject from infection with influenza A. 248. The composition as described in any one of paragraphs 185-237, for use in a method of inducing an immune response to influenza B or protecting a subject from infection with influenza B. 249. Use of the composition as described in any one of paragraphs 185-237 in the manufacture of a medicament for inducing an immune response to influenza A or for protecting a subject from infection with influenza A. 250. Use of the composition as described in any one of paragraphs 185-237 in the manufacture of a medicament for inducing an immune response to influenza B or for protecting a subject from infection with influenza B. Example Example 1: 1:1:1:1 Combined Influenza mRNA Vaccine Formulation: Immunogenicity in Mice

[0659] This example describes an experiment evaluating the potency of monovalent and quadrivalent mRNA-LNP vaccine formulations containing mRNAs encoding HA sequences of two influenza A strains (A / H1N1 and A / H3N2) and two influenza B strains (B / Yamagata lineage and B / Victoria lineage) in a 1:1:1:1 ratio. The immunogenicity of three tetravalent modified mRNA influenza vaccines, whose mRNAs encode HA sequences of two influenza A strains (A / H1N1 and A / H3N2) and two influenza B strains (B / Yamagata lineage and B / Victoria lineage) in a 1:1:1:1 ratio, was also assessed. The LNP formulation contained: 40% cationic lipid ckk-E10; 1.5% DMG-PEG2000; 28.5% cholesterol; and 30% DOPE. BALB / c mice were administered 40 μg of mRNA encoding HA-1 (A / Michigan / 45 / 2015), HA-3 (A / Singapore / INFIMH160019 / 2016), HA-B Victoria (B / Maryland / 15 / 2016 BX69A), and HA-B Yamagata (B / Phuket / 3073 / 2013) (40 μg of each mRNA formulation mixed prior to administration) in a two-dose regimen at 3-week intervals. Samples were collected on days 1, 20, 22, and 36. Hemagglutination inhibition (HAI) response against the homologous strain was assessed to measure functional antibodies. Results for the day 36 sample are shown in Table 1 below. Table 1 HAI GMT titers in mice

[0660] No significant differences were observed between the monovalent and quadrivalent vaccines in terms of immune response to any of the four antigens. However, the HAI GMT of the beta strain was within the detection limit in both cases, indicating a reduced immune response compared to the beta strain. Example 2: A 1:1:1:1 combination influenza mRNA vaccine formulation in human clinical trials

[0661] A pandemic occurs when a novel influenza virus emerges in the population. Such pandemics remain a major threat to public health, requiring vigilance and preparedness to respond to ongoing human-to-human transmission. In the experiment described in this example, three Phase I / II studies were designed to evaluate the safety and immunogenicity of three tetravalent modified mRNA influenza vaccines. The mRNA encodes the HA sequences (in a 1:1:1:1 ratio) of two influenza A strains (A / H1N1 and A / H3N2) and two influenza B strains (B / Yamagata lineage and B / Victoria lineage) and is encapsulated in an LNP formulation containing one of three cationic lipids: GL-HEPES-E3-E12-DS-4-E10 (Clinical Trial NCT05624606), ckk-E10 (Clinical Trial NCT05553301), or OF-02 (Clinical Trial NCT05650554). The composition of LNP is as follows: 40% cationic lipids; 1.5% DMG-PEG2000; 28.5% cholesterol; and 30% DOPE.

[0662] Clinical trial NCT05624606 evaluated the safety and immunogenicity of the quadrivalent influenza mRNA vaccine MRT5410, administered as a single intramuscular injection at three dose levels (low, medium, and high) to adults aged 18 years and older, and compared with the following positive controls: (1) Fluzone Quadrivalent®, a standard-dose quadrivalent inactivated influenza vaccine, and used as a control vaccine for study participants aged 18–64 years and ≥ 65 years; (2) Flublok Quadrivalent®, a quadrivalent recombinant influenza vaccine, and used as a control vaccine for study participants aged 18–64 years and ≥ 65 years; and (3) Fluzone High-Dose Quadrivalent®, a high-dose quadrivalent inactivated influenza vaccine, and used as a control vaccine only for study participants aged ≥ 65 years.

[0663] Clinical trial NCT05553301 evaluated the safety and immunogenicity of the quadrivalent influenza mRNA vaccine MRT5407, administered as a single intramuscular injection in adults aged 18 years and older at two dose levels (i.e., dose level 1 and dose level 2), and compared with the following positive controls: (1) Fluzone Quadrivalent®, as a control vaccine in study participants aged 18–64 years and ≥ 65 years; (2) Flublok Quadrivalent®, as a control vaccine in study participants aged 18–64 years and ≥ 65 years; and (3) Fluzone High-Dose Quadrivalent®, as a control vaccine only in study participants aged ≥ 65 years.

[0664] Clinical trial NCT05650554 evaluated the safety and immunogenicity of the quadrivalent influenza mRNA vaccine MRT5413, administered as a single intramuscular injection at three dose levels (low, medium, and high) to adults aged 18 years and older, and compared with the following positive controls: (1) Fluzone Quadrivalent®, as a control vaccine for study participants aged 18–64 years and ≥ 65 years; (2) Flublok Quadrivalent®, as a control vaccine for study participants aged 18–64 years and ≥ 65 years; and (3) Fluzone High-Dose Quadrivalent®, as a control vaccine only for study participants aged ≥ 65 years.

[0665] Interim results from the clinical trial NCT05624606 showed that all three dose levels (low, medium, and high) of the 1:1:1:1 quadrivalent mRNA vaccine formulated with the cationic lipid GL-HEPES-E3-E12-DS-4-E10 generated hemagglutinin inhibition (HAI) antibodies against all four influenza strains in adults aged 18 to 64 years. Additionally, while immune responses against influenza A strains (e.g., A / H1N1, A / H3N2) were comparable to controls, lower immune responses against influenza B strains (e.g., B / Yamagata lineage and B / Victoria lineage) were observed in adults aged 18 to 64 years. Figure 1 As shown.

[0666] Interim results from the clinical trial NCT05553301 showed that the 1:1:1:1 quadrivalent mRNA vaccine formulated with the cationic lipid ckk-E10 at both dose levels (dose level 1 and dose level 2) generated HAI antibodies against all four influenza strains in adults aged 18 to 64 years. However, while immune responses against influenza A strains (e.g., A / H1N1, A / H3N2) were comparable to controls, lower immune responses against influenza B strains (e.g., B / Yamagata lineage and B / Victoria lineage) were observed in adults aged 18 to 64 years. Figure 2 As shown.

[0667] The data from the above studies indicate a need to improve the immunogenicity of influenza B strains in combined influenza mRNA vaccine formulations. Example 3: Improving the immunogenicity of influenza B strains in combined influenza mRNA vaccine formulations

[0668] An exemplary strategy for improving the immunogenicity of influenza B strains in combined influenza mRNA vaccine formulations is to increase the ratio / amount of mRNA encoding one or more HA sequences of one or more influenza B viruses compared to mRNA encoding one or more HA sequences of one or more influenza A viruses.

[0669] Table 2 below depicts exemplary clinical trial protocols in which eligible participants (adults aged 18 to 64 years and ≥ 65 years) were randomly assigned to receive a single intramuscular injection of any of the following: (1) a 1:1:1:1 quadrivalent mRNA vaccine encoding HA sequences of influenza A and influenza B strains, with a total mRNA dose of 130 μg; (2) a 1:1:4:4 quadrivalent mRNA vaccine encoding HA sequences of influenza A and influenza B strains, with a total mRNA dose of 160 μg; (3) a 1:1:2:2 quadrivalent mRNA vaccine encoding HA sequences of influenza A and influenza B strains, with a total mRNA dose of 200 μg; (4) a 1:1:6:6 quadrivalent mRNA vaccine encoding HA sequences of influenza A and influenza B strains, with a total mRNA dose of 224 μg; (5) a single dose of Fluzone Quadrivalent® influenza vaccine (standard dose) (Sanofi Pasteur). (6) One dose of Fluzone High-Dose Quadrivalent® influenza vaccine (Sanofi Pasteur); or (7) One dose of Flublok Quadrivalent® recombinant influenza vaccine (Sanofi Pasteur). Table 2 - Exemplary clinical study protocol (Protocol 1) for evaluating the HA mRNA ratio and total mRNA dose in quadrivalent influenza mRNA vaccines.

[0670] The aim of this study was to evaluate the safety and immunogenicity of four quadrivalent influenza mRNA vaccines (with different A:A:B:B HA mRNA ratios and total mRNA doses) administered via a single intramuscular injection in adults aged 18 years and older, compared with the following controls: one dose of Fluzone Quadrivalent® influenza vaccine (standard dose) as a control vaccine in study participants aged 18–64 years and ≥ 65 years; one dose of Fluzone High-Dose Quadrivalent® influenza vaccine as a control vaccine only in study participants aged ≥ 65 years; and one dose of Flublok Quadrivalent® recombinant influenza vaccine as a control vaccine in study participants aged 18–64 years and ≥ 65 years.

[0671] Table 3 below describes alternative clinical trial protocols in which eligible participants (adults aged 18 to 64 years and ≥ 65 years) were randomly assigned to receive a single intramuscular injection of any of the following: (1) a 1:1:2:2 quadrivalent mRNA vaccine encoding the HA sequences of influenza A and influenza B strains, with a total mRNA dose of 192 μg, in an LNP containing the cationic lipid GL-HEPES-E3-E12-DS-4-E10; (2) a 1:1:2:2 quadrivalent mRNA vaccine encoding the HA sequences of influenza A and influenza B strains, with a total mRNA dose of 30 μg, in an LNP containing the cationic lipid IM-01; (3) a 1:1:2:2 quadrivalent mRNA vaccine encoding the HA sequences of influenza A and influenza B strains, with a total mRNA dose of 96 μg, in an LNP containing the cationic lipid IM-01; (4) (5) A 1:1:2:2 quadrivalent mRNA vaccine encoding HA sequences of influenza A and influenza B strains, with a total mRNA dose of 132 μg, in an LNP containing cationic lipid IM-01; (6) A 1:1:2:2 quadrivalent mRNA vaccine encoding HA sequences of influenza A and influenza B strains, with a total mRNA dose of 192 μg, in an LNP containing cationic lipid IM-01; (7) A 1:1:2:2 quadrivalent mRNA vaccine encoding HA sequences of influenza A and influenza B strains, with a total mRNA dose of 96 μg, in an LNP containing cationic lipid ALC-0315; (8) A 1:1:2:2 quadrivalent mRNA vaccine encoding HA sequences of influenza A and influenza B strains, with a total mRNA dose of 192 μg, in an LNP containing cationic lipid ALC-0315; (9) (6) One dose of Fluzone Quadrivalent® Influenza Vaccine (Standard Dose) QIV-SD (Sanofi Pasteur); or (7) One dose of Fluzone High-Dose Quadrivalent® Influenza Vaccine QIV-HD (Sanofi Pasteur); or (8) One dose of Flublok Quadrivalent® Recombinant Influenza Vaccine RIV (Sanofi Pasteur). Table 3 - Exemplary clinical study protocol for evaluating the HA mRNA ratio and total mRNA dose of different LNPs in a quadrivalent influenza mRNA vaccine - (Protocol 2)

[0672] The aim of this study was to evaluate the safety and immunogenicity of quadrivalent influenza mRNA vaccines (with different A:A:B:BHA mRNA ratios and total mRNA doses) administered via a single intramuscular injection in adults aged 18 years and older, compared with the following controls: one dose of Fluzone Quadrivalent® influenza vaccine (standard dose) as a control vaccine in study participants aged 18–64 years and ≥ 65 years; one dose of Fluzone High-Dose Quadrivalent® influenza vaccine as a control vaccine only in study participants aged ≥ 65 years; and one dose of Flublok Quadrivalent® recombinant influenza vaccine as a control vaccine in study participants aged 18–64 years and ≥ 65 years.

[0673] The following are exemplary nucleic acid sequences encoding exemplary influenza A and influenza B constructs that can be used in clinical research protocols:

[0674] A / Wisconsin / 588 / 2019

[0675] A / Tasmania / 503 / 2020

[0676] B / Washington State / 02 / 2019

[0677] B / Phuket / 3073 / 2013 Example 4: Using LNP containing IM-001 to induce HA immune response

[0678] The following LNPs were used to deliver the HA antigen in mice: 40% IM-001, 1.5% DMG-PEG2000, 28.5% cholesterol, and 30% DOPE. Balb / c mice (Mus musculus) were immunized under isoflurane anesthesia with 0.05 mL of IM-001 / modified Tasmanian H3 mRNA-lipid nanoparticles at a dose of 0.4 μg per mouse via the IM route into the quadriceps femoris muscle (one hind leg on day 0, and the contralateral leg on day 21). Mice were evaluated for at least 3 days post-administration, and animals exhibiting severe clinical signs after veterinary evaluation were euthanized by subcutaneous injection of 5 mg / kg meloxicam.

[0679] Blood was collected from all sedated animals via submandibular sinus or orbital sinus sampling (in-life bleed on day -1 and day 20) and cardiac puncture (terminal sampling, day 35). Blood was collected from mice at the pre-study stage to obtain baseline pre-immune serum samples for pre-screening purposes.

[0680] HAI assays were performed using the A / Tasmania / 503 / 2020 (H3N2) virus strain (BIOQUAL). Serum was treated with receptor-destructive enzyme (RDE) by diluting one part of the serum with three parts of the enzyme and incubating overnight at 37°C. The enzyme was inactivated by incubation at 56°C for 30 minutes, followed by the addition of six parts of PBS, resulting in a final dilution of 1 / 10. HAI assays were performed in 96-well V-bottom plates using four viral hemagglutination units (HAU) and 0.5% turkey RBC. Reference serum for each strain was included as a positive control on each assay plate. Each plate also included a back titration to confirm the antigen dose (4 HAU / 25 μl) and a negative control sample (PBS or naive control serum). The HAI titer was determined as the highest serum dilution resulting in complete inhibition of hemagglutination. Results were only valid for plates with appropriate back titration results (validating the added 4 HAU / 25 μl) and a reference serum titer within two times the expected titer. The vaccine showed that it induced 320 HAI GMT, demonstrating that these LNPs induce high levels of immunogenicity against influenza antigens.

Claims

1. A composition comprising at least three messenger RNAs (mRNAs), wherein the at least three mRNAs contain an open reading frame (ORF) encoding a hemagglutinin (HA) antigen, the at least three mRNAs being selected from the group consisting of: (i) The first mRNA encoding the HA antigen of influenza A virus; (ii) A second mRNA encoding the HA antigen of influenza A virus type 2, wherein the influenza A virus type 1 and the influenza A virus type 2 belong to different subtypes; and (iii) The third mRNA encoding the HA antigen of influenza B virus, The mRNA encoding the HA antigen of the influenza A virus and the mRNA encoding the HA antigen of the influenza B virus exist at different ratios (w / w).

2. The composition of claim 1, further comprising a fourth mRNA encoding the HA antigen of influenza B virus type 2, wherein the influenza B virus type 1 and the influenza B virus type 2 belong to different lineages.

3. The composition of claim 1, wherein the first mRNA, the second mRNA, and the third mRNA are present in a ratio (w / w) of about 1:1:2, about 1:1:3, about 1:1:4, about 1:1:5, about 1:1:6, about 1:1:7, about 1:1:8, about 1:1:9, or about 1:1:

10.

4. The composition of claim 2, wherein the first mRNA, the second mRNA, the third mRNA and the fourth mRNA are present in a ratio (w / w) of about 1:1:2:2, about 1:1:3:3, about 1:1:4:4, about 1:1:5:5, about 1:1:6:6, about 1:1:7:7, about 1:1:8:8, about 1:1:9:9 or about 1:1:10:

10.

5. The composition according to any one of claims 1-22, wherein the ratio is expressed in micrograms (µg).

6. The composition as claimed in any of the preceding claims, wherein the first mRNA, the second mRNA, the third mRNA and / or the fourth mRNA are formulated into an LNP.

7. The composition of claim 6, wherein the LNP comprises at least one cationic lipid, optionally the at least one cationic lipid being selected from the group consisting of: OF-02, cKK-E10, GL-HEPES-E3-E10-DS-3-E18-1, GL-HEPES-E3-E12-DS-4-E10, GL-HEPES-E3-E12-DS-3-E14, [(4-hydroxybutyl)azanidinediyl]bis(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315) and IM-001.

8. The composition of claim 6 or claim 7, wherein the LNP further comprises polyethylene glycol (PEG) conjugated (PEGylated) lipids, cholesterol-based lipids, and auxiliary lipids.

9. The composition of any one of claims 6 to 8, wherein the LNP comprises: Cationic lipids with a molar ratio of 35% to 55%; A polyethylene glycol (PEG) conjugated (PEGylated) lipid in a molar ratio of 0.25% to 2.75%; Cholesterol-based lipids with a molar ratio of 20% to 45%; and The molar ratio of auxiliary lipids is 5% to 35%. All of these molar ratios are relative to the total lipid content of the LNP; Optionally, the LNP includes: Cationic lipids with a molar ratio of 40%; PEGylated lipids with a molar ratio of 1.5%; Cholesterol-based lipids with a molar ratio of 28.5%; and The auxiliary lipid has a molar ratio of 30%. All of these molar ratios are relative to the total lipid content of the LNP.

10. The composition of claim 8 or claim 9, wherein the PEGylated lipid is dimyristoyl-PEG2000 (DMG-PEG2000) or 2-[(polyethylene glycol)-2000]-N,N-bistetradecylacetamide (ALC-0159); and / or the cholesterol-based lipid is cholesterol; and / or the co-lipid is 1,2-dioleoyl-SN-glycerol-3-phosphate ethanolamine (DOPE) or 1,2-distearate-sn-glycerol-3-phosphate choline (DSPC).

11. The composition of any of the preceding claims, wherein the first mRNA encodes the HA antigen of influenza A H1N1 subtype, and / or the second mRNA encodes the HA antigen of influenza A H3N2 subtype, and / or the third mRNA encodes the HA antigen of influenza B Victoria lineage strain.

12. The composition according to any one of claims 2-11, wherein the fourth mRNA encodes the HA antigen of the Yamagata lineage of influenza B.

13. A composition comprising at least three messenger RNAs (mRNAs), wherein: (i) The first mRNA encodes the hemagglutinin (HA) antigen of the first influenza A virus; (ii) The second mRNA encodes the HA antigen of the second influenza A virus, wherein the first and second influenza A viruses belong to different subtypes; and (iii) The third mRNA encodes the HA antigen of influenza B virus type 1. The first mRNA, the second mRNA, and the third mRNA were formulated into lipid nanoparticles (LNPs) containing IM-001.

14. The composition of any one of claims 1-14, for use in a method of inducing an immune response to influenza A or protecting a subject from infection with influenza A.

15. The composition of any one of claims 1-14, for use in a method of inducing an immune response to influenza B or protecting a subject from infection with influenza B.

Images