CAR-NK cell for treating glioma as well as application and composition of CAR-NK cell

Abstract

The invention provides a CAR (Chimeric Antigen Receptor)-NK (Natural Killer) cell of glioma. The CAR-NK cell is prepared by the following steps: constructing a pMFG-EGFRvIII-CAR plasmid vector, preparing an anti-EGFRvIII-CAR retroviral vector, and preparing an anti-EGFRvIII-CAR-NK cell. The EGFRvIII-CAR-NK cell has strong killing activity to the U87-EGFRvIII cell, and the killing activity is obviously higher than that of the NK cell, so that the EGFRvIII-CAR-NK is proved to enhance the targeting capability and the killing activity of the EGFRvIII-CAR-NK cell.

Description

Technical Field

[0001] This invention relates to the field of cell therapy, and more particularly to CAR-NK cells for the treatment of gliomas, their applications, and compositions. Background Technology

[0002] In recent years, chimeric antigen receptor-engineered T (CAR-T) cells have shown considerable success in treating hematologic malignancies, but their application in solid tumors has been limited. This is related to the limitations of CAR-T cell therapy, such as antigen escape, off-target effects, and CAR-T cell-related toxicity. NK cells are core cells of the innate immune system. Similar to CAR-T therapy, CAR-NK therapy was initially used to treat various hematologic malignancies, such as leukemia, myeloma, and lymphoma. Specifically, compared to CAR-T therapy, CAR-NK cells have the advantage of lower immune escape probability. Unlike CAR-T cells, CAR-NK cells retain the intrinsic ability to target tumor cells and recognize natural receptors. Therefore, the likelihood of tumor cells escaping immunely during treatment is lower; their anti-cancer killing power is doubled. Compared to T cells, NK cells do not require antigen presentation to fight on the front line of cancer, resulting in a faster onset of action. CAR-NK cells not only retain the advantages of NK cells as the "vanguard" in cancer treatment, but also assist T cells in recognizing tumor antigens and killing specific cancer cells. They are also cheaper and faster to produce; CAR-NK cells do not require strict HLA matching and do not cause graft-versus-host disease. Therefore, the preparation process eliminates the need to extract T cells from patients and then expand them in vitro. This means that "off-the-shelf" CAR-NK cells are cheaper than CAR-T cells and significantly shorten treatment time, potentially benefiting more patients. Furthermore, they have fewer side effects; CAR-NK cells do not cause immune rejection within days to weeks, and no adverse reactions such as cytokine release syndrome have been observed in multiple clinical trials.

[0003] However, the preparation of CAR-NK cells still faces many challenges, primarily in NK cell culture and expansion, as well as CAR transfection. NK cells can be obtained from peripheral blood or umbilical cord blood, and current culture methods mainly include feeder cell culture and cytokine culture. However, the use of serum and feeder cells may introduce potential contamination risks, requiring careful selection and use. The most mature method for CAR transduction is currently viral vectors, including lentiviral vectors, retroviral vectors, and adeno-associated virus vectors. Compared to the characteristics of lentiviral vectors—instantaneous packaging systems, large plasmid usage, complex purification processes, and low viral vector titers (requiring concentration)—retroviral vectors offer advantages in industrial production, such as the ability to prepare stable toxin-producing cell lines, lower plasmid usage, lower impurity levels, and higher viral vector titers.

[0004] Epidermal growth factor receptor (EGFR) is a transmembrane glycoprotein belonging to the ErbB receptor tyrosine kinase family. Overexpression, mutation, or high expression of its binding ligands in these family members can lead to various cancers, such as non-small cell lung cancer, breast cancer, head and neck cancer, cervical cancer, bladder cancer, gastric cancer, and ovarian cancer. EGFRvIII variants are oncogenic mutations that have been reported in various cancers, including glioblastoma multiforme, breast cancer, lung cancer, head and neck cancer, ovarian cancer, and prostate cancer. Studies have shown that EGFRvIII is highly expressed or aberrantly expressed in many solid tumors, making it a promising therapeutic target. Summary of the Invention

[0005] To address the aforementioned problems, this invention provides CAR-NK cells for treating gliomas. The CAR-NK cells are prepared via the following method: Step 1, constructing the pMFG-EGFRvⅢ-CAR plasmid vector: Designing a CAR vector sequence targeting the epidermal growth factor receptor EGFRvⅢ, which sequentially connects a signal peptide region, an antigen-binding domain targeting EGFRvⅢ, a CD8 hinge region, an NKG2D transmembrane domain, a 2B4 intracellular co-stimulatory factor domain, and a CD3ζ signal transduction domain from the amino terminus to the carboxyl terminus. Inserting this gene fragment between the xhoI and NotI restriction sites of the retroviral vector pMFG plasmid yields the pMFG-EGFRvⅢ-CAR plasmid vector; Step 2, ant... Preparation of i-EGFRvⅢ-CAR retroviral vector: The pMFG-EGFRvⅢ-CAR plasmid vector was transfected into Phoenix-Ampho cells and the cell supernatant was collected to harvest the troponin retroviral vector. The vector was then mixed with BaEV-WT cells to obtain a stable BaEV retroviral vector-packaged cell line. The culture supernatant of the stable BaEV-WT retroviral vector-transfected cell line was collected, which is the final anti-EGFRvⅢ-CAR retroviral vector. Step 3, preparation of anti-EGFRvⅢ-CAR-NK cells: The anti-EGFRvⅢ-CAR retroviral vector was transduced into NK cells to prepare anti-EGFRvⅢ-CAR-NK cells.

[0006] In one embodiment, the EGFRvⅢ-VH sequence of the EGFRvⅢscFv targeting the antigen-binding domain of EGFRvⅢ is SEQ ID NO:1; and the EGFRvⅢ-VL sequence of the EGFRvⅢscFv targeting the antigen-binding domain of EGFRvⅢ is SEQ ID NO:2.

[0007] In one embodiment, the EGFRvIII chimeric antigen receptor is sequentially linked from the amino terminus to the carboxyl terminus to a signal peptide region, an EGFRvIII-targeting antigen-binding domain, a CD8 hinge region, an NKG2D transmembrane domain, a 2B4 intracellular co-stimulatory factor domain, and an intracellular signal transduction molecule CD3ζ signal transduction domain.

[0008] In one embodiment, the EGFRvⅢ-VH sequence of the EGFRvⅢscFv targeting the antigen-binding domain of EGFRvⅢ is SEQ ID NO:1; and the EGFRvⅢ-VL sequence of the EGFRvⅢscFv targeting the antigen-binding domain of EGFRvⅢ is SEQ ID NO:2.

[0009] In one embodiment, an isolated nucleic acid is provided, the isolated nucleic acid comprising a nucleotide sequence for targeting the EGFRvⅢ chimeric antigen receptor as described above.

[0010] In one embodiment, a recombinant vector is provided, the recombinant vector comprising the isolated nucleic acid described above.

[0011] In one embodiment, the above-described CAR-NK cells are provided for use in the preparation of a drug for the treatment of glioma.

[0012] In one embodiment, the above-described targeting of the EGFRvⅢ chimeric antigen receptor is provided in the preparation of a medicament for the treatment of glioma.

[0013] In one embodiment, the above-described recombinant vector is provided for use in the preparation of a medicament for the treatment of glioma.

[0014] In one embodiment, a pharmaceutical composition for treating glioma is provided, comprising the above-described CAR-NK cells, the above-described EGFR-targeting chimeric antigen receptor, the above-described isolated nucleic acid, or the above-described recombinant vector, and a pharmaceutically acceptable carrier, diluent, or excipient.

[0015] In one embodiment, a method for inhibiting glioma cells in vitro is provided, comprising contacting glioma cells with the aforementioned CAR-NK cells or the aforementioned pharmaceutical composition to inhibit the glioma cells.

[0016] In this invention, when the human glioblastoma cell line U87-EGFRvⅢ was used as the target cell, the killing efficiency of anti-EGFRvⅢ CAR-NK cells against the specific target cells U87-EGFRvⅢ was significantly higher than that of unmodified NK cells. After co-incubating anti-EGFRvⅢ CAR-NK cells and U87-EGFRvⅢ cells for 24 hours, the expression levels of pro-inflammatory cytokines IFN-γ and TNF-α, granzyme, and perforin PRF1 were significantly higher than those of NK cells, indicating that anti-EGFRvⅢ CAR-NK cells have enhanced anti-tumor function against specific target cells. EGFRvⅢ-CAR-NK cells exhibited strong killing activity against U87-EGFRvⅢ cells, significantly higher than that of NK cells, demonstrating that EGFRvⅢ-CAR-NK enhances its targeting ability and killing activity. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of this application, the accompanying drawings used in the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments recorded in this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1 This is a schematic diagram of the structure of the retroviral vector in this invention;

[0019] Figure 2 This is a graph showing the results of flow cytometry analysis of the transduction positivity rate of BaEV retroviral vector packaging cell lines;

[0020] Figure 3 This is a graph showing the CAR-NK transduction positivity rate (48h).

[0021] Figure 4 This is a graph showing the CAR-NK transduction positivity rate (13 days).

[0022] Figure 5 This is a graph showing the results of in vitro detection of anti-EGFRvⅢ-CAR-NK cells killing target cells by an RTCA analyzer. Figure 5 A represents U87 cells as target cells and NK cells as effector cells. Figure 5 B consists of U87 target cells and anti-EGFRvIII-CAR-NK cells as effector cells. Figure 5 C represents U87-EGFRvⅢ cells as target cells and NK cells as effector cells. Figure 5 D represents U87-EGFRvⅢ cells as target cells and anti-EGFRvⅢ-CAR-NK cells as effector cells;

[0023] Figure 6 This is a graph showing the results of the lactate dehydrogenase release assay (LDH) to detect the in vitro killing effect of anti-EGFRvⅢ-CAR-NK cells on target cells.

[0024] Figure 7 This is a graph showing the results of ELISA detection of TNF-α, PRFI, IFN-γ, and Granzyme expression levels after co-incubation of anti-EGFRvⅢ-CAR-NK cells and target cells. Figure 7 A is the result graph for TNF-α. Figure 7 B is the IFN-γ result graph. Figure 7 C is the PRF1 result image. Figure 7 D is the Granzyme result image. Detailed Implementation

[0025] To enable those skilled in the art to better understand the technical solutions in this application, the present invention will be further described below with reference to embodiments. Obviously, the described embodiments are only some embodiments of this application, and not all embodiments. Based on the embodiments in this application, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of this application.

[0026] Example 1: Construction of CAR expression plasmid

[0027] The CAR vector (anti-EGFRvⅢ-CAR) sequence designed in this invention, targeting the epidermal growth factor receptor EGFRvⅢ, comprises the EGFRvⅢ scFv sequence, the CD8 hinge region and transmembrane segment, the NKG2D intracellular co-stimulatory domain, the intracellular signal transduction molecule CD3ζ, and an mCherry gene fragment linked by a P2A self-cleaving peptide. A schematic diagram of the gene element structure is shown below. Figure 1 .

[0028] The EGFRvⅢscFv sequence was synthesized, and the gene fragment was inserted between the xhoI and NotI restriction sites of the retroviral vector pMFG plasmid to construct the pMFG-EGFRvⅢ-CAR vector. Sequencing verified that the sequence was correct.

[0029] EGFRvⅢscFv sequence:

[0030] EGFRvⅢ-VH (SEQ ID NO:1):

[0031] GAGGTCCAGGTGCTGGAATCTGGCGGCGGACTGGTGCAGCCTGGCGGCAG

[0032] CCTGAGACTGAGCTGTGCCGCCAGCGGCTTCACCTTCAGCAGCTACGCCA

[0033] TGTCTTGGGTCCGGCAGGCTCCTGGAAAGGGCCTGGAATGGGTGTCCGCC

[0034] ATCAGCGGCTCTGGCGGCTCCACCAACTACGCCGACAGCGTGAAGGGCCG

[0035] GTTCACCATCAGCCGGGACAACAGCAAGAACACCCTGTATCTGCAGATGA

[0036] ACAGCCTGAGAGCCGAGGACACCGCCGTGTACTACTGTGCCGGCAGCAGC

[0037] GGGTGGAGCGAGTACTGGGGCCAGGGCACACTGGTCACAGTGTCTAGCEGFRvIII-VL (SEQ ID NO: 2):

[0038] GACATCCAGATGACCCAGAGCCCTAGCAGCCTGAGCGCCAGCGTGGGCG

[0039] ACAGAGTGACCATCACCTGTCGGCCAGCCAGGGCATCAGAAACAACCTG

[0040] GCCTGGTATCAGCAGAAGCCCGGCAAGGCCCCCAAGAGACTGATCTACGC

[0041] TGCCAGCAATCTGCAGAGCGGCGTGCCCAGCAGATTCACCGGAAGCGGCT

[0042] CCGGCACCGAGTTCACCCTGATCGTGTCCAGCCTGCAGCCCGAGGACTTC

[0043] GCCACCTACTACTGCCTGCAGCACCACAGCTACCCTCTGACCAGCGGCGG

[0044] AGGCACCAAGGTGGAGATCAAG

[0045] The CD8 hinge region, NKG2D transmembrane segment, 2B4 intracellular costimulatory factor domain, and the amino acid sequence of the intracellular signal transduction molecule CD3ζ and the P2A self-cleaving peptide are commonly used sequences in this field, such as CN 118290596 A, which will not be elaborated upon here.

[0046] Example 2: Preparation of Retroviral Vectors

[0047] A two-step method was used to construct the BaEV-EGFRvⅢ-CAR toxin-producing cell line. Cell lines were packaged sequentially using Phoenix-Ampho and BaEV-WT retroviral vectors. The pMFG-EGFRvⅢ-CAR plasmid was transfected into Phoenix-Ampho cells, and the cell supernatant was collected to harvest the troponin-dependent retroviral vector. This supernatant was then mixed with BaEV-WT cells, and horizontal centrifugation was used to promote retroviral vector transduction into BaEV cells, resulting in a stable BaEV retroviral vector-packaged cell line. Flow cytometry analysis showed a BaEV-EGFRvⅢ-CAR positivity rate of 81.69% (…). Figure 2 The supernatant from the culture of the BaEV-WT retroviral vector-stabilized cell line was collected, which became the final anti-EGFRvⅢ-CAR retroviral vector.

[0048] Example 3: Preparation and Biotiter Detection of Retroviruses

[0049] BaEV-EGFRvⅢ-CAR cells were expanded into T75 culture flasks and incubated at 32°C for toxin production. Cell culture supernatants were collected at 24h, 48h, 72h, and 96h, filtered through a 0.45μm filter membrane, and labeled as H1-H4.

[0050] 293T cells were seeded into 24-well plates, with 2 × 10⁻⁶ cells per well. 5 Cells were collected. After 24 hours, the cell culture medium was discarded, 500 μL of the virus to be tested was added, followed by 1 μg / mL of polybrene. The cells were centrifuged at 2500 rpm for 1 hour at 32°C. The cells were then incubated at 37°C for further culture. Fresh culture medium was added 24 hours after virus transduction. After 48 hours, the transduction efficiency was calculated by flow cytometry using the mCherry positivity rate. The flow cytometry positivity rate of anti-EGFRvⅢ-CAR retrovirus infection of 293T was 6.45% (H3). Viral titer was calculated as follows: Viral titer (TU / mL) = number of infected cells × percentage of positive cells / volume of original virus solution. The anti-EGFRvⅢ-CAR retrovirus vector titers are shown in Table 1.

[0051] Table 1

[0052] Positive rate Titration (TU / mL) H3 6.45％ 1.66E6

[0053] Example 4: Retrovirus transduction of NK cells

[0054] 1. NK cell sorting and purification

[0055] NK cells were purified from human peripheral blood mononuclear cells (PBMCs) using magnetic bead sorting and then activated and expanded. Anti-EGFRvIII-CAR-NK cells were prepared by transducing NK cells using an anti-EGFRvIII-CAR retroviral vector.

[0056] 2. Transducing NK cells

[0057] Add 1 mL of RetroNectin (10 μg / mL) to each well of a 12-well plate (without tissue treatment). Incubate overnight at 4°C, protected from light. The next day, remove the RetroNectin solution and wash with PBS. Dilute the viral vector 1:2 using culture medium. Add 1 mL of the above anti-EGFRvⅢ-CAR retroviral vector to each coated 12-well plate, centrifuge at 2500 rpm for 1 h at 32°C, and remove the viral supernatant from the wells. Take 4 × 10⁴ cells / well. 5 Activated NK cells were resuspended in 1 mL of anti-EGFRvⅢ-CAR retroviral vector, and the cell suspension was added to the corresponding wells, along with polybrene (final concentration 6 μg / mL). The 12-well plates were centrifuged at 32°C, 2500 rpm for 1 h, and then incubated at 37°C for 2 h. The supernatant was discarded, and the corresponding retroviral vector (containing polybrene) was added. The plates were then centrifuged at 32°C, 2500 rpm for 1 h. After centrifugation, the cells were incubated at 37°C for 2 h. The supernatant was discarded, and the cells were resuspended in 1 mL of fresh NK cell complete culture medium and cultured further.

[0058] 3. Detection of positive rate of transduction

[0059] 48 hours after transduction, take 2×10 5 The transduction efficiency of NK cells after transduction was detected by flow cytometry. The transduction efficiency of anti-EGFRvⅢ-CAR-NK was 55.6%. Figure 3 As shown, after 13 days of culture, the transduction efficiency of NK cells was re-measured by flow cytometry. The anti-EGFRvⅢ-CAR-NK transduction efficiency was 56.15%. Figure 4 As shown.

[0060] Example 5: In vitro antitumor function of CAR-NK cells

[0061] 1. Real-time label-free dynamic cell analysis (RTCA) experiment

[0062] NK and anti-EGFRvⅢ-CAR-NK cells were used as effector cells, and U87 cells and U87-EGFRvⅢ cells were used as target cells. 50 μL of the culture medium for the target cells was added to each well of a 16-well E-Plate plate and incubated at 37°C for 5-10 min. Baseline values ​​were then measured. 100 μL of cells were collected from each group at a density of 5 × 10⁶ cells / well. 4 Target cells were seeded at a concentration of / mL into 16-well E-Plate plates. After standing for 10 min, the plates were placed in an RTCA analyzer to observe the target cell proliferation curve. When the target cells were in the logarithmic growth phase and the resistivity was approximately 1, the E-Plate plates were removed. 100μL of effector cells were added to each well of each group at different effector-to-target ratios (E:T = 0:1 / 1:1 / 2:1 / 3:1) for co-culture. Wells with an E:T = 0:1 ratio were treated with the same volume of effector cell culture medium. The E-Plate plates were then placed back into the RTCA analyzer, and data were recorded every 15 min for 3-4 days to observe the effect of effector cells on target cell proliferation.

[0063] The results are as follows Figure 5 As shown, Figure 5 A represents U87 cells as target cells and NK cells as effector cells. Figure 5 B consists of U87 target cells and anti-EGFRvIII-CAR-NK cells as effector cells. Figure 5 C represents U87-EGFRvⅢ cells as target cells and NK cells as effector cells. Figure 5 D represents U87-EGFRvⅢ cells as target cells and anti-EGFRvⅢ-CAR-NK cells as effector cells. When only target cells were present (E:T = 0:1), the growth curve of the target cells was observed. The cell index of the target cells showed an increasing trend over time, especially with U87 cells overexpressing EGFRvⅢ showing a significantly higher index than untransfected U87 cells, further verifying that EGFRvⅢ overexpression promotes U87 cell proliferation. When the cell index of the target cells was approximately 1, effector cells were added. As the effector-to-target ratio increased, the cell index gradually decreased. Compared to NK cells and U87 cells, the cell index of CAR-NK cells targeting U87-EGFRvⅢ was significantly lower than the control group, indicating that CAR-NK cells targeting EGFRvⅢ have a strong killing effect on EGFRvⅢ-positive U87 cells.

[0064] 2. Lactate Dehydrogenase (LDH) Release Assay

[0065] NK and anti-EGFRvⅢ-CAR-NK cells were used as effector cells, and U87 cells and U87-EGFRvⅢ cells were used as target cells. 100 μL of cells at a density of 5 × 10⁻⁶ cells were used. 4Target cells were seeded at 100 cells / ml in a 96-well plate, and 100 μL of target cell culture medium was added to the blank wells. Add 100 μL of PBS to the surrounding area to prevent evaporation of the culture medium, and place the 96-well plate in a cell culture incubator at 37°C with 5% CO2. After 24 hours of culture, add 100 μL of effector cells at different effector-to-target ratios (E:T = 0:1 / 1:1 / 2:1 / 3:1) for co-culture. Add 100 μL of effector cell culture medium to the blank wells and control wells. After 7 hours of culture, remove the 96-well plate, add 10% LDH release reagent to the "target cell maximum enzyme activity control well", and continue incubation in the cell culture incubator for 1 hour. After incubation, centrifuge the cell culture plate at 400g for 5 minutes using a multi-well centrifuge, and take 120 μL of the supernatant from each well and transfer it to a new 96-well plate. Prepare the LDH detection working solution according to the Beyotime LDH detection kit instructions, add 60 μL of LDH detection working solution to each well, mix well, and incubate at room temperature on a horizontal shaker in the dark for 30 minutes. Measure the OD value of each well at a wavelength of 490 nm using a microplate reader.

[0066] The results are as follows Figure 6 As shown, the lysis rate of target cells gradually increased with the increase of the effector-to-target ratio, indicating that the lysis rate of target cells was dose-dependent. At an effector-to-target ratio of E:T = 3:1, the lysis rate of CAR-NK cells on target cells was significantly higher than that of NK cells, especially in U87-EGFRvIII cells. The lysis rate of CAR-NK cells was (71.41±0.14)%, while that of NK cells was (43.45±0.81)%, and the difference between the two groups was statistically significant (P<0.01). This further demonstrates that the cytotoxic effect of EGFRvIII-CAR NK cells in U87-EGFRvIII cells is superior to that of NK cells.

[0067] Example 6: Detection of CAR-NK cytokine secretion

[0068] NK and anti-EGFRvⅢ-CAR-NK cells were used as effector cells, and U87 cells and U87-EGFRvⅢ cells were used as target cells. 100 μL of cells were collected at a density of approximately 5 × 10⁻⁶ cells. 4Target cells were seeded at a density of 10 cells / ml in 24-well plates and cultured in a cell culture incubator at 37°C with 5% CO2. The next day, effector cells were added at different effector-to-target ratios (E:T = 0:1 / 1:1 / 2:1 / 3:1) for co-culture. After 24 hours of culture, the supernatant from the cell co-culture was collected. The ELISA plate was then set up with standard wells, blank wells, and sample wells. 100 μL of serially diluted standard was added to the standard wells, 100 μL of standard dilution was added to the blank wells, and 100 μL of the sample to be tested was added to the sample wells. After adding the samples, the ELISA plate was sealed and incubated at 37°C for 90 minutes. After incubation, the liquid in the plate was discarded and the plate was patted dry. 10 μL of the sample was added to each well. Add 0 μL of biotinylated antibody working solution A, seal the ELISA plate, and incubate at 37°C for 1 hour. Discard the liquid in the wells and pat dry. Add 350 μL of washing buffer to each well and soak for 1 minute. Repeat washing 3 times. Add 100 μL of enzyme conjugate working solution B to each well, seal the ELISA plate, and incubate at 37°C in the dark for 30 minutes. Wash 5 times. Add 90 μL of chromogenic substrate TMB to each well, seal the ELISA plate, and incubate at 37°C for 15-30 minutes. Add 50 μL of stop solution to each well. Immediately use an ELISA reader to detect the OD value of each well at 450 nm. Calculate the concentration of cytokines in the sample by plotting a standard curve.

[0069] The results are as follows Figure 7 As shown, Figure 7 A is the result graph for TNF-α. Figure 7 B is the IFN-γ result graph. Figure 7 C is the PRF1 result image. Figure 7 D is the Granzyme result diagram. After co-incubating anti-EGFRvⅢ-CAR-NK cells with U87 and U87-EGFRvⅢ cells for 24 h, the expression levels of pro-inflammatory cytokines IFN-γ and TNF-α, granzyme, and perforin PRF1 were significantly higher than those of NK cells, indicating that anti-EGFRvⅢ-CAR-NK cells have anti-tumor function against specific target cells.

[0070] Those skilled in the art will also recognize, or be able to identify, many equivalents of the specific embodiments of the invention described herein using no more than conventional experiments. These equivalents are also included in the appended claims.

Claims

1. A CAR-NK cell for treating glioma, characterized in that, The CAR-NK cells were prepared using the following method: Step 1: Constructing the pMFG-EGFRvⅢ-CAR plasmid vector: Design a CAR vector sequence targeting the epidermal growth factor receptor EGFRvⅢ. This sequence is connected sequentially from the amino terminus to the carboxyl terminus to the signal peptide region, the antigen-binding domain targeting EGFRvⅢ, the CD8 hinge region, the NKG2D transmembrane domain, the 2B4 intracellular co-stimulatory factor domain, and the CD3ζ signal transduction domain of the intracellular signal transduction molecule. Insert the above gene fragments between the xhoI and NotI restriction sites of the retroviral vector pMFG plasmid to obtain the pMFG-EGFRvⅢ-CAR plasmid vector. Step 2, Preparation of anti-EGFRvⅢ-CAR retroviral vector: The pMFG-EGFRvⅢ-CAR plasmid vector was transfected into Phoenix-Ampho cells and the cell supernatant was collected to harvest the troponin retroviral vector. This vector was then mixed with BaEV-WT cells to obtain a stable BaEV retroviral vector packaging cell line. The culture supernatant of the stable BaEV-WT retroviral vector-transfected cell line was collected, which is the final anti-EGFRvⅢ-CAR retroviral vector. Step 3, Preparation of anti-EGFRvⅢ-CAR-NK cells: The anti-EGFRvⅢ-CAR retroviral vector is transduced into NK cells to prepare anti-EGFRvⅢ-CAR-NK cells.

2. The CAR-NK cells according to claim 1, characterized in that, The EGFRvⅢ-VH sequence of EGFRvⅢscFv targeting the antigen-binding domain of EGFRvⅢ is SEQ ID NO:1; the EGFRvⅢ-VL sequence of EGFRvⅢscFv targeting the antigen-binding domain of EGFRvⅢ is SEQ ID NO:

2.

3. A method for targeting EGFRvⅢ chimeric antigen receptors, characterized in that, It is connected sequentially from the amino terminus to the carboxyl terminus to the signal peptide region, the antigen-binding domain targeting EGFRvⅢ, the CD8 hinge region, the NKG2D transmembrane domain, the 2B4 intracellular co-stimulatory factor domain, and the CD3ζ signal transduction domain of the intracellular signal transduction molecule.

4. The chimeric antigen receptor according to claim 3, characterized in that, The EGFRvⅢ-VH sequence of EGFRvⅢscFv targeting the antigen-binding domain of EGFRvⅢ is SEQ ID NO:1; the EGFRvⅢ-VL sequence of EGFRvⅢscFv targeting the antigen-binding domain of EGFRvⅢ is SEQ ID NO:

2.

5. An isolated nucleic acid, characterized in that, The isolated nucleic acid includes a nucleotide sequence for expressing the EGFRvⅢ chimeric antigen receptor as described in claim 3 or 4.

6. A recombinant vector, characterized in that, The recombinant vector comprises the isolated nucleic acid as described in claim 4.

7. The use of CAR-NK cells as described in any one of claims 1-2 in the preparation of a drug, characterized in that, The drug is used to treat gliomas.

8. The use of the EGFRvⅢ chimeric antigen receptor as described in any one of claims 3-4 in the preparation of a drug, characterized in that, The drug is used to treat gliomas.

9. The use of the recombinant vector as described in claim 6 in the preparation of a drug, characterized in that, The drug is used to treat gliomas.

10. A pharmaceutical composition for treating glioma, characterized in that, Includes CAR-NK cells as described in any one of claims 1-2, EGFR-targeting chimeric antigen receptors as described in any one of claims 3-4, isolated nucleic acids as described in claim 4, or recombinant vectors as described in claim 6, as well as pharmaceutically acceptable vectors, diluents, or excipients.

11. A method for inhibiting glioma cells in vitro, characterized in that, This includes contacting glioma cells with CAR-NK cells as described in any one of claims 1-2 or the pharmaceutical composition as described in claim 10, thereby inhibiting the glioma cells.

Images