Method for increasing growth speed of fishes
By fusing the gh1 gene with the β-actin promoter in the fish genome, high expression of gh1 was achieved, solving the problem of increasing growth rate in existing technologies and significantly improving the growth rate and muscle quality of fish.
Patent Information
- Application Number
- CN202511020731.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2024-07-29
- Filing Date
- 2025-07-23
- Publication Date
- 2026-01-30
AI Technical Summary
Existing technologies are insufficient to effectively increase the growth rate of fish, especially without the introduction of exogenous genes, as there is a lack of effective means to enhance the expression of growth hormone genes.
By using gene editing technology, the coding region of the growth hormone gene gh1 is fused with the promoter of the endogenous highly expressed gene β-actin to form a gh1 highly expressed gene. The high expression of the gh1 gene is achieved by utilizing DNA breakage and intracellular repair pathways.
It significantly improves fish growth rate, increases muscle mass, weight and condition index, enhances food conversion rate, and increases growth rate and fillet yield without introducing foreign genes.
Smart Images

Figure CN121428019A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of biotechnology and aquaculture, and particularly relates to a method for improving the growth speed of fish. BACKGROUND
[0002] The growth hormone (gh) gene in fish controls the speed of growth and development. The gh1 gene is a growth hormone gene in zebrafish (DaniO rerio or zebrafish).
[0003] Actin, also known as "actin", is an important cytoskeletal protein in cells. Actin can be roughly divided into six types, and the most widely studied types are actin, alpha skeletal muscle 2 (hereinafter referred to as alpha-actin) and beta-actin (also known as actin beta, beta-actin1, actb or actb1). The promoter of each type of actin gene is an important element for effectively driving gene expression. SUMMARY
[0004] The present application creates a fast-growing fish variety through gene editing, and the specific scheme is as follows:
[0005] The present application provides a method for improving the growth speed of fish, comprising the following steps: under the condition of not introducing an exogenous gene, fusing the coding region of the gh1 gene with a strong promoter of another endogenous high-expression gene in vivo to produce a gh1 high-expression gene, and the strong promoter is the beta-actin gene promoter.
[0006] The present application also provides an editing method for knocking up the expression of an endogenous gh1 gene in fish, comprising the following steps: under the condition of not introducing an exogenous gene, fusing the coding region of the gh1 gene with a strong promoter of another endogenous high-expression gene in vivo to produce a gh1 high-expression gene, and the strong promoter is the beta-actin gene promoter.
[0007] In one specific embodiment, the method specifically comprises the following steps:
[0008] DNA breaks are simultaneously generated at two different specific positions in the genome of the organism, which are the genomic sites between the coding region of the gh1 gene and its promoter and the genomic sites between the coding region of the beta-actin gene and its promoter, and then the two are connected to each other through an intracellular repair pathway, so that the coding region of the gh1 gene is fused with the promoter of the beta-actin gene in vivo, and finally a gh1 high-expression gene is produced;
[0009] Alternatively, DNA breaks are simultaneously generated at three different specific locations in the genome of the organism, which are two genomic sites capable of cleaving out the promoter fragment of the β-actin gene and the genomic site between the coding region of the gh1 gene and its promoter, and then connected to each other through intracellular repair pathways to generate a translocation editing event of the insertion of the promoter fragment of the β-actin gene upstream of the coding region of the gh1 gene, and finally a gh1 high-expression gene is generated;
[0010] Alternatively, DNA breaks are simultaneously generated at three different specific locations in the genome of the organism, which are two genomic sites capable of cleaving out the promoter fragment of the β-actin gene and the genomic site between the coding region of the gh1 gene and its promoter, and then connected to each other through intracellular repair pathways to generate a translocation editing event of the insertion of the promoter fragment of the β-actin gene upstream of the coding region of the gh1 gene, and finally a gh1 high-expression gene is generated;
[0011] In one embodiment, the method further comprises the following steps: designing a primer pair capable of specifically distinguishing the new combination of the above-mentioned genetic elements for the above-mentioned combination of specific locations, screening the cells or tissues containing the gh1 high-expression gene by PCR, and sequencing to determine the characteristic sequence of the new combination of genetic elements.
[0012] In another embodiment, the primer pair is selected from any one of the following groups: SEQ ID NO: 14 and SEQ ID NO: 15, SEQ ID NO: 16 and SEQ ID NO: 17, SEQ ID NO: 18 and SEQ ID NO: 19, and SEQ ID NO: 20 and SEQ ID NO: 21.
[0013] In one embodiment, the DNA break is performed by Meganuclease, Zinc finger nuclease, TALEN or CRISPR / Cas system.
[0014] In another embodiment, the system is CRISPR / Cas9 or CRISPR / KingCas12 system.
[0015] In one embodiment, the sequence of the gh1 high-expression gene is shown in SEQ ID NO: 22 or SEQ ID NO: 23.
[0016] In one embodiment, the nucleic acid sequence of the strong promoter is shown in SEQ ID NO: 1 or SEQ ID NO: 4.
[0017] In one embodiment, the gh1 gene is a nucleotide encoding the amino acid sequence of SEQ ID NO: 3 or SEQ ID NO: 7.
[0018] In another embodiment, the nucleic acid sequence is as set forth in SEQ ID NO: 2 or SEQ ID NO: 6.
[0019] In one embodiment, the fish exhibits at least one of the following characteristics: increased muscle mass, increased muscle weight, increased condition factor, increased growth rate, increased food conversion rate, increased fillet weight, or increased fillet yield.
[0020] In one embodiment, the fish is salmon.
[0021] In another embodiment, the fish is rainbow trout or zebra fish.
[0022] The present application also provides a fish with a gh1 high expression gene, which has a nucleotide sequence as set forth in SEQ ID NO: 22 or SEQ ID NO: 23.
[0023] The present application also provides a target sequence designed for increasing the growth rate of fish or knocking up the expression of an endogenous gh1 gene in fish, which is as set forth in SEQ ID NO: 8, SEQ ID NO: 9, and SEQ ID NO: 10, and the reverse complement thereof; or as set forth in SEQ ID NO: 11, SEQ ID NO: 12, and SEQ ID NO: 13, and the reverse complement thereof.
[0024] Some of the terms used in the present application are defined as follows.
[0025] The "fish" of the present application refers to a gill-bearing vertebrate that lives in water. In one embodiment, the fish is salmon, preferably rainbow trout or zebra fish.
[0026] The "salmon" of the present application refers to the group standard of "Raw Salmon" jointly formulated by the China Aquatic Products Processing and Marketing Association and multiple enterprises in 2018, which provides that salmon is a general term for salmonids, including most salmonids such as Atlantic salmon, rainbow trout, coho salmon, and king salmon. The salmon commercially available in China is mainly imported Atlantic salmon and rainbow trout (Oncorhynchus mykiss) artificially bred in China, which is also known as "freshwater salmon". Salmon has small scales, orange-red meat, and delicious meat, and is rich in unsaturated fatty acids, which can effectively reduce blood lipids and blood cholesterol and prevent cardiovascular diseases.
[0027] The terms "wild type" and "mutation" as used in this invention are relative and refer to the phenotype with the highest frequency in a particular population, or the system, organism, or gene that has this phenotype.
[0028] The terms "protein," "polypeptide," and "peptide" are used interchangeably in this invention to refer to polymers of amino acid residues, including polymers in which one or more amino acid residues are chemical analogs of natural amino acid residues. The proteins and polypeptides of this invention can be generated through recombinant synthesis or through chemical synthesis.
[0029] As used in this article, “genome” refers to all the genetic material (genes and non-coding sequences) present in every cell, virus, or organelle of an organism, and / or the complete set of chromosomes inherited as a unit (haploid) from a parent.
[0030] The “gene” as described in this invention includes nucleic acid fragments that express functional molecules (such as, but not limited to, specific proteins), including regulatory sequences before (5' non-coding sequence) and after (3' non-coding sequence).
[0031] The DNA sequence that “encodes” a specific RNA is the DNA nucleic acid sequence that is transcribed into RNA. DNA polynucleotides can encode RNA (mRNA) that is translated into proteins, or DNA polynucleotides can encode RNA that is not translated into proteins (such as tRNA, rRNA, or RNA that targets DNA; also known as “non-coding” RNA or “ncRNA”).
[0032] The terms "nucleotide," "polynucleotide," "nucleic acid," "nucleic acid molecule," or "nucleic acid sequence" used in this invention are used interchangeably and refer to oligonucleotides, nucleotides, or polynucleotides and fragments or portions thereof, which may be single-stranded or double-stranded, and indicate sense or antisense strands. Nucleic acids include DNA, RNA, or hybrids thereof, and may have natural or synthetic origins. For example, nucleic acids may include mRNA or cDNA. Nucleic acids may include nucleic acids that have been amplified (e.g., using polymerase chain reaction). The nucleotide name "R" indicates a purine, such as guanine or adenine; "Y" indicates a pyrimidine, such as cytosine or thymine (or uracil if it is RNA); "M" indicates adenine or cytosine; "K" indicates guanine or thymine; and "W" indicates adenine or thymine.
[0033] Those skilled in the art will readily understand that, due to the degeneracy of the genetic code, a variety of different nucleic acid sequences can encode the amino acid sequences disclosed herein. Generating other nucleic acid sequences encoding the same protein is within the capabilities of those skilled in the art; therefore, this invention covers nucleic acid sequences encoding the same amino acid sequence due to the degeneracy of the genetic code. For example, to achieve high expression of a heterologous gene in a target host organism such as a plant, the gene can be optimized using codons preferred by the host organism to improve its expression.
[0034] The term "gene editing" refers to strategies and techniques for targeted and specific modifications to any genetic information or genome of a living organism. Therefore, the term includes editing of gene-coding regions, but also editing of regions other than the gene-coding regions of the genome. It also includes editing or modifying the nucleus (if present) and other genetic information within the cell.
[0035] The term “CRISPR / Cas” can refer to a CRISPR-based nuclease or the nucleic acid sequence encoding it, including but not limited to: 1) Cas9, including SpCas9, ScCas9, SaCas9, xCas9, VRER-Cas9, EQR-Cas9, SpG-Cas9, SpRY-Cas9, SpCas9-NG, NG-Cas9, NGA-Cas9(VQR), etc.; 2) Cas12, including LbCpf1, FnCpf1, AsCpf1, MAD7, KingCas12, etc.; or any variant or derivative of the aforementioned CRISPR-based nucleases. Preferably, the at least one of the CRISPR-based nucleases contains a mutation compared to the corresponding wild-type sequence, such that the obtained CRISPR-based nuclease recognizes a different PAM sequence.
[0036] The term "CRISPR" refers to a sequence-specific genetic manipulation technique that relies on clustered, regularly spaced short palindromic repeats, unlike RNA interference which regulates gene expression at the transcriptional level.
[0037] The terms "Cas9 nuclease" and "Cas9" are used interchangeably in this article, referring to RNA-guided nucleases that include the Cas9 protein or fragments thereof (e.g., proteins containing the active DNA-cutting domain of Cas9 and / or the gRNA-binding domain of Cas9). Cas9 is a component of the CRISPR / Cas (clustered regularly spaced short palindromic repeats and related systems) genome editing system, capable of targeting and cleaving DNA target sequences to form DNA double-strand breaks (DSBs) under the guidance of guide RNA.
[0038] In this document, "gRNA" refers to a guide RNA used for targeting specific genes and thus correcting them using CRISPR technology. It typically consists of partially complementary crRNA and tracrRNA molecules forming a complex. The crRNA contains a sequence sufficiently complementary to the target sequence to hybridize with it and guide the CRISPR complex (Cas9+crRNA+tracrRNA) to specifically bind to the target sequence. However, it is known in the art that a single guide RNA (sgRNA) can be designed that simultaneously incorporates features of both crRNA and tracrRNA.
[0039] The term "crRNA" or "CRISPR RNA" refers to a guide RNA suitable for the CRISPR system, which includes a recognition sequence (or spacer sequence) and a backbone region. The backbone region can interact with a CRISPR protein (or Cas protein), thereby causing the Cas protein and crRNA to form a complex, which guides the complex to bind to a target sequence. As described in this invention, crRNA is a short RNA that guides the KingCas12 protein / enzyme (SEQ ID NO: 24) to bind to a target genomic DNA sequence, and its recognition sequence is complementary to the target sequence.
[0040] The terms “complementary,” “complementarity,” “reverse complementarity,” or “reverse complementarity” are used interchangeably to refer to a nucleotide sequence that is complementary to a given nucleotide sequence, but in reverse order. For example, the sequence “5’-CAGT-3’” is complementary to the sequence “3’-GTCA-5’.” The term “complementary sequence” refers to a nucleic acid sequence that can form hydrogen bonds with another nucleic acid sequence through conventional Watson-Crick or other non-traditional types.
[0041] In some embodiments, guide RNA(one or more) and Cas9 or KingCas12 protein can be delivered to cells as a ribonucleoprotein (RNP) complex. The RNP consists of purified Cas9 or KingCas12 protein complexed with the guide RNA, and it is well known in the art that RNPs can be efficiently delivered to a variety of cell types, including but not limited to stem cells and immune cells (Addgene, Cambridge, MA; Mirus Bio LLC, Madison, WI).
[0042] The terms "translocation" or "chromosomal translocation" can be used interchangeably in this article. A change in the position of a chromosome segment is called a "translocation," which is accompanied by a change in the position of a gene. When a translocation occurs within a single chromosome, it is called a translocation or intrachromosomal translocation; when a translocation occurs between two homologous or non-homologous chromosomes, it is called an interchromosomal translocation.
[0043] Altering the expression of endogenous genes in organisms involves both intensity and spatiotemporal characteristics. Intensity includes upregulation (i.e., knock-up, high gene expression), downregulation (i.e., knock-down), and zeroing (i.e., knockout); spatiotemporal specificity includes time (reproductive period) specificity and space (tissue) specificity, as well as inducibility. Furthermore, it involves altering protein targeting, for example, changing a protein located in the cytoplasm to one located in chloroplasts or the nucleus. In this invention, a "highly expressed gene" refers to a gene whose expression level is higher than that of a normal gene in a specific tissue.
[0044] The terms "regulatory sequence" and "regulatory element" are used interchangeably. Both refer to nucleotide sequences located upstream (5' non-coding sequence), midway, or downstream (3' non-coding sequence) of a coding sequence that influence the transcription, RNA processing, stability, or translation of the relevant coding sequence. Plant expression regulatory elements are nucleotide sequences that can control the transcription, RNA processing, stability, or translation of a nucleotide sequence of interest in plants.
[0045] Regulatory sequences may include, but are not limited to, promoters, translational leader sequences, introns, and polyadenylation recognition sequences.
[0046] A promoter is a nucleic acid fragment that controls the transcription of another nucleic acid segment. A promoter is a specific DNA regulatory region located upstream of the coding sequence of a gene, whose function is to mediate and regulate the transcription initiation and expression level of a target gene. This region contains core promoter elements (such as the TATA box, initiator Inr, etc.) and adjacent regulatory sequences (such as the GC box, CAAT box, etc.), and can form a pre-initiation complex (PIC) by binding to RNA polymerase, universal transcription factors (GTFs), and specific transcription factors (TFs), thereby precisely controlling the spatiotemporally specific expression of the gene. In genetic engineering, promoters are operatively linked to the open reading frame (ORF) of the target gene to achieve the controlled expression of the foreign gene in the host cell. In some embodiments of this invention, the promoter is a promoter capable of controlling gene transcription in plant cells, regardless of whether it originates from plant cells. The promoter can be a constitutive promoter, a tissue-specific promoter, a developmental regulatory promoter, or an inducible promoter.
[0047] As used herein, the term "promoter" generally refers to a DNA molecule involved in the recognition and binding of RNA polymerase II and other proteins (trans-acting transcription factors) to initiate transcription. A promoter can initially be isolated from a DNA sequence within a 1-4000 bp range upstream of the 5' untranslated region (5'UTR) of a gene's genomic copy. Alternatively, a promoter can be a synthetically generated or manipulated DNA molecule. Promoters can also be chimeric, i.e., promoters generated by the fusion of two or more heterologous DNA molecules. Useful promoters in embodiments of the invention include SEQ ID NO:2 or SEQ ID NO:4, or fragments or variants thereof. In specific embodiments of the invention, these promoters and any variants or derivatives thereof described herein are further defined as containing promoter activity, i.e., capable of functioning as a promoter in a host cell (e.g., in a transgenic plant). In even further specific embodiments, a fragment can be defined as exhibiting the promoter activity of the initiating promoter from which it originates, or a fragment can contain a "minimal promoter" (which provides a basic level of transcription and consists of a TATA box or an equivalent sequence for recognition and binding of the RNA polymerase II complex to achieve transcription initiation).
[0048] In one embodiment, a fragment of the promoter sequence disclosed herein is provided. The promoter fragment may contain the promoter activity described above and may be used alone or in combination with other promoters and promoter fragments, as in a constructed chimeric promoter. In a particular embodiment, a promoter fragment comprising at least about 50, 95, 150, 250, 500, 750, 1000, 1500, 2000, 3000, or at least about 4000 consecutive nucleotides or longer of a polynucleotide molecule having the promoter activity disclosed herein is provided.
[0049] The promoter may be an isolated nucleic acid, wherein the sequence of said isolated nucleic acid comprises a sequence having at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with a sequence selected from SEQ ID NO:3, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, or SEQ ID NO:52, or a sequence having at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with a fragment thereof.
[0050] The term "strong promoter" is well-known and widely used in the art, and many strong promoters are known in the art or can be identified by routine experiments. The promoter activity is higher than that of a promoter effectively linked to the nucleic acid molecule to be overexpressed in a wild-type organism, for example, a promoter with higher activity than the promoter of an endogenous gene. Preferably, the strong promoter activity is about 2%, 5%, 8%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 600%, 700%, 800%, 900%, 1000%, or more than 1000% higher than that of a promoter effectively linked to the nucleic acid molecule to be overexpressed in a wild-type organism. Those skilled in the art know how to determine promoter activity and compare the activities of different promoters.
[0051] In this invention, "comprising" or "including" means "including but not limited to".
[0052] The terminology used herein is for the purpose of describing particular embodiments and is not intended to be limiting. Unless otherwise expressly stated herein, the terms “a,” “an,” and “the” as used in the foregoing include their plural forms. The terms “comprises” and / or “comprising,” or “includes” and / or “including” as used herein specifically refer to the presence of the features, factors, and / or ingredients described herein, without excluding the presence and addition of one or more other features, factors, and ingredients. The term “and / or” as used above includes all or one of the items in the list of combinations.
[0053] This invention has been described in detail through a series of embodiments, but the invention is not limited to the disclosed embodiments. Any variations, substitutions, or replacements that fall within the scope of this invention, not described herein, may be modified according to public needs. Attached Figure Description
[0054] Figure 1 PCR detection results of interface sequences formed by zebrafish chromosome translocations: detection of the interface between the gh1 promoter and the β-actin promoter (left end of translocation interface), and detection of the interface between the β-actin promoter and the gh1 gene (right end of translocation interface).
[0055] Figure 2 The PCR test results of the selected positive and non-positive zebrafish offspring show that samples with bands are positive.
[0056] Figure 3A schematic diagram of the translocation event of the gh1 gene initiated by the zebrafish β-actin promoter;
[0057] Figure 4 Translocation-positive and wild-type zebrafish growth curves;
[0058] Figure 5-1 A comparison of the body size of zebrafish with high gh1 levels with wild-type zebrafish of the same period;
[0059] Figure 5-2 Comparison of gh1 gene mRNA in zebrafish with high gh1 knockout with wild-type gh1 gene mRNA during the same period;
[0060] Figure 6 PCR detection results of gh1 gene translocation event initiated by rainbow trout β-actin promoter: β-actin promoter positive at the gh1 interface (left 4# sample), gh1 positive at the β-actin promoter interface (right 4# sample);
[0061] Figure 7 PCR detection results of gh1 gene translocation event initiated by rainbow trout α-actin promoter: gh1 and α-actin promoter left-end interface positive, α-actin promoter and gh1 right-end interface positive;
[0062] Figure 8 Weight comparison of rainbow trout with high gh1 levels and wild-type trout of the same period;
[0063] Figure 9 Body size comparison of β-actin-gh1 knockout rainbow trout (top) and wild-type trout of the same period (bottom).
[0064] Sequence Description
[0065]
[0066] Detailed Implementation
[0067] The following embodiments are provided to provide those skilled in the art with a complete disclosure and description of how to prepare and use the invention, and these embodiments are not intended to limit the scope of the invention as viewed by the inventors, nor are they intended to represent or imply that the experiments described below are all or only the experiments performed. Those skilled in the art will understand that many variations and / or modifications can be made to the invention shown in specific aspects without departing from the spirit or scope broadly described herein. Therefore, aspects herein are to be considered illustrative rather than restrictive in all respects.
[0068] Example 1: Creating a gh1 overexpression gene in zebrafish
[0069] sgRNA targeting gh1 (SEQ ID NO: 8): 5'-aggtgtactgatatttatatg-3' was designed upstream of the start codon of the zebrafish gh1 gene. sgRNA targeting β-actin-A1 (SEQ ID NO: 9): 5'-aatctgagaggaagttgctg-3' and sgRNA targeting β-actin-A2 (SEQ ID NO: 10): 5'-gctttttttccctacagcca-3' were also designed upstream of the start codon of the zebrafish β-actin gene. EasyEdit sgRNA was synthesized by Genscript Biotech. The synthesized sgRNA was mixed with purified Cas9 protein at a 1:1 ratio, and the volume was brought up to 20 μl with RNase-free ultrapure water to achieve a final concentration of 3 μM. The mixture was incubated at room temperature for 5 min. In the experiment, sgRNA-gh1 was combined with sgRNA-β-actin-A1 and sgRNA-β-actin-A2 in equal proportions to prepare the RNP complex, which was then injected into zebrafish fertilized eggs after mixing.
[0070] DNA was extracted from the tail fins of surviving zebrafish approximately 2-3 months after injection in each group. After 0.8% agarose gel electrophoresis, the DNA samples were subjected to PCR detection using corresponding primers, and positive bands were sent for sequencing verification.
[0071] The primer sequences used to amplify the translocation interface between the β-actin promoter (SEQ ID NO: 1) and gh1 (nucleotide sequence SEQ ID NO: 2, amino acid sequence SEQ ID NO: 3) are as follows: Primers for amplifying the interface between the gh1 promoter and the β-actin promoter are: gh1-actb F1 (SEQ ID NO: 14): aacatcatcctggagtcatggaa; gh1-actb R1 (SEQ ID NO: 15): tgtttagggtggaggggagtt. Primers for amplifying the interface between the β-actin promoter and the gh1 gene are: gh1-actb F2 (SEQ ID NO: 16): tataaggcaatagtgaggctg; gh1-actb R2 (SEQ ID NO: 17): gattcaccagcaaactaacca.
[0072] like Figure 1As shown, positive bands of chromosomal translocation were detected in zebrafish embryo samples from the RNP injection group; sequencing results showed that the expected β-actin promoter-initiated translocation event of the gh1 gene occurred after editing between the gh1 and β-actin gene target sites in zebrafish, and the zebrafish gh1 highly expressed gene sequence is shown in SEQ ID NO: 22.
[0073] In addition, zebrafish whose β-actin-gh1 gene translocation was verified by sequencing were crossbred with wild-type zebrafish (see [link]). Figure 3 The offspring were cultured under the same conditions, including the same growth environment and feeding conditions. Positive offspring fish were also tested by PCR (see...). Figure 2 ) and sequencing verification. Average body weight and length were measured at 40, 60, and 90 days post-fertilization, and growth curves were plotted as follows: Figure 4 As shown, the size difference between zebrafish with high gh1 knockout and wild-type zebrafish of the same period was compared (e.g., Figure 5-1 As shown in the figure, the results indicated that, compared with the wild type, the body length and weight of β-actin-gh1 positive fish were significantly increased. Simultaneously, we examined the expression level of the gh1 gene in different genotypes, and the results showed that, compared with the wild type, the mRNA level of gh1 in β-actin-gh1 positive fish was significantly increased. Figure 5-2 The results in summary indicate that zebrafish expressing the gh1 gene via the β-actin promoter exhibit significantly faster growth.
[0074] Example 2: Creating a gh1 overexpression gene in rainbow trout
[0075] Based on the rainbow trout genome information, target sites were designed to obtain gh1 highly expressed genes β-actin-gh1 and α-actin-gh1 with promoter translocations of β-actin (Gene ID: 100135845) and "actin,alpha skeletal muscle 2" (Gene ID: 110499273). The specific steps are as follows: a crRNA-gh1 target (SEQ ID NO: 11): 5'-acttgaaagtgcggtggtcggtt-3' was designed for the upstream sequence of the start codon of the rainbow trout gh1 gene; a crRNA1-β-actin target (SEQ ID NO: 12): 5'-ttttgtttcagttcaaaatggaa-3' and a crRNA2-β-actin target (SEQ ID NO: 13): 5'-acatgcagactgtagagtagagt-3' were designed for the upstream sequence of the start codon of the rainbow trout β-actin gene.
[0076] Simultaneously, crRNA-gh1 target (SEQ ID NO: 11): 5'-acttgaaagtgcggtggtcggtt-3' was designed upstream of the start codon of the rainbow trout gh1 gene, and crRNA1-α-actin target (SEQ ID NO: 25): 5'-gtatcctttcccagatctgtacc-3' and crRNA2-α-actin target (SEQ ID NO: 26): 5'-cccaccattgagaatgtctacgt-3' were designed upstream of the start codon of the rainbow trout α-actin gene.
[0077] GenScript Biotech was commissioned to synthesize the corresponding crRNA. The synthesized crRNA was then mixed with purified KingCas12 (SEQ ID NO: 24) protein in a 1:1 ratio to prepare two sets of RNP samples.
[0078] The above samples were microinjected into artificially inseminated rainbow trout embryos. The injected embryos were then incubated in a rainbow trout hatching system at a water temperature of 10℃. DNA was extracted from tail fin samples of surviving rainbow trout approximately 2-3 months after injection, and PCR was performed using corresponding primers. Positive bands were sent for sequencing verification. Specifically, primers BG-F (SEQ ID NO: 18): gggagtttataaaatggcggcc and BG-R (SEQ ID NO: 19): ttctatcgctgccccttgac were used to amplify the interface between the β-actin promoter (SEQ ID NO: 4) and gh1 (nucleotide sequence SEQ ID NO: 6, amino acid sequence SEQ ID NO: 7); primers GB-F (SEQ ID NO: 20): ccttacaccgacacgtacatg and GB-R (SEQ ID NO: 21): ggccctatacagagcacagc were used to amplify the interface between gh1 and the β-actin promoter. PCR results are shown below. Figure 6 Sequencing confirmed that the β-actin promoter translocation was successful, and the gh1 high-expression gene sequence in rainbow trout is shown in SEQ ID NO: 23.
[0079] Primers used for amplifying the α-actin promoter (SEQ ID NO: 5) interface with gh1 were AG-F (SEQ ID NO: 27): accctaaaaccccaagcagc and AG-R (SEQ ID NO: 28): ttctatcgctgccccttgac; primers used for amplifying the gh1 interface with α-actin were GA-F (SEQ ID NO: 29): ccgtctcgagtccttctctg and GA-R (SEQ ID NO: 30): aatcacccatggactgtttca. PCR results are shown below. Figure 7 Sequencing confirmed that the α-actin promoter translocation was successful.
[0080] Two groups of positive and wild-type rainbow trout were collected separately, and their body weights were measured. ANOVA analysis was performed using SPSS. Figure 8 As shown; and the body size differences between β-actin-gh1 knockout rainbow trout and wild-type trout of the same period were compared (e.g. Figure 9 (As shown in the image). The results showed that, compared with the wild type and the α-actin-gh1 genotype, the β-actin-gh1 positive fish had a significantly increased body weight.
[0081] Rainbow trout with β-actin-gh1 knockout were bred, and the positive offspring were subjected to gh1 gene expression and phenotypic analysis. The results showed that gh1 gene expression and body weight were significantly increased compared to wild-type.
[0082] All publications and patent applications mentioned in the specification are incorporated herein by reference as if each publication or patent application were individually and specifically incorporated herein by reference.
[0083] Although the invention has been described in considerable detail by way of example and embodiments for clarity, it will be apparent that certain changes and modifications may be made within the scope of the appended claims, and all such changes and modifications are within the scope of the invention.
Claims
1. A method of increasing the growth rate of fish, characterized in that, The method comprises the following steps: The coding region of the gh1 gene is fused with a strong promoter of another endogenous high-expression gene in vivo to generate a gh1 high-expression gene without introducing an exogenous gene, and the strong promoter is the β-actin gene promoter.
2. An editing method for knocking up expression of an endogenous gh1 gene in fish, characterized in that, The method comprises the following steps: The coding region of the gh1 gene is fused with a strong promoter of another endogenous high-expression gene in vivo to generate a gh1 high-expression gene without introducing an exogenous gene, and the strong promoter is the β-actin gene promoter.
3. The method according to claim 1 or 2, characterized in that, The method comprises the following steps: DNA breaks are simultaneously generated at two different specific positions in the genome of the organism, which are the genomic sites between the coding region of the gh1 gene and its promoter and the genomic sites between the coding region of the β-actin gene and its promoter, and then connected to each other through intracellular repair pathways to fuse the coding region of the gh1 gene with the promoter of the β-actin gene in vivo, thereby generating a gh1 high-expression gene; Or, DNA breaks are simultaneously generated at three different specific positions in the genome of the organism, which are two genomic sites capable of cutting out a β-actin gene promoter fragment and the genomic site between the coding region of the gh1 gene and its promoter, and then connected to each other through intracellular repair pathways to generate a translocation editing event of the β-actin gene promoter fragment inserted upstream of the coding region of the gh1 gene, thereby generating a gh1 high-expression gene; Or, DNA breaks are simultaneously generated at three different specific positions in the genome of the organism, which are two genomic sites capable of cutting out a β-actin gene promoter fragment and the genomic site between the coding region of the gh1 gene and its promoter, and then connected to each other through intracellular repair pathways to generate a translocation editing event of the β-actin gene promoter fragment inserted upstream of the coding region of the gh1 gene, thereby generating a gh1 high-expression gene.
4. The method of claim 3, wherein, The method further comprises the following steps: designing a primer pair capable of specifically distinguishing the new combination of the above gene elements for the combination of the above specific positions, screening cells or tissues containing the gh1 high-expression gene by PCR, and sequencing to determine the characteristic sequence of the new combination of gene elements; preferably, the primer pair is selected from any one of the following groups: SEQ ID NO: 14 and SEQ ID NO: 15, SEQ ID NO: 16 and SEQ ID NO: 17, SEQ ID NO: 18 and SEQ ID NO: 19, and SEQ ID NO: 20 and SEQ ID NO:
21.
5. The method of claim 3, wherein, The DNA breaks are performed by Meganuclease, Zincfinger nuclease, TALEN or CRISPR / Cas system; preferably, the system is CRISPR / Cas9 or CRISPR / KingCas12 system.
6. The method according to any one of claims 1 to 5, characterized in that, The sequence of the gh1 high-expression gene is shown in SEQ ID NO: 22 or SEQ ID NO:
23.
7. The method according to any one of claims 1 to 6, characterized in that, The nucleic acid sequence of the strong promoter is shown in SEQ ID NO: 1 or SEQ ID NO:
4.
8. The method according to any one of claims 1 to 7, characterized in that, The gh1 gene is a nucleotide encoding the amino acid sequence of SEQ ID NO: 3 or SEQ ID NO: 7; preferably, the nucleotide sequence is shown in SEQ ID NO: 2 or SEQ ID NO:
6.
9. The method according to any one of claims 1 to 8, characterized in that, The fish exhibits at least one of the following characteristics: increased muscle mass, increased muscle weight, increased condition factor, increased growth rate, increased food conversion rate, increased fillet weight, or increased fillet yield; preferably, the fish comprises salmon; more preferably, the fish is rainbow trout or zebrafish.
10. A fish having a gh1 high expression gene or the nucleic acid sequence of the gene is shown in SEQ ID NO: 22 or SEQ ID NO:
23.
11. A target sequence designed for increasing the growth rate of fish or knocking up the expression of an endogenous gh1 gene in fish, characterized in that, The target sequence is shown in SEQ ID NO: 8, SEQ ID NO: 9, and SEQ ID NO: 10, and the reverse complement thereof; or shown in SEQ ID NO: 11, SEQ ID NO: 12, and SEQ ID NO: 13, and the reverse complement thereof.