GhNF-YB3 and application thereof

Through genome-wide association analysis and quantitative trait locus analysis, the nuclear factor YB subunit gene GhNF-YB3 was identified and overexpressed in cotton. This solved the problem of unclear locus intervals for cotton yield traits in existing technologies, significantly improved seed index and boll weight, and provided a breeding basis for high-yield cotton varieties.

CN121610498BActive Publication Date: 2026-05-29HAINAN RES INST OF ZHEJIANG UNIV +1
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
HAINAN RES INST OF ZHEJIANG UNIV
Filing Date
2026-02-02
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

Existing technologies make it difficult to directly use GWAS and eQTL analysis to discover causal genes that cause phenotypic variations in cotton. The locus intervals that affect cotton yield traits are large and unclear, resulting in poor breeding results.

Method used

By using genome-wide association analysis and quantitative trait locus analysis, the nuclear factor YB subunit gene GhNF-YB3 was identified, and its overexpression was achieved in cotton through genetic engineering to regulate seed index and boll weight phenotypes, thereby constructing high-yield cotton varieties.

Benefits of technology

It significantly improved the seed index and boll weight of cotton, provided the genetic basis and breeding basis for high-yield cotton varieties, and achieved efficient genetic engineering improvement.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121610498B_ABST
    Figure CN121610498B_ABST
Patent Text Reader

Abstract

The application discloses a nuclear factor YB subunit gene GhNF-YB3 and application thereof, the nucleotide sequence of the gene GhNF-YB3 is shown as SEQ ID NO. 1; through yield character investigation on 245 upland cotton varieties, GWAS and eQTL positioning are carried out in combination with population genome resequencing and ovule transcriptome sequencing one day after flowering, and a site gene GhNF-YB3 significantly related to cotton yield character is obtained. The gene expression of the gene GhNF-YB3 is significantly positively correlated with two yield characters of seed index and boll weight, and the gene may be a causal gene for regulating cotton seed index character. The nuclear factor YB subunit gene GhNF-YB3 of the application can be applied to identification of high-yield upland cotton varieties and improvement of cotton yield character.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of cotton yield trait gene technology in biotechnology, and in particular to a cotton yield trait-associated nuclear factor YB subunit (NF-YB) gene GhNF-YB3 and its applications. Background Technology

[0002] Cotton is one of my country's major economic crops, playing a vital role in the country's agricultural economic development and promoting sustainable agricultural development. Yield is the foundation of cotton planting profits, and given the comprehensive development of other traits, high yield is the most important goal in cotton variety breeding. Therefore, fully exploring high-yield and superior genes in cotton varietal resources is of great significance for cotton breeding. Although a large number of quantitative trait loci (QTLs) for yield have been identified in cotton, the intervals between QTLs are relatively large, and the causal genes causing phenotypic variations are not clearly defined, making direct application in breeding difficult.

[0003] Genome-wide association studies (GWAS) utilize statistical analysis to identify variant sites associated with target traits, further identifying important candidate genes. With advancements in sequencing technology and the continuous improvement of related statistical algorithms, GWAS has been widely applied in fine mapping studies and variety improvement of complex traits in plants and animals. Although GWAS can establish associations between genetic variant sites and phenotypes, the GWAS signal does not directly point to genes, and it still has limitations in identifying causal genes or DNA structural variations that influence phenotypes. Given these limitations, multi-omics analysis methods are used as a supplement to GWAS. Expression quantitative trait loci (eQTL) analysis treats gene expression levels as quantitative traits and associates them with genomic variant sites such as single nucleotide polymorphisms (SNPs) to identify genetic variations regulating gene expression. Combined analysis of GWAS and eQTL can identify causal genes causing phenotypic changes, aiding in the analysis of complex quantitative traits. The combined analysis of GWAS and eQTL has been successfully applied to crops such as rice, rapeseed, and cotton for the discovery of causal genes for agronomic traits. Currently, studies have identified the BnPMT6s gene as negatively regulating seed oil content through GWAS and eQTL analysis of 505 rapeseed accessions. Another study, through eQTL analysis of the transcriptomes of 224 maize accessions under drought stress, identified the ABH2 gene as a gene causing drought tolerance variation in maize populations. A further study, through GWAS and eQTL analysis of 251 cotton accessions, identified KIP-related proteins as contributing to increased fiber length by regulating the developmental transition from rapid elongation phase to secondary cell wall synthesis. A third study, through GWAS and eQTL analysis of 218 upland cotton accessions, identified the GhHRK1 gene as negatively regulating the plant's heat stress response through eQTL identification of the transcriptome under high temperature. These studies demonstrate that the integration of eQTL and GWAS analyses can identify causal genes causing phenotypic variations at the single-gene level.

[0004] Nuclear factor Y (NF-Y) typically exists as a complex, generally consisting of three subunits: NF-YA, NF-YB, and NF-YC. NF-Y is an important transcription factor in organisms, and no single NF-Y subunit can independently regulate transcription. The NF-Y transcription factor complex is also known as the CCAAT-binding factor (CBF) due to its ability to bind to the CCAAT box on the promoter. Many reports have revealed the molecular mechanisms by which the NF-Y complex functions. In fungi and plants, most studies suggest that NF-YB forms a dimer with NF-YC in the cytoplasm, and with the help of NF-YC, is transported to the nucleus to form a trimer with NF-YA. The NF-YA protein contains a DNA transcription-binding domain, which activates or inhibits transcription by binding to the CCAAT box in the promoter region of downstream genes. In addition to this pattern, reports indicate that the dimer formed by NF-YB and NF-YC can also bind to other transcription factors, recognize promoter region elements (which may not be CCAAT boxes), and regulate downstream gene expression.

[0005] The typical function of NF-YB family members is to interact with the NF-YC and NF-YA subunits to form the NF-Y complex, which binds to the CCAAT box on the promoter and regulates the transcription of downstream genes. LEC1 (NF-YB9) is the most well-studied member of the NF-YB family in plants. LEC1 is an atypical NF-YB subunit, capable of binding with other transcription factors besides the NF-YA and NF-YC subunits to form complexes and exerting its function by binding with different motifs. LEC1 plays a role in different stages of seed development, including embryogenesis, hormone synthesis and signal transduction, the accumulation of macromolecular storage substances, and seed maturation. LEC1 loss-of-function mutants exhibit defects in seed storage protein and lipid accumulation, and suppressed seed germination and leaf primordia initiation. Studies have shown that in Arabidopsis and soybean, LEC1 can bind with seed development-related transcription factors AREB3, bZIP67, and ABI3, and different combinations of transcription factors can regulate different gene populations, thereby playing a role in different signaling pathways. Rice OsNF-YB9 and OsNF-YB7 are homologous to Arabidopsis LEC1. Heterologous expression of OsNF-YB9 or OsNF-YB7 in the Arabidopsis mutant lec1-1 can compensate for the defective phenotype of lec1-1. Loss of OsNF-YB9 function leads to abnormal rice seed development, resulting in smaller seeds with reduced width and thickness, and a higher chalkiness ratio. Studies have found that OsNF-YB9 can interact with the sucrose synthesis protein kinase gene SPK, regulating the expression of sucrose synthesis-related genes, thereby modulating rice seed development.

[0006] Furthermore, in rice, multiple studies have shown that OsNF-YB1 participates in regulating rice grain development and affects grain quality. Rice with nfyb1 loss-of-function mutants exhibits increased chalkiness in the endosperm, along with significantly reduced starch and amylose content. Studies have shown that rice OsNF-YB1 plays a role in grain filling, and chalkiness in the endosperm can be observed in nfyb1 mutants. In addition, NF-YB1 also affects sucrose transport to the endosperm. Subsequent studies have further explored the molecular mechanism by which the NF-YB1-YC12-bHLH144 complex regulates rice grain quality.

[0007] Currently, there are no reports on the function of the nuclear factor YB subunit (NF-YB) gene GhNF-YB3 in the genus Gossypium. Studying the function of gene GhNF-YB3 in the regulation of cotton seed index and boll weight can provide a genetic basis for the improvement of high-yielding cotton varieties and play an important role in precision cotton breeding. Summary of the Invention

[0008] The purpose of this invention is to address the shortcomings of existing technologies by providing a nuclear factor YB subunit gene, GhNF-YB3, and its applications. Genome-wide association analysis and quantitative trait locus analysis in this invention demonstrate that gene expression can induce phenotypic variations in cotton seed index and boll weight.

[0009] The objective of this invention is achieved through the following technical solution: This invention provides a nuclear factor YB subunit gene GhNF-YB3, the nucleotide sequence of which in tetraploid upland cotton (Gossypium hirsutum) TM-1 is shown in SEQ ID NO.1.

[0010] This invention also provides an application of the nuclear factor YB subunit gene GhNF-YB3 in identifying high-yield upland cotton varieties.

[0011] Furthermore, the gene expression of the nuclear factor YB subunit gene GhNF-YB3 is associated with an upstream genetic locus (SNP: A07:89225810). The primer pair used to detect this upstream genetic locus in cotton includes the upstream primer shown in SEQ ID NO.2 and the downstream primer shown in SEQ ID NO.3. In the population, materials with the AA base at this SNP locus exhibited low seed index and low boll weight; materials with the GG base at this SNP locus exhibited high seed index and high boll weight; and heterozygous materials with the AG base type showed seed index and boll weight between the two.

[0012] This invention also provides an application of the nuclear factor YB subunit gene GhNF-YB3 in the breeding of high-yielding cotton varieties. The cloned GhNF-YB3 gene fragment is recombined with the cotton overexpression vector WMV062, and the recombinant vector is transformed into cotton callus tissue by Agrobacterium-mediated transformation and then transformed into upland cotton standard lines. After screening with antibiotic markers, GhNF-YB3 overexpression lines are obtained.

[0013] Furthermore, the expression level of the nuclear factor YB subunit gene GhNF-YB3 showed a significant positive correlation with the seed index and boll weight of upland cotton. Using TM-1 DNA as a template, the GhNF-YB3 sequence was amplified by PCR using the upstream primer shown in SEQ ID NO.4 and the downstream primer shown in SEQ ID NO.5, and a cotton overexpression vector of the GhNF-YB3 gene was constructed.

[0014] Furthermore, using genetic engineering techniques, the cotton overexpression vector of the GhNF-YB3 gene was transformed into TM-1 to obtain GhNF-YB3 gene overexpression lines, which were then propagated to the homozygous generation. The two GhNF-YB3 gene overexpression lines (#4 and #6) showed increased seed index (11.8% and 7.4%, respectively) and boll weight (15.7% and 11.0%, respectively) compared to the transgenic background TM-1. Based on the significant increase in seed index and boll weight achieved by the GhNF-YB3 overexpression materials, it is possible to further screen for high-yielding upland cotton varieties in the progeny of transgenic plants, which is of great significance in breeding practice.

[0015] Compared with the prior art, the beneficial effects of the present invention are:

[0016] (1) This invention has discovered a nuclear factor YB subunit gene GhNF-YB3 that is simultaneously associated with the cotton yield traits seed index and boll number through genome-wide association analysis and quantitative trait locus analysis. The GhNF-YB3 cDNA sequence provided by this invention was obtained by PCR technology, which has the advantages of small starting template amount, simple and easy experimental steps and high sensitivity.

[0017] (2) The expression of the GhNF-YB3 gene in this invention is significantly correlated with the size of the seed finger, indicating that the GhNF-YB3 gene is related to the constituent factors of yield traits.

[0018] (3) Based on the different SNP genotypes of the gene GhNF-YB3, the present invention can divide the variety population into two major categories. Statistical analysis revealed that there are significant differences in boll weight and seed index between the two groups, further proving the correlation between the GhNF-YB3 gene and cotton yield traits.

[0019] (4) This invention obtains transgenic material overexpressing the nuclear factor YB subunit gene GhNF-YB3 through genetic engineering technology, providing a basis for improving the high-yield trait of cotton. Attached Figure Description

[0020] Figure 1 A schematic diagram showing the co-location results of genome-wide association analysis of cotton yield trait and locus association analysis of GhNF-YB3 expression quantitative trait;

[0021] Figure 2 The results of a comparative analysis of yield traits among different haplotypes of the gene GhNF-YB3;

[0022] Figure 3 The correlation results between GhNF-YB3 gene expression and yield traits;

[0023] Figure 4 Photo of GhNF-YB3 transgenic plant;

[0024] Figure 5 The results of the comparative analysis of seed index between GhNF-YB3 gene overexpression lines and wild-type lines;

[0025] Figure 6 The results of the comparative analysis of boll weight between GhNF-YB3 gene overexpression lines and wild-type lines. Detailed Implementation

[0026] Exemplary embodiments will now be described in detail, examples of which are illustrated in the accompanying drawings. When the following description relates to the drawings, unless otherwise indicated, the same numerals in different drawings denote the same or similar elements. The embodiments described in the following exemplary embodiments do not represent all embodiments consistent with the present invention. Rather, they are merely examples of apparatuses and methods consistent with some aspects of the invention as detailed in the appended claims.

[0027] The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. The singular forms “a,” “the,” and “the” used in this invention and the appended claims are also intended to include the plural forms unless the context clearly indicates otherwise. It should also be understood that the term “and / or” as used herein refers to and includes any or all possible combinations of one or more of the associated listed items.

[0028] It should be understood that although the terms first, second, third, etc., may be used in this invention to describe various information, this information should not be limited to these terms. These terms are only used to distinguish information of the same type from one another. For example, first information may also be referred to as second information without departing from the scope of this invention, and similarly, second information may also be referred to as first information. Depending on the context, the word "if" as used herein may be interpreted as "when," "when," or "in response to a determination."

[0029] The present invention will now be described in detail with reference to the accompanying drawings. Unless otherwise specified, the features of the following embodiments and implementations can be combined with each other.

[0030] Example 1: Discovery of the nuclear factor YB subunit gene GhNF-YB3 associated with cotton yield trait

[0031] A detailed survey of yield traits (boll weight and seed index, etc.) was conducted on 245 modern upland cotton varieties or lines. Simultaneously, whole-genome resequencing and transcriptome sequencing of 1 DPA ovules were performed on these cotton varieties. The genome sequences were aligned to the upland cotton reference genome sequence, and whole-genome SNPs were identified using Samtools software. A total of 1,186,673 high-quality SNPs (minimum gene frequency >0.05, deletion rate <80%) were mined for genome-wide association analysis. Association analyses and statistical tests were performed between the obtained high-quality SNPs and cotton yield traits and gene expression, respectively. The results were based on P < 1 × 10⁻⁶. -6 The requirement is to screen for SNP-associated signaling loci. The results of genome-wide association analysis (GWAS) for cotton yield and co-location analysis of GhNF-YB3 expression quantitative trait loci are as follows: Figure 1 As shown, the horizontal axis represents chromosome A07 (Mb), indicating the location (Mb) on chromosome A07; the Manhattan plot in the upper left shows the significance of the association between SNP loci and seed finger, and the Manhattan plot in the upper right shows the significance of the association between SNP loci and boll weight; the vertical axis uses -log 10 (P) indicates the significance of the association between the SNP site and GhNF-YB3 expression; the two Manhattan plots below show the significance of the association between the SNP site and GhNF-YB3 expression, with the vertical axis represented by logarithms. 10 (P) indicates. From Figure 1As can be seen, a SNP signaling locus (SNP: A07:89225810) on chromosome A07 can significantly correlate with both seed index and boll weight, two yield traits. Furthermore, this locus is also an eQTL site significantly associated with the expression of the nuclear factor YB subunit gene GhNF-YB3. Therefore, it is preliminarily determined that the SNP signaling locus (SNP: A07:89225810) can influence cotton yield traits by regulating the expression of the GhNF-YB3 gene, and that the GhNF-YB3 gene is a causal gene affecting cotton yield traits; that is, the expression of the nuclear factor YB subunit encoding the GhNF-YB3 gene is associated with an upstream genetic locus (SNP: A07:89225810).

[0032] Example 2: Application of the nuclear factor YB subunit gene GhNF-YB3 in identifying high-yielding upland cotton varieties

[0033] Twenty-five upland cotton varieties with different yield levels were collected, and genomic DNA was extracted from each variety. Subsequently, a primer pair for detecting SNP sites was designed. Based on the location of the SNP site (SNP: A07:89225810) on chromosome A07, genomic amplification primers were designed at both ends of the site. The primer sequences are F1: AATAGGCGCAGCAAAGCT (SEQ ID NO.2) and R1: GGGCGTGTGGTCCTAAGAC (SEQ ID NO.3). This primer pair was used to identify high-yielding cotton varieties. PCR amplification and sequencing were performed on the DNA of 279 varieties using this primer pair. The PCR reaction program was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 20 s, 30 cycles; and a final extension at 72℃ for 5 min. The genotype of the upstream genetic locus of the YB subunit gene GhNF-YB3 in cotton, A07:89225810, was detected, and the identification results in 266 upland cotton varieties are shown in Tables 1, 2, and 3.

[0034] Genotypes of each variety population at this SNP locus were analyzed based on the sequencing results of the PCR amplification products. The upstream genetic locus of the GhNF-YB3 gene (A07:89225810) showed SNP variations in 245 cotton varieties, including three types: AA, GG, and AG (heterozygous). Based on the base information of the two SNP loci, AA was labeled as GhNF-YB3(AA), GG as GhNF-YB3(GG), and AG as GhNF-YB3(AG). 207 haplotype GhNF-YB3(AA), 7 haplotype GhNF-YB3(GG), and 31 heterozygous GhNF-YB3(AG) materials were identified in this population, as shown in Tables 1, 2, and 3. The Student's t-test was used to compare and calculate the differences in yield traits among the three haplotype groups. The confidence scores (P-values) for the differences between groups are shown in Tables 1, 2, and 3. Figure 2 As shown, the box plots represent the distribution of seed index (g) and boll weight (g) among the varietal populations. There are 207 varieties containing the AA, 31 containing the AG, and 7 containing the GG haplotypes. The horizontal lines within the boxes represent the median values ​​of the trait distribution. Figure 2 The calculation results show that the average seed index of GhNF-YB3(GG) is 11.58 g, and the average boll weight is 6.05 g; the average seed index of GhNF-YB3(AA) is 10.47 g, and the average boll weight is 5.39 g; and the average seed index of GhNF-YB3(AG) is 11.57 g, and the average boll weight is 5.80 g. Compared with GhNF-YB3(AA), the haplotype GhNF-YB3(GG) has a 10.6% higher seed index (P=0.0034, Student's t-test) and a 12.2% higher boll weight (P=0.0032, Student's t-test). In the population, materials with the AA base at this SNP site exhibit low seed index and low boll weight; materials with the GG base at this SNP site exhibit high seed index and high boll weight; and the hybrid material with the AG base type has a seed index and boll weight between the two. Therefore, varieties carrying GhNF-YB3 (GG) exhibit high seed index and high boll weight. In summary, the upstream SNP genetic locus of GhNF-YB3 is of significant value in identifying high-yielding cotton varieties. The primer pairs SEQ ID NO.2 and SEQ ID NO.3 provided by this invention can be used to effectively identify cotton yield traits, demonstrating excellent application value in the breeding and improvement of high-yielding cotton varieties.

[0035] Example 3: Correlation analysis between GhNF-YB3 gene expression level and yield trait in a population

[0036] Transcriptome sequencing was performed on RNA samples from 245 cotton varieties. Gene expression levels were calculated as the number of sequencing fragments per thousand transcripts per million sequencing bases (FPKM). Figure 3 In this study, scatter plots were created by comparing the standardized GhNF-YB3 gene expression levels of 245 cotton varieties with their seed index and boll weight data. Linear fitting, correlation calculations, and statistical tests were then performed to obtain the following results: Figure 3 The correlation results between GhNF-YB3 gene expression and yield traits are shown. Figure 3 In the graph, scatter plots represent variety populations, the horizontal axis represents the standardized GhNF-YB3 gene expression level, and the vertical axis represents the seed index and boll weight, respectively, for yield traits. The diagonal lines in the graph represent the trend lines after linear regression fitting of the scatter plots. R 2 The coefficient of determination (P-value) indicates the statistical significance of a linear relationship. From... Figure 3 It can be found that GhNF-YB3 gene expression and seed finger (R) are related. 2 =0.17, P=1.22×10 -11 ) and bell weight (R 2 =0.10, P=3.29×10 -07 A significant positive correlation indicates that this gene is associated with yield trait components. Therefore, varieties with high GhNF-YB3 expression exhibit higher seed index and boll weight, laying the foundation for further breeding of high-yielding cotton varieties through genetic engineering.

[0037] Example 4: Obtaining GhNF-YB3 overexpression lines of nuclear factor YB subunit gene

[0038] Upland cotton cultivars were used as recipients. The overexpression vector WMV062, used for cotton transgenic research, was purchased from Weimi Biotechnology Co., Ltd. The vector was then linearized by digesting it with Xbal I and Sal I restriction endonucleases. The cDNA sequence of GhNF-YB3 (GH_A07G2187) was obtained from the upland cotton genome sequence (SEQ ID NO.1). Following the strategy of homologous recombination, amplification primers were designed based on the sequences at both ends of the target cDNA. Homologous sequences and corresponding restriction sites identical to those at the ends of the linearized cotton overexpression vector WMV062 were introduced at the 5′ end of the primers. The upstream primer sequence was F2: GAGAACACGGGGGACTCTAGAATGGCGGATTCGGACGAT (SEQ ID NO.4), and the downstream primer sequence was R2: GTCCTTGTAGTCCATGTCGACACAAACTCCACCTCCACCAACA (SEQ ID NO.5). This primer pair contained the added homologous arms and restriction enzyme sites. Using cotton genomic cDNA containing the GhNF-YB3 gene as a template, PCR amplification was performed using the above primer pair. The PCR reaction program was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 20 s, 30 cycles; and a final extension at 72℃ for 5 min. Subsequently, the PCR amplification product was sequenced, and the sequence was further compared with the GhNF-YB3 cDNA sequence (SEQ ID NO.1) to confirm the sequence accuracy, thus obtaining the nuclear factor YB subunit gene GhNF-YB3. The cloned GhNF-YB3 gene fragment was recombined with the linearized cotton overexpression vector WMV062. The reaction program was 37℃ for 30 min to obtain the recombinant vector. Subsequently, the recombinant vector was transformed into Escherichia coli, and the inserted fragment was sequenced and aligned. The successfully recombinant vector was transformed into Agrobacterium, and then transformed into cotton callus tissue via Agrobacterium-mediated transformation into the upland cotton standard line TM-1. After antibiotic labeling and selection, GhNF-YB3 overexpression lines were obtained.

[0039] Example 5: Application of GhNF-YB3, the gene encoding the nuclear factor YB subunit, in improving yield traits.

[0040] Transgenic lines (i.e., transgenic cotton plants) overexpressing the GhNF-YB3 gene were constructed using genetic engineering techniques and propagated to the homozygous generation, yielding plants such as... Figure 4 The GhNF-YB3 gene overexpression lines shown are as follows: Figure 5 The results of the comparative analysis of seed index between the GhNF-YB3 gene overexpression lines and wild-type lines are shown, as well as... Figure 6 The results of the boll weight comparison analysis between the GhNF-YB3 gene overexpression lines and the wild type are shown. Figure 4 Photos of wild-type (TM-1) and GhNF-YB3 gene overexpression lines (T4 generation) planted in the field. The GhNF-YB3 gene overexpression lines include two lines, #4 and #6, with TM-1 as the background control for transgenic material. Figure 5 In the figure, the vertical axis represents the seed index (g). The student t-test was used to compare the data between the two groups. There were six biological replicates for each group. **** indicates that the significance P value is less than 0.0001. Figure 6 In the figure, the vertical axis represents the weight of the bell (g). A Student's t-test was used to compare the data between the two groups, with three biological replicates for each group. * indicates a significance P-value less than 0.05, and ** indicates a significance P-value less than 0.01. There were no significant differences in growth and plant type between the GhNF-YB3 gene overexpression lines and the wild type. Figure 4 As shown. However, the two overexpression lines of GhNF-YB3 (#4 and #6) showed seed index increases of 11.8% and 7.4%, respectively, compared to the transgenic background TM-1, as shown. Figure 5 As shown, the weight of the bells increased by 15.7% and 11.0% respectively, as... Figure 6 As shown. Therefore, it is demonstrated that the overexpression vector of the GhNF-YB3 gene can significantly increase cotton yield. The GhNF-YB3 gene has application value in the breeding of high-yielding varieties through genetic engineering. Plants overexpressing the GhNF-YB3 gene can be obtained through genetic engineering, and the yield of upland cotton plants can be increased by increasing the expression level of this gene. Furthermore, high-yielding new upland cotton varieties can be screened from the offspring of transgenic plants.

[0041] Table 1: Part 1 Identification Results of High-Yield and Low-Yield Haplotypes in Population Variety Materials

[0042]

[0043] Table 2: Part II Identification Results of High-Yielding and Low-Yielding Haplotypes in Population Variety Materials

[0044]

[0045] Table 3: Part III Identification Results of High-Yielding and Low-Yielding Haplotypes in Population Variety Materials

[0046]

[0047] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. The application of the nuclear factor YB subunit gene GhNF-YB3 as shown in SEQ ID NO.1 in the breeding of cotton varieties with high seed index and / or high boll weight, characterized in that, The cloned GhNF-YB3 gene fragment was recombined with the cotton overexpression vector WMV062, and the recombinant vector was transformed into cotton callus tissue via Agrobacterium-mediated transformation and then transformed into upland cotton standard lines. After screening with antibiotic markers, GhNF-YB3 overexpression lines were obtained.

2. The application according to claim 1, characterized in that, The GhNF-YB3 gene fragment was obtained by PCR amplification using the upstream primer shown in SEQ ID NO.4 and the downstream primer shown in SEQ ID NO.5.

Citation Information

Patent Citations

  • Transcriptional regulation for improved plant productivity

    CN104981481A

  • Application of GhVdR2 gene in improving disease resistance of cotton verticillium wilt

    CN118703514A