Use of miR-4680-3p inhibitors
By discovering the abnormal expression of miR-4680-3p in ischemic stroke and developing corresponding inhibitors, the diagnostic and treatment challenges of ischemic stroke have been solved, and effective improvement and therapeutic effects on cell damage have been achieved.
Patent Information
- Application Number
- CN202610107116.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-27
- Publication Date
- 2026-04-07
- Estimated Expiration
- 2046-01-27
AI Technical Summary
Existing diagnostic and treatment methods for ischemic stroke (IS) have a short time window, are easily affected by subjective factors, lack standardized rapid diagnostic or prognostic assessment systems, and lack highly sensitive and specific miRNA combinations for clinical application.
We discovered and validated that miR-4680-3p is abnormally elevated in the plasma of patients with ischemic stroke, and developed miR-4680-3p inhibitors to improve cell damage caused by OGD/R treatment, reduce apoptosis rate and reactive oxygen species (ROS) levels by inhibiting its expression, for use in the preparation of drugs for the treatment of ischemic stroke.
It effectively reduces the increase in miR-4680-3p expression in cells caused by OGD/R treatment, improves cell viability, reduces apoptosis rate and ROS level, and has a significant therapeutic effect on ischemic stroke.
Smart Images

Figure CN121570486B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of biological medicine, and particularly relates to application of a miR-4680-3p inhibitor. BACKGROUND
[0002] Stroke is commonly known as apoplexy, and the definition of apoplexy is that the blood supply of brain tissue is interrupted to cause local or overall brain tissue damage, which can be caused by ischemia or hemorrhage. Ischemic stroke (IS) is the most common type of stroke, accounting for 87% of all stroke cases, and is a kind of brain tissue necrosis and corresponding nerve function defect caused by insufficient blood supply of brain tissue due to stenosis or occlusion of the blood supply artery of brain tissue.
[0003] At present, the diagnosis of IS mainly relies on clinical evaluation, supplemented by neuroimaging, and the diagnosis result is easily affected by individual experience and subjective judgment difference. Thrombolysis and thrombectomy in acute stage are the main treatment methods for IS at present, but because they have a short time window, most patients cannot receive timely treatment and appear irreversible ischemic injury of brain tissue. Therefore, exploring new strategies for effectively diagnosing and treating IS is still a hot issue in clinical and basic research.
[0004] MicroRNA (miRNA) can be detected in many liquids including blood, cerebrospinal fluid and the like, so miRNA has great potential as a new diagnostic, prognostic and therapeutic tool for stroke. miRNA is a small non-coding single-stranded RNA that plays a crucial role in health and disease. After transcription, miRNA regulates gene expression by regulating target messenger RNA (mRNA), thereby causing changes in target protein levels. miRNA can bind to the 3' untranslated region (UTR) of the target mRNA, leading to its degradation or inhibition of the transcription translation level. A single miRNA has the potential to regulate thousands of downstream target genes, thereby affecting the entire gene network and protein synthesis. Studies have shown that miRNA plays a key role in the neuropathological process triggered by stroke. Therefore, the level of miRNA after stroke can be evaluated as a clinical biomarker, and it can also provide in-depth understanding of the potential pathological mechanism of stroke. In addition, adjusting the level of specific miRNA indicates that this method can be used as a new therapeutic intervention measure for treating stroke. The OGD / R (oxygen glucose deprivation / reperfusion) cell model is the most core and classical in vitro experimental model for studying ischemic stroke. It directly simulates the key pathophysiological link in the occurrence of stroke, and provides an irreplaceable platform for revealing the disease mechanism and screening therapeutic drugs.
[0005] Although the potential of microRNA (miRNA) as a novel biomarker and therapeutic target has been revealed, there is no standardized, widely applicable clinical rapid diagnostic or prognostic evaluation system based on specific miRNA profiles. How to screen a combination of miRNAs with high sensitivity and specificity and convert it into a reliable diagnostic / prognostic tool is a key technical bottleneck. SUMMARY
[0006] The purpose of the present application is to find and discover miRNA markers related to the treatment of ischemic stroke (IS). The inventors of the present application found that the expression of miR-4680-3p in the plasma of IS patients was abnormally increased in the study of the pathogenesis of IS. Through further cell experiments, it was found that inhibiting the expression of miR-4680-3p can effectively improve the adverse effects of OGD / R treatment on cell viability, apoptosis, and ROS, and has a significant therapeutic effect on IS. OGD / R-induced cell damage is often used as a classic model of in vitro stroke in research.
[0007] The miR-4680-3p inhibitor described in the present application is used for preparing a drug for treating ischemic stroke, and the nucleotide sequence thereof is as follows: UAACAACUCUUACAAUUCAGA.
[0008] The beneficial effects of the present application are:
[0009] Transfecting the neuron cells with the miR-4680-3p inhibitor in advance can effectively reduce the increase in the expression level of miR-4680-3p in the cells caused by OGD / R treatment, can effectively increase the decrease in cell viability caused by OGD / R treatment (P<0.001), can effectively reduce the increase in the apoptosis rate of the cells caused by OGD / R treatment (P<0.001), and can effectively reduce the increase in ROS caused by OGD / R treatment (P<0.001). Inhibiting the expression of miR-4680-3p can effectively improve the adverse effects of OGD / R treatment on cell viability, apoptosis, and ROS, and has a significant therapeutic effect on IS. BRIEF DESCRIPTION OF DRAWINGS
[0010] Figure 1 The expression of miR-4680-3p in the plasma of the control group is shown in Figure 1. ### P<0.001 compared with the control group;
[0011] Figure 2 The effect of the miR-4680-3p inhibitor on the expression of miR-4680-3p in the neuron cells treated by OGD / R is shown in Figure 2. ## P<0.01 compared with the control group; *** P<0.001 compared with the model group;
[0012] Figure 3 A comparative diagram showing the effects of miR-4680-3p inhibitors on the effects of OGD / R treatment on neuronal cell viability. #### This indicates that compared with the control group, p < 0.0001; *** (This indicates that p < 0.001 compared to the model group)
[0013] Figure 4 A comparative diagram showing the effect of miR-4680-3p inhibitors on OGD / R-induced neuronal apoptosis. #### This indicates that compared with the control group, p < 0.0001; *** (Indicates p < 0.01 compared to the model group).
[0014] Figure 5 A comparative diagram showing the effects of miR-4680-3p inhibitors on reactive oxygen species (ROS) induced by OGD / R treatment in neurons. #### This indicates that compared with the control group, p < 0.0001; *** This indicates that p < 0.001 compared to the model group. Detailed Implementation
[0015] The present invention will be further described below with reference to embodiments, but this is not intended to limit the present invention in any way. Any modifications or substitutions made based on the teachings of the present invention shall fall within the protection scope of the present invention.
[0016] 1. Expression characteristics and clinical significance of miR-4680-3p in IS patients
[0017] 1.1 Main reagents and consumables
[0018] Reagent name Company miRcute miRNA Isolation Kit Tiangen Chloroform Xilong Scientific Anhydrous ethanol Xilong Scientific miRNA cDNA First-Strand Synthesis Kit Tiangen miRNA Fluorescent Quantitative Detection Kit (SYBR Green) Tiangen
[0019] 1.2 Main Instruments
[0020] Instrument name Company Vortex Mixer SCILOGEX High-Speed Refrigerated Centrifuge SCILOGEX Handheld Centrifuge SCILOGEX 96-Well Plate Centrifuge Its Linbail Water Bath Jintan Kexi Quantitative PCR Instrument Roche
[0021] 1.3 Experimental Methods
[0022] 1.3.1 Sample Collection
[0023] Plasma samples were collected from 5 patients with ischemic stroke and 5 healthy volunteers (control group) (a total of 10 subjects) as study subjects. Plasma sample preparation method: Approximately 4 mL of fasting peripheral venous blood was collected from the subjects. After collection, the plasma samples were stored in sodium citrate anticoagulant tubes, centrifuged (3000 rpm, 4℃, 10 min), and the plasma was immediately stored in a -80℃ freezer for later use.
[0024] 1.3.2 Primer Design and Synthesis
[0025] The corresponding sequence was obtained from the NCBI database, and the miR-4680-3p primer was designed. The primer was synthesized by Shanghai Sangon Biotech Co., Ltd. The primer sequence is as follows: miR-4680-3p Forward: 5'-TCTGAATTGTAAGAGTTGTTA-3'.
[0026] 1.3.3 miRNA extraction
[0027] Take 200 µL of plasma sample and extract miRNA from the plasma sample using the miRcute miRNA extraction and isolation kit.
[0028] 1.3.4 miRNA reverse transcription
[0029] The reverse transcription system was performed according to the miRNA-cDNA first-strand synthesis kit instructions.
[0030] Ingredient Volume 2x miRNA RT Reaction Buffer 10 μL miRNA RT Enzyme Mix 2 μL miRNA Sample 8 μL
[0031] Bring the total volume of the three reagents to 20 µL, gently shake, centrifuge for 3-5 s to mix the reactants, incubate at 42°C for 60 min, then at 95°C for 3 min to obtain the first strand of reverse-transcribed cDNA. Immediately place on ice or store at -20°C.
[0032] 1.3.5 qPCR detection of target gene expression
[0033] Following the instructions of the miRNA fluorescence quantitative detection kit, add the following reagents to each well of a 96-well PCR plate in the order of sample loading:
[0034] Ingredient Volume 2x miRcute Plus miRNA PreMix (SYBR & ROX) 5 μL Forward Primer 0.2 μL Reverse Primer (10 µM) 0.2 μL miRNA First-Strand cDNA 1 μL ddH2O 3.6 μL Total System 10 µL
[0035] The above system was thoroughly mixed, briefly centrifuged, and then placed in a LightCycler 96 instrument for detection. Amplification signals were collected. The following were the quantitative PCR conditions: pre-denaturation 95℃, 600s; 95℃: 5s, 60℃: 30s, 72℃: 30s, 45 cycles; melting curve analysis: 95℃: 15s; 60℃: 30s; 95℃: 1s. U6 was selected as an internal control. For the analysis of relative expression levels of the target gene, 2... -△△Ct The method is used for calculation.
[0036] 1.3.6 Statistical Analysis
[0037] The analysis and comparison were performed using GraphPad Prism 9.0.0. The two independent samples t-test was used to compare between groups, and P < 0.05 was considered statistically significant.
[0038] 1.4 Experimental results
[0039] The results are as Figure 1 shown. Compared with healthy volunteers (control group), the expression level of miR-4680-3p in the plasma of IS patients was significantly increased (p < 0.001).
[0040] 2. Protective effect of miR-4680-3p inhibitor on OGD / R-induced neuronal cell injury
[0041] 2.1 Main reagents and consumables
[0042] Reagent name Company DMEM High Glucose Medium Gibco Hanks' Balanced Salt Solution (HBSS) Gibco Papain Sigma DNase I Solebao Neurobasal-A Medium Gibco B-27 Supplement Gibco Penicillin-Streptomycin (P / S) Gibco lipofectamine TM 3000]]> Gibco Trizol Thermo Fisher Isopropanol Xilong Scientific Chloroform Xilong Scientific Anhydrous ethanol Xilong Scientific miRNA cDNA First-Strand Synthesis Kit Tiangen miRNA Fluorescent Quantitative Detection Kit (SYBR Green) Tiangen Annexin V-FITC Apoptosis Detection Kit Biyun Tian Reactive Oxygen Species Detection Kit Biyun Tian
[0043] 2.2 Main instruments
[0044] Instrument name Company Cell Culture Incubator Thermo Fisher Scientific 3141 Super Clean Bench Haier HCB-1300V Inverted Microscope OLYMPUS BX53 Nanophotometer Ultra-Micro Spectrophotometer IMPLEN Quantitative PCR Instrument Roche Flow Cytometer ACEA Novocyte 2060R
[0045] 2.3 Experimental methods
[0046] 2.3.1 Primary culture of tree shrew cortical neurons
[0047] Take tree shrews within 24 h after birth (Institute of Medical Biology, Chinese Academy of Medical Sciences, license number SCXK (Yunnan) K2023-0003). After disinfection with 75% alcohol immersion, decapitate the brain on ice. After rinsing in pre-cooled HBSS solution, strip the meninges and blood vessels on the cortical surface on ice, remove the cerebellum and brainstem, isolate the cerebral cortex, cut the collected cortex into small pieces (about 0.5 - 1 mm 3 in size), blow and resuspend to mix evenly, add a mixture of 2 mg / mL papain and 200 U / mL DNase I at 37℃, place it in a cell culture incubator, after acting for 30 min at 37℃, add DMEM high-glucose complete medium to terminate digestion, and gently blow into a single cell suspension. Then filter and collect the suspension through a 70 μm sieve, centrifuge at 1000 r / min for 5 min, discard the supernatant, blow and resuspend the cells with DMEM high-glucose complete medium, and count the cell concentration of the mother liquor. Adjust the appropriate cell density and inoculate it in a cell culture plate coated with rat tail glue. Four hours after inoculation, replace all the DMEM high-glucose complete medium with Neurobasal-A medium (added with 2% B27, 1% double antibody, 1% glutamine), and then replace the medium half-volume every 2 days. Cultivate in vitro for 7 days for subsequent experiments.
[0048] 2.3.2 Establishment of glucose oxygen deprivation and reoxygenation model
[0049] On day 8 of neuron culture, an oxygen deprivation / reoxygenation (OGD / R) model was established. The specific method was as follows: the normal culture medium was discarded, the cells were washed twice with PBS, and glucose-free and serum-free DMEM medium was added. The cells were then placed in an incubator (37℃, 95% N2, 5% CO2) for OGD treatment. After 2 hours, the cells were removed, the DMEM medium was discarded, and the medium was replaced with normal Neurobasal-A medium to begin reoxygenation. Subsequent detection was performed 18 hours later.
[0050] 2.3.3 Cell Treatment
[0051] Experimental grouping and treatment:
[0052] ① Control group: Neuronal cells were cultured normally;
[0053] ②OGD / R group: Establish an OGD / R model of neuronal cells according to 2.3.2;
[0054] ③ miR-4680-3p inhibitor group: The diluted miR-4680-3p inhibitor was mixed with lipofectamine TM Mix 3000g of transfection reagent, gently mix, and incubate at room temperature for 20 min to form a transfection complex. Add the above mixture to neuronal cells cultured for 7 days, gently shake the cell plate to mix thoroughly, and incubate in a 5% CO2, 37℃ incubator for 24 h to construct an OGD / R model. The self-designed miR-4680-3p inhibitor sequence is as follows: UAACAACUCUUACAAUUCAGA, synthesized by Shanghai Sangon Biotech Co., Ltd.
[0055] 2.3.4 qPCR detection
[0056] Cells from different treatment groups were collected, and total RNA was extracted using the Trizol method. The concentration and purity of total RNA were detected using a micro spectrophotometer. The RNA was then reverse transcribed into cDNA, and PCR amplification was performed using a Roche quantitative PCR instrument. The reaction conditions were: pre-denaturation 95℃ for 600 s; 95℃: 5 s, 60℃: 30 s, 72℃: 30 s, 45 cycles; melting curve analysis: 95℃: 15 s; 60℃: 30 s; 95℃: 1 s. U6 was selected as an internal control, and 2 was used for relative expression level analysis of the target gene. -△△Ct The method is used for calculation.
[0057] 2.3.5 Cell viability assay
[0058] Cell viability was assessed using CCK-8 reagent. After cell culture in each group, the original culture medium was removed, and fresh Neurobasal-A medium containing 10% CCK-8 was added at 100 μL / well. The cells were then incubated at 37°C in the dark for 2 hours. The absorbance at 450 nm was then measured using a full-wavelength microplate reader.
[0059] 2.3.6 Flow Cytometry Apoptosis
[0060] Cells from different treatment groups were collected, resuspended in 400 μL of binding buffer, and 5 μL of Annexin V-FITC was added and gently mixed. After incubation in the dark for 15 min, 10 μL of PI was added and mixed. After reacting at room temperature in the dark for 5 min, the cells were analyzed by flow cytometry.
[0061] 2.3.7 ROS Detection
[0062] The DCFH-DA probe was used to detect ROS levels in neuronal cells. The specific procedure was as follows: DCFH-DA was diluted with serum-free medium (final concentration 10 μmol / L). Cells from different treatment groups were collected, and 1 mL of DCFH-DA dilution was added to the cells. The cells were incubated at 37°C for 20 min. After centrifugation at 350 g for 5 min, the supernatant was discarded, and the cells were washed three times with serum-free cell culture medium to thoroughly remove any unextracted DCFH-DA. After centrifugation at 350 g for 5 min, the supernatant was discarded, the cells were resuspended in PBS, and the data were analyzed by flow cytometry.
[0063] 2.3.8 Statistical Analysis
[0064] The analysis and comparison were performed using GraphPad Prism 9.0.0. One-way ANOVA was used for comparisons between groups, and LSD method was used for pairwise comparisons. A p-value < 0.05 was considered statistically significant.
[0065] 2.4 Experimental Results
[0066] 2.4.1 Effects of miR-4680-3p inhibitors on miR-4680-3p expression in neurons after OGD / R treatment
[0067] The results are as follows Figure 2 As shown, after OGD / R treatment, the expression level of miR-4680-3p in neurons was significantly increased (P < 0.01); pre-transfection of neurons with miR-4680-3p inhibitors can effectively reduce the increase in miR-4680-3p expression level caused by OGD / R treatment (P < 0.001).
[0068] 2.4.2 Effects of miR-4680-3p inhibitor on neuronal cell viability after OGD / R treatment
[0069] The results are as follows Figure 3 As shown, OGD / R treatment significantly reduced cell viability in neurons (P < 0.0001); pre-transfection of neurons with miR-4680-3p inhibitor effectively increased the reduction in cell viability caused by OGD / R treatment (P < 0.001).
[0070] 2.4.3 Effect of miR-4680-3p inhibitor on neuronal apoptosis after OGD / R treatment
[0071] The results are as follows Figure 4 As shown, the apoptosis rate of neurons was significantly increased after OGD / R treatment (P < 0.0001); pre-transfection of neurons with miR-4680-3p inhibitor can effectively reduce the increase in apoptosis rate caused by OGD / R treatment (P < 0.001).
[0072] 2.4.4 Effects of miR-4680-3p inhibitor on OGD / R treatment of reactive oxygen species (ROS) in neurons
[0073] The results are as follows Figure 5 As shown, the ROS level in neurons was significantly increased after OGD / R treatment (P < 0.0001); pre-transfection of neurons with miR-4680-3p inhibitor effectively reduced the increase in ROS caused by OGD / R treatment (P < 0.001).
Claims
1. The application of miR-4680-3p inhibitors, characterized in that, The inhibitor is used to prepare a drug for treating ischemic stroke, and its nucleotide sequence is UAACAACUCUUACAAUUCAGA.
Citation Information
Patent Citations
Viral attenuation and vaccine production
US20140363469A1
New targets modulated by a casual variant of type 2 diabetes (T2D) embedded within the TCF7l2 gene and methods of use thereof for identifying agents having efficacy for the treatment of type 2 diabetes and other metabolic disorders
WO2016201438A1