TAL effector nuclease pair and application thereof
By designing TAL effector nuclease pairs that specifically recognize mitochondrial disease mutation sites, specific cleavage of mutant mtDNA and wild-type mtDNA was achieved, solving the treatment challenge of mitochondrial diseases and providing methods for the prevention and treatment of mitochondrial diseases.
Patent Information
- Application Number
- CN202480051034.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2023-12-25
- Filing Date
- 2024-12-19
- Publication Date
- 2026-03-13
AI Technical Summary
Existing technologies have difficulty specifically cutting mutant and wild-type mitochondrial DNA (mtDNA), resulting in complex symptoms of mitochondrial diseases and a lack of radical cures.
Design a TAL effector nuclease pair comprising first and second TAL effector nuclease monomers. Through specific RVD recognition of bases at mitochondrial disease-induced mutation sites, a heterodimer FokI endonuclease domain is formed, enabling specific cleavage of mutant mtDNA and wild-type mtDNA.
It improves the cleavage specificity of mutant mtDNA and wild-type mtDNA, and can alter their ratio, thereby reproducing symptoms and developing treatments applicable to the prevention and treatment of mitochondrial diseases.
Smart Images

Figure CN121666451A_ABST
Abstract
Description
Technical Field
[0001] This disclosure relates to TAL effector nuclease pairs. This application is based on Japanese Patent Application No. 2023-217626, filed on December 25, 2023, the contents of which are incorporated herein by reference. Background Technology
[0002] It is known that some mitochondrial diseases, which cause decline in mitochondrial function, are caused by mutations in mitochondrial DNA (mtDNA). Hundreds to thousands of copies of mtDNA exist in a single cell. It is believed that in most cases, mutant mtDNA coexists with normal wild-type mtDNA, and when the proportion of mutant mtDNA reaches a certain level, functional impairment occurs. It is known that in a state of coexistence of mutant and wild-type mtDNA (heterogeneity), if a double-strand break is introduced into one type of mtDNA, the broken mtDNA disappears, thus altering the ratio of mutant to wild-type mtDNA. Genome editing technologies containing transcription activator-like effector nucleases (TALENs) can sequence-specifically introduce double-strand breaks into DNA. Therefore, the ratio of mutant to wild-type mtDNA can be altered by designing TALENs that specifically cleave mutant or wild-type mtDNA (e.g., Patent Document 1).
[0003] Existing technical documents
[0004] Patent documents
[0005] Patent Document 1: Japanese Patent Application Publication No. 2018-139580 Summary of the Invention
[0006] Mitochondrial diseases caused by mtDNA mutations present with complex symptoms, and currently there is no cure. Techniques that alter the mutation ratio of mtDNA can be used to reproduce symptoms, potentially helping to elucidate the cause and develop treatments. Furthermore, reducing the proportion of mutated mtDNA could potentially serve as a fundamental treatment targeting the underlying cause. Therefore, there is a ongoing search for a technology capable of more specifically cleaving either mutated or wild-type mtDNA.
[0007] This disclosure may be implemented in the following ways.
[0008] (1) According to one aspect of the present disclosure, a TAL effector nuclease pair is provided. The TAL effector nuclease pair comprises a first TAL effector nuclease monomer and a second TAL effector nuclease monomer, wherein the target sequence of the first TAL effector nuclease monomer is spaced 12 to 20 bases from the target sequence of the second TAL effector nuclease monomer, and the first TAL effector nuclease monomer and the second TAL effector nuclease monomer each have: a DNA-binding domain containing an RVD and binding to DNA of 8 to 15 bases, and a DNA-cutting domain of a FokI endonuclease, wherein the RVD comprises: a first RVD that recognizes a mitochondrial disease-induced mutation site, and a second RVD that recognizes bases other than the mitochondrial disease-induced mutation site, wherein the first RVD is at least one of NM that recognizes adenine, WK that recognizes guanine, and LK that recognizes guanine, and the second RVD recognizes adenine by NI and guanine by NN. Based on this method, the TAL effector nuclease pair can more specifically cleave either mutant mtDNA or wild-type mtDNA.
[0009] (2) According to the TAL effector nuclease pair described in (1) above, the DNA cleavage domains of the FokI endonuclease in the first TAL effector nuclease monomer and the second TAL effector nuclease monomer may have different amino acid sequences and form heterodimers. According to this TAL effector nuclease pair, since the FokI endonuclease forms heterodimers, it can more specifically cleave one of the mutant mtDNA and the wild-type mtDNA.
[0010] (3) The TAL effector nuclease pair described in (1) or (2) above can bind to mutant mitochondrial DNA. The TAL effector nuclease pair according to this method can specifically cleave mutant mtDNA.
[0011] (4) The TAL effector nuclease pair described in (1) or (2) above can bind to wild-type mitochondrial DNA. The TAL effector nuclease pair according to this method can specifically cleave wild-type mtDNA.
[0012] (5) The TAL effector nuclease pair according to any one of (1) to (4) above, wherein the mitochondrial disease-induced mutation can be the A3243G mutation. The TAL effector nuclease pair according to this method can specifically cleave one of the mutant mtDNA and wild-type mtDNA associated with the A3243G mutation.
[0013] (6) According to the TAL effector nuclease pair described in (5) above, wherein the RVD in the first TAL effector nuclease monomer can be any one of NN-NN-HD-NI-NN-WK-NN-HD-HD-HD-NN, NN-NN-HD-NI-NN-LK-NN-HD-HD-HD-NN, and NN-NN-HD-NI-NN-NM-NN-HD-HD-HD-NN. The TAL effector nuclease pair according to this configuration can more specifically cleave either the mutant mtDNA associated with the A3243G mutation or the wild-type mtDNA.
[0014] (7) According to the TAL effector nuclease pair described in (5) or (6) above, wherein the RVD in the second TAL effector nuclease monomer can be any one of NI-NI-NI-NN-NG-NG-NG-NG-NG-NI-NI-NN-NG, NI-NI-NI-NN-NG-NG-NG-NG-NI-NI-NN, and NN-NG-NI-NI-NI-NN-NG-NG-NG-NG-NG-NI-NI-NN-NG. The TAL effector nuclease pair according to this configuration can more specifically cleave either the mutant mtDNA associated with the A3243G mutation or the wild-type mtDNA.
[0015] (8) According to the TAL effector nuclease pair described in (5) to (7) above, wherein the first TAL effector nuclease monomer can be any of the amino acid sequences shown in any one of Serial No. 1 to 3, an amino acid sequence having more than 90% homology with the amino acid sequences shown in any one of Serial No. 1 to 3, or an amino acid sequence in which one or more amino acid residues are missing, replaced, or added in the amino acid sequences shown in any one of Serial No. 1 to 3; and the second TAL effector nuclease monomer can be any of the amino acid sequences shown in any one of Serial No. 4, Serial No. 19, and Serial No. 20, an amino acid sequence having more than 90% homology with the amino acid sequences shown in any one of Serial No. 4, Serial No. 19, and Serial No. 20, or an amino acid sequence in which one or more amino acids are missing, replaced, or added in the amino acid sequences shown in any one of Serial No. 4, Serial No. 19, and Serial No. 20. Based on this method of TAL effector nuclease pairing, it is possible to more specifically cleave either the mutant mtDNA associated with the A3243G mutation or the wild-type mtDNA.
[0016] (9) According to another aspect of this disclosure, a nucleic acid composition may be provided. The nucleic acid composition comprises a first nucleic acid encoding a first TAL effector nuclease monomer and a second nucleic acid encoding a second TAL effector nuclease monomer, wherein the target sequence of the first TAL effector nuclease monomer is spaced 12 to 20 bases from the target sequence of the second TAL effector nuclease monomer, and the first TAL effector nuclease monomer and the second TAL effector nuclease monomer each have: a DNA-binding domain comprising an RVD and binding to DNA of 8 to 15 bases, and a DNA-cutting domain of a FokI endonuclease, wherein the RVD comprises: a first RVD recognizing a base that induces a mitochondrial disease mutation site, and a second RVD recognizing a base other than the mitochondrial disease mutation site, wherein the first RVD is at least one of NM recognizing adenine, WK recognizing guanine, and LK recognizing guanine, and the second RVD recognizes adenine by NI and guanine by NN. Based on this method of nucleic acid composition, a TAL effector nuclease pair that can more specifically cleave one of the mutant mtDNA and the wild-type mtDNA can be expressed.
[0017] (10) According to another aspect of this disclosure, a vector containing the nucleic acid composition described in (9) above can be provided. According to the vector of this aspect, a TAL effector nuclease pair capable of more specifically cleaving one of the mutant mtDNA and the wild-type mtDNA can be expressed.
[0018] (11) According to another aspect of this disclosure, a pharmaceutical composition may be provided. The pharmaceutical composition comprises the TAL effector nuclease pair described in any one of (1) to (8) above, the nucleic acid composition described in (9) above, or the vector described in (10) above. The pharmaceutical composition according to this aspect is capable of more specifically cleaving either mutant mtDNA or wild-type mtDNA.
[0019] It should be noted that this disclosure can be implemented in various ways. For example, it can be implemented as a preventive drug for mitochondrial diseases, a therapeutic drug for mitochondrial diseases, a method for manufacturing a preventive drug for mitochondrial diseases, a method for manufacturing a therapeutic drug for mitochondrial diseases, a method for preventing mitochondrial diseases, a method for treating mitochondrial diseases, a method for delaying the progression of mitochondrial diseases, the use of TAL effector nuclease pairs in the manufacture of therapeutic drugs for mitochondrial diseases, and the use of TAL effector nuclease pairs for reducing the proportion of mutant mtDNA in mitochondrial diseases. Attached Figure Description
[0020] Figure 1 This is a schematic diagram illustrating how TALEN cuts DNA.
[0021] Figure 2This is an illustrative diagram showing the RVD of the TALEN pair used to cleave mutant mtDNA in SSA detections 1 and 5, together with the target sequence.
[0022] Figure 3 This is an illustrative diagram showing the RVD of the TALEN pair used to cleave wild-type mtDNA in SSA detections 1 and 5, together with the target sequence.
[0023] Figure 4 This is an illustrative diagram showing the RVD of the TALEN pair used in SSA detections 2-4 together with the target sequence.
[0024] Figure 5 This is an explanatory diagram showing an overview of SSA testing.
[0025] Figure 6 This is an illustrative diagram showing the DNA cleavage activity of the TALEN pair used to cleave mutant mtDNA in SSA assay 1.
[0026] Figure 7 This is an illustrative diagram showing the cleavage specificity for mutant mtDNA.
[0027] Figure 8 This is an illustrative diagram showing the DNA cleavage activity of the TALEN pair used to cleave wild-type mtDNA in SSA assay 1.
[0028] Figure 9 This is an illustrative diagram showing the cleavage specificity for wild-type mtDNA.
[0029] Figure 10 This is an explanatory diagram showing the results of SSA detection 2.
[0030] Figure 11 This is an explanatory diagram showing the results of SSA test 3.
[0031] Figure 12 This is an explanatory diagram showing the results of SSA detection 4.
[0032] Figure 13 This is an explanatory diagram showing the results of SSA detection of cleavage activity in 5.
[0033] Figure 14 This is an illustrative diagram showing the cleavage specificity brought about by TALEN pairs used to cleave mutant mtDNA.
[0034] Figure 15 This is an illustration showing the cleavage specificity brought about by TALEN pairs used to cleave wild-type mtDNA.
[0035] Figure 16This is an illustrative diagram showing the inhibition of TALEN nonspecific cleavage caused by amino acid modifications in the FokI region.
[0036] Figure 17 This is an illustrative diagram showing the effect of using mpTALEN, which is used to cleave mutant mtDNA, on the mutation rate change.
[0037] Figure 18 This is an illustrative diagram showing the effect of using mpTALEN, which is used to cleave wild-type mtDNA, on the mutation rate change. Detailed Implementation
[0038] The inventors of this application attempted to design, as described in the embodiments below, a TAL effector nuclease (hereinafter also referred to as "TALEN") pair that specifically binds to and cleaves mtDNA associated with mitochondrial disease-induced mutations. They found that by using an RVD that recognizes the bases of the target mtDNA sequence, specifically targeting a mitochondrial disease-induced mutation site, which differs from commonly used RVDs, the cleavage specificity of mtDNA brought about by the TALEN pair could be improved, thus completing the invention of this application. The inferred mechanism for improving cleavage specificity is not yet clear, but it is speculated to be as follows: It is believed that by using an RVD different from commonly used RVDs to recognize the bases of the point mutation sites inducing mitochondrial diseases, thereby adjusting the binding affinity of the bases to TALEN, the TALEN pair can bind more specifically to mtDNA, thus improving cleavage specificity.
[0039] According to one embodiment of this disclosure, a TAL effector nuclease pair is provided. The TALEN pair comprises a first TALEN monomer and a second TALEN monomer. The first TALEN monomer and the second TALEN monomer each have: a DNA-binding domain comprising repeat variable di-residues (RVD), and a DNA-cutting domain of a FokI endonuclease. It should be noted that the DNA-binding domain is also referred to as TALE.
[0040] Figure 1This is a schematic diagram illustrating the cleavage of DNA by TALEN. The TALEN monomer consists of a single polypeptide chain. A first TALEN monomer binds its DNA-binding domain to a target sequence on the sense strand, and a second TALEN monomer binds its DNA-binding domain to a target sequence on the antisense strand. RVDs are, for example, variable sites in a repeating unit of 20-34 amino acids, generally corresponding to amino acid residues at positions 12 and 13 of that repeating unit. Each RVD recognizes one base, thereby binding the DNA-binding domain to the target sequence. The DNA-binding domains of the first and second TALEN monomers in this disclosure specifically bind to target mtDNA sequences of 8-15 bases, respectively, based on the RVDs of the modules contained in the TALEN. The DNA-binding domain of the first TALEN monomer more preferably specifically binds to target mtDNA sequences of 9-13 bases, more preferably specifically binds to target mtDNA sequences of 10-12 bases, and even more preferably specifically binds to target mtDNA sequences of 10-11 bases. The DNA-binding domain of the second TALEN monomer more preferably specifically binds to a target mtDNA sequence of 9-14 bases, further preferably to a target mtDNA sequence of 11-14 bases, and even more preferably to a target mtDNA sequence of 11-12 bases. The length of the target mtDNA sequence specifically bound by the DNA-binding domains of the first and second TALEN monomers is more preferably 9-13 bases for the first TALEN monomer and 9-14 bases for the second TALEN monomer, further preferably 10-12 bases for the first TALEN monomer and 11-14 bases for the second TALEN monomer, and even more preferably 10-11 bases for the first TALEN monomer and 11-12 bases for the second TALEN monomer. In this disclosure, the target sequence of the first TALEN monomer and the target sequence of the second TALEN monomer are spaced 12-20 bases apart. The target sequence of the first TALEN monomer and the target sequence of the second TALEN monomer are preferably separated by 12 to 15 bases, more preferably by 12 to 14 bases, and even more preferably by 13 bases. In other words, the spacer of the TALEN pair disclosed herein is 12 to 20 bases, preferably 12 to 15 bases, more preferably 12 to 14 bases, and even more preferably 13 bases. In this spacer, the DNA cleaving domains of the FokI endonuclease in the first and second TALEN monomers are opposite each other to form a dimer, which can cleave double-stranded DNA.
[0041] The TALEN disclosed herein can alter the ratio of mutant mtDNA to wild-type mtDNA by binding to and cleaving mtDNA. As a result, it can be used to reproduce the symptoms of mitochondrial diseases caused by mutant mtDNA, and holds promise for elucidating symptoms and developing treatments. Mitochondrial diseases caused by mutant mtDNA are not particularly limited, and examples include mitochondrial encephalomyopathy with hyperlactatemia and stroke-like episodes (MELAS), myoclonic epilepsy with broken red fiber syndrome (MERRF), chronic progressive ophthalmoplegia (CPEO), Leigh encephalopathy, Leber hereditary optic neuropathy (LHON), Kearns-Sayre syndrome (KSS), Pearson syndrome (PS), and mitochondrial diabetes. Among these, MELAS and mitochondrial diabetes are preferred examples.
[0042] The mutated mtDNA is not particularly limited to any mtDNA with a base sequence mutation that is a factor in the pathogenesis of mitochondrial diseases. The TALEN disclosed herein specifically binds to and cleaves mtDNA associated with mitochondrial disease-inducing mutations whose pre-mutated base (wild-type) is A (adenine) or G (guanine). Mitochondrial disease-inducing mutations whose pre-mutated base is A are not particularly limited; for example, in the case of humans, examples include A608G, A1116G, A1555G, A1640G, A3243G, A3251G, A3252G, A3260G, A3274G, A3280G, A3288G, A3302G, A3995G, A4136G, A4267G, A4269G, and A4295G. Models include A4300G, A4317G, A4917G, A7443G, A7543G, A7445G, A8296G, A8326G, A8344G, A8348G, A9016G, A10543G, A11084G, A12146G, A12320G, A12770G, A13514G, A13528G, A14495G, A15579G, and A15923G.The mutations induced by mitochondrial diseases, where the pre-mutant base is G, are not specifically limited. For example, in humans, examples include G583A, G611A, G617A, G1606A, G1642A, G1644A, G3196A, G3242A, G3244A, G3249A, G3255A, G3376A, G3380A, G3460A, G3635A, and G. 3697A, G3700A, G3733A, G3946A, G3959A, G4284A, G4298A, G4309A, G4332A, G4450A, G52 44A, G5521A, G5532A, G5540A, G5549A, G5703A, G5920A, G5968A, G6708A, G6930A, G7023A , G7497A, G7896A, G8313A, G8328A, G8342A, G8361A, G8363A, G9438A, G9952A, G10197A, G11778A, G11832A, G12147A, G12183A, G12207A, G12315A, G12294A, G13042A, G13051A, G13513A, G13730A, G14279A, G14453A, G14459A, G14846A, G15059A, G15084A, G15150A, G15168A, G15242A, G15243A, G15498A, G15615A, G15723A, G15762A, G15915A, G15995A, etc. Mutated mtDNA typically contains one type of base sequence mutation, but can also contain two or more.
[0043] In the above description of mutations, the first letter indicates the base before the mutation, the middle number indicates the base position of the mutated object, i.e., the base number of the mtDNA, and the last letter indicates the base after the mutation. The sequence of human wild-type mtDNA is represented by accession number NC_012920.1 in the Reference Sequence database GenBank (registered trademark) published by NCBI (National Center for Biological Information).
[0044] The DNA-binding domains of the first and second TALEN monomers each contain an RVD that recognizes a base at a mitochondrial disease-induced mutation site and a second RVD that recognizes a base other than a mitochondrial disease-induced mutation site. In this disclosure, amino acid residues in the amino acid sequence are represented by single letters representing the amino acid. That is, A represents alanine, R represents arginine, N represents asparagine, D represents aspartic acid, C represents cysteine, Q represents glutamine, E represents glutamic acid, G represents glycine, H represents histidine, I represents isoleucine, L represents leucine, K represents lysine, M represents methionine, F represents phenylalanine, P represents proline, S represents serine, T represents threonine, W represents tryptophan, Y represents tyrosine, and V represents valine.
[0045] The first RVD is at least one of NM (asparagine-methionine) which recognizes adenine, WK (tryptophan-lysine) which recognizes guanine, and LK (leucine-lysine) which recognizes guanine. Therefore, in the TALEN pair used to cleave mutant mtDNA with a base of G before the mutation and an A base after the mutation, NM recognizes adenine. Similarly, in the TALEN pair used to cleave wild-type mtDNA associated with mitochondrial disease-induced mutations with a base of A before the mutation and a base of G after the mutation, NM also recognizes adenine. Additionally, in the TALEN pair used to cleave mutant mtDNA with a base of A before the mutation and a base of G after the mutation, WK or LK recognizes guanine. Similarly, in the TALEN pair used to cleave wild-type mtDNA associated with mitochondrial disease-induced mutations with a base of G before the mutation and a base of A after the mutation, WK or LK also recognizes guanine.
[0046] The second RVD that recognizes bases other than those induced by mitochondrial disease mutations is equivalent to the commonly used RVD. The second RVD recognizes adenine by NI (asparagine-isoleucine) and guanine by NN (asparagine-asparagine). Additionally, the second RVD recognizes cytosine by HD (histidine-aspartic acid) and thymine by NG (asparagine-glycine). Therefore, in the TALEN pairs disclosed herein, bases at mitochondrial disease-induced mutation sites are recognized by NM, WK, or LK, while bases other than those induced by mitochondrial disease mutation sites are recognized by NI, NN, HD, and NG.
[0047] In the case of mitochondrial disease-induced mutation to A3243G mutation, the RVD in the first TALEN monomer is preferably any one of NN-NN-HD-NI-NN-WK-NN-HD―HD-HD, NN-NN-HD-NI-NN-LK-NN-HD―HD-HD, NN-NN-HD-NI-NN-NM-NN-HD―HD-HD, NN-NN-HD-NI-NN-WK-NN-HD―HD-HD-NN, NN-NN-HD-NI-NN-LK-NN-HD―HD-HD-NN and NN-NN-HD-NI-NN-NM-NN-HD―HD-HD-NN, more preferably any one of NN-NN-HD-NI-NN-WK-NN-HD―HD-HD-NN, NN-NN-HD-NI-NN-LK-NN-HD―HD-HD-NN and NN-NN-HD-NI-NN-NM-NN-HD―HD-HD-NN. The RVD in the second TALEN monomer paired with such a first TALEN monomer is preferably NI-NI-NI-NN-NG-NG-NG-NG-NI-NI-NN-NG, NI-NI-NI-NN-NG-NG- NG-NG-NI-NI-NN, NN-NG-NI-NI-NI-NN-NG-NG-NG-NG-NI-NI-NN and NN-NG-NI-NI-NI-NN-NG-NG-NG-NG-NI-N Any one of I-NN-NG, more preferably NI-NI-NI-NN-NG-NG-NG-NG-NI-NI-NN-NG, NI-NI-NI-NN-NG-NG-NG-NG-NI-NI-NN and NN Any one of -NG-NI-NI-NI-NN-NG-NG-NG-NG-NI-NI-NN-NG, more preferably NI-NI-NI-NN-NG-NG-NG-NG-NI-NI-NN-NG. The above descriptions of RVD all indicate that the sequence from the N-terminus to the C-terminus binds along the 5'-3' direction of the mtDNA target sequence.
[0048] In the DNA-binding domains of both the first and second TALEN monomers, the amino acid sequence other than RVD in the repeat units can be designed based on publicly available information. For example, the Platinum TALEN design method can be used.
[0049] In this disclosure, the FokI endonuclease DNA cleaving domains of the first TALEN monomer and the second TALEN monomer preferably have different amino acid sequences and form heterodimers. According to this configuration, even when the first TALEN monomers or the second TALEN monomers form homodimers with each other, no DNA cleavage activity is exhibited, thus suppressing non-specific DNA cleavage. The FokI endonuclease DNA cleaving domains of the first TALEN monomer and the second TALEN monomer preferably contain three amino acid mutations relative to the wild-type amino acid sequence shown in Serial No. 16. There are no particular limitations on the three amino acid mutations relative to the wild-type, but preferably one of the FokI endonuclease DNA cleavage domains contains a so-called KKR mutation, and the other contains a so-called ELD mutation. The KKR mutation refers to the mutations E109K, H156R, and I157K in the DNA cleavage domain of the FokI endonuclease, as shown in sequence number 17. The ELD mutation refers to the mutations Q105E, N115D, and I118L in the DNA cleavage domain of the FokI endonuclease, as shown in sequence number 18. In the above descriptions of mutations, the first letter indicates the amino acid residue before the mutation, the middle number indicates the amino acid number in the DNA cleavage domain of the FokI endonuclease, and the last letter indicates the amino acid residue after the mutation.
[0050] In the case of mitochondrial disease-induced mutation to be A3243G mutation, the first TALEN monomer is preferably one of the following: the amino acid sequence shown in any one of sequence numbers 1 to 3, the amino acid sequence having more than 90% homology with the amino acid sequence shown in any one of sequence numbers 1 to 3, and the amino acid sequence in which one or more amino acid residues are missing, substituted, or added. Furthermore, the second TAL effector nuclease monomer is preferably any one of the amino acid sequences shown in any one of Serial No. 4, Serial No. 19, and Serial No. 20, an amino acid sequence having more than 90% homology with the amino acid sequence shown in any one of Serial No. 4, Serial No. 19, and Serial No. 20, or an amino acid sequence in which one or more amino acids are missing, substituted, or added, and more preferably any one of the amino acid sequences shown in Serial No. 4, an amino acid sequence having more than 90% homology with the amino acid sequence shown in Serial No. 4, or an amino acid sequence in which one or more amino acids are missing, substituted, or added, and more preferably any one of the amino acid sequences shown in Serial No. 4, an amino acid sequence having more than 90% homology with the amino acid sequence shown in Serial No. 4, and an amino acid sequence in which one or more amino acids are missing, substituted, or added, and more preferably any one of the amino acid sequences shown in Serial No. 4.
[0051] In this disclosure, the "homology" of an amino acid sequence refers to the maximum homology (%) of the sequences obtained by aligning two compared sequences by introducing gaps as needed (sequence alignment). The homology of amino acid sequences can be calculated, for example, using blastn from NCBI BLAST (http: / / blast.ncbi.nlm.nih.gov / ) with the BLAST algorithm installed. In this disclosure, from the viewpoint of suppressing specificity reduction, the homology of the amino acid sequences is preferably 92% or more, more preferably 94% or more, further preferably 95% or more, even more preferably 96% or more, still more preferably 97% or more, particularly more preferably 98% or more, and especially preferably 99% or more.
[0052] In this disclosure, "one or more amino acid residues" is preferably 1 to 10 amino acid residues, more preferably 1 to 8 amino acid residues, even more preferably 1 to 6 amino acid residues, and even more preferably 1 to 3 amino acid residues. The deletion, substitution, or addition of amino acid residues is preferably in a region far from the coding region of RVD and the region encoding the active site of the FokI endonuclease. Furthermore, the substitution of amino acid residues is preferably a conservative substitution to an amino acid having a similar side chain. Examples of conservative substitutions include, for instance, substitutions of amino acid residues with basic side chains such as K, R, and H; substitutions of amino acid residues with acidic side chains such as D and E; substitutions of amino acid residues with non-electrolyzed polar side chains such as G, N, Q, S, T, Y, and C; substitutions of amino acid residues with non-polar side chains such as A, V, L, I, P, F, M, and W; substitutions of amino acid residues with β-branched side chains such as T, V, and I; and substitutions of amino acid residues with aromatic side chains such as Y, F, W, and H.
[0053] The first and second TALEN monomers constituting the TALEN pair of this disclosure can be chemically modified, provided that they have the activity of specifically cleaving mutant mtDNA or wild-type mtDNA when paired.
[0054] For example, the C-terminus of the first and second TALEN monomers can also be a carboxyl group (-COOH), a carboxylic acid ester (-COO-), an amide (-CONH2), an ester (-COOR), etc. The R group in the ester is not particularly limited; for example, it can be methyl, ethyl, n-propyl, isopropyl, n-butyl, etc. 1-6 Alkyl groups; cyclopentyl, cyclohexyl, etc. (C60) 3-8 Cycloalkyl; phenyl, α-naphthyl, etc. C 6-12 Aryl; benzyl, phenethyl and other phenyl-C 1-2 Alkyl groups; α-naphthylmethyl and other α-naphthyl-C 1-2 Alkyl and other C7-14 Aryl groups; neopentyloxymethyl groups, etc. Additionally, for example, the carboxyl groups (or carboxylic acid esters) other than the C-terminus of the first and second TALEN monomers may be amidated or esterified. The ester used in this case is not particularly limited; for example, it may be the same ester as the C-terminus described above.
[0055] Furthermore, for example, the N-terminal amino groups of the first and second TALEN monomers can be protected by protecting groups, or they can be N-terminal glutamine residues that have undergone pyroglutamylation and can be cleaved in vivo. Additionally, for example, the substituents on the side chains of the amino acids within the first and second TALEN monomers can be protected by protecting groups, or they can be complex proteins such as so-called glycoproteins that have incorporated sugar chains. The substituents mentioned above are not particularly limited; examples include -OH, -SH, amino, imidazole, indole, guanidinyl, etc. The protecting groups mentioned above are not particularly limited; examples include formyl, acetyl, etc. 1-6 alkyl acyl and other C 1-6 Acyl groups, etc.
[0056] Furthermore, for example, the first and second TALEN monomers may be attached with known protein tags, signal sequences, or other polypeptides. As for protein tags, there are no particular limitations; examples include biotin, His tags, FLAG tags, Halo tags, MBP tags, HA tags, Myc tags, V5 tags, and PA tags. As for signal sequences, there are no particular limitations; examples include MTS (mitochondrial targeting sequence). From the viewpoint of enabling them to function within mitochondria, the first and second TALEN monomers preferably have an MTS attached, more preferably an MTS attached to the N-terminus. Furthermore, from the same viewpoint, it is preferable that they do not contain nuclear localization signals.
[0057] Furthermore, for example, the first and second TALEN monomers can also be pharmaceutically acceptable salts of acids or bases. There are no particular limitations on the type of salt, as long as it is pharmaceutically acceptable; it can be either an acidic salt or a basic salt. As an acidic salt, there are no particular limitations; examples include inorganic acid salts such as hydrochloride, hydrobromide, sulfate, nitrate, and phosphate; organic acid salts such as acetate, propionate, tartrate, fumarate, maleate, malate, citrate, methanesulfonate, and p-toluenesulfonate; and amino acid salts such as aspartate and glutamate. As a basic salt, there are no particular limitations; examples include alkali metal salts such as sodium and potassium salts; and alkaline earth metal salts such as calcium and magnesium salts. Furthermore, for example, the first and second TALEN monomers can be in the form of a solvate. As a solvent, there are no particular limitations, as long as it is pharmaceutically permissible; examples include water, ethanol, glycerol, and acetic acid.
[0058] According to another aspect of this disclosure, a nucleic acid composition is provided. The nucleic acid composition comprises a first nucleic acid encoding a first TAL effector nuclease monomer and a second nucleic acid encoding a second TAL effector nuclease monomer, wherein the target sequence of the first TAL effector nuclease monomer is spaced 12-20 bases from the target sequence of the second TAL effector nuclease monomer. The first and second TAL effector nuclease monomers each have: a DNA-binding domain containing an RVD that binds to DNA of 8-15 bases, and a DNA-cutting domain of a FokI endonuclease; the RVD comprises a first RVD recognizing a mitochondrial disease-inducing mutation site and a second RVD recognizing bases other than the mitochondrial disease-inducing mutation site, wherein the first RVD is at least one of NM recognizing adenine, WK recognizing guanine, and LK recognizing guanine, and the second RVD recognizes adenine by NI and guanine by NN.
[0059] In this disclosure, the first and second nucleic acids are preferably mRNA. In addition to the sequences encoding the first or second TAL effector nuclease monomer, the first and second nucleic acids may also contain, for example, signal sequences, promoters, etc., and preferably include MTS as a signal sequence. The promoter is not particularly limited; for example, it can be a pol II lineage promoter. Examples of pol II lineage promoters include CMV promoters, EF1 promoters, SV40 promoters, MSCV promoters, hTERT promoters, β-actin promoters, and CAG promoters.
[0060] The first and second nucleic acids can contain multiple cloning sites (MCS), drug resistance genes, origins of replication, etc., as needed. For example, in a configuration where the first and second nucleic acids are sequentially configured with the coding sequences of a promoter, a first TAL effector nuclease monomer, or a second TAL effector nuclease monomer starting from the 5' side, the MCS can be positioned between the promoter and the coding sequence, on the 3' side of the coding sequence. The MCS is preferably positioned adjacent to the promoter and the coding sequence. There are no particular limitations as long as the MCS contains multiple restriction enzyme sites; for example, it is preferred to contain 2 to 50, more preferably 2 to 20, and more preferably 2 to 10 restriction enzyme sites. As for drug resistance genes, there are no particular limitations; examples include ampicillin resistance genes, chloramphenicol resistance genes, tetracycline resistance genes, neomycin resistance genes, erythromycin resistance genes, spectinomycin resistance genes, kanamycin resistance genes, hygromycin resistance genes, and puromycin resistance genes. It should be noted that the first and second nucleic acids can be composed of different nucleic acids, or they can be composed of a single nucleic acid containing both the first and second nucleic acids.
[0061] According to another aspect of this disclosure, a vector comprising the above-described nucleic acid composition can be provided. The vector is not particularly limited; examples include plasmid vectors such as animal cell expression plasmids; viral vectors such as retroviruses, lentiviruses, adenoviruses, adeno-associated viruses, herpesviruses, and Sendai viruses; and Agrobacterium vectors.
[0062] According to another aspect of this disclosure, a pharmaceutical composition comprising the aforementioned TALEN pairs, the aforementioned nucleic acid composition, or the aforementioned carrier can be provided. The pharmaceutical composition can be formulated by appropriately combining pharmaceutically acceptable carriers or additives. Specifically, it can be formulated into oral dosage forms such as tablets, coated tablets, pills, powders, granules, capsules, liquids, suspensions, and emulsions; and non-oral dosage forms such as injections, infusions, suppositories, ointments, and patches. The proportions of carriers or additives can be appropriately set based on the ranges commonly used in the pharmaceutical industry. There are no particular limitations on carriers or additives; examples include various carriers, excipients, binders, solubilizers, prosolvents, salt-forming agents, salts, buffers, viscosity modifiers, hardness modifiers, pH adjusters, gelling agents, emulsifiers, solubilizers, wetting agents, dispersants, disintegrants, absorption promoters, lubricants, antioxidants, preservatives, fillers, colorants, flavoring agents, fragrances, and adjuvants.
[0063] The pharmaceutical composition disclosed herein can, for example, reduce the proportion of mutant mtDNA in heterogeneous mtDNA by specifically binding to and cleaving mutant mtDNA. As a result, it can inhibit the onset of mitochondrial diseases and therefore holds promise as a preventative agent for mitochondrial diseases. Furthermore, as a result of reducing the proportion of mutant mtDNA, it holds promise as a therapeutic agent for mitochondrial diseases. It should be noted that the treatment of mitochondrial diseases includes delaying the progression of the disease.
[0064] According to another aspect of this disclosure, a method for the prevention or treatment of mitochondrial diseases can be provided. The method includes administering the aforementioned pharmaceutical composition to a subject having a mitochondrial disease-inducing mutation containing either a wild-type A-base-changed G-base-changed or a wild-type G-base-changed A-base-changed mitochondrial disease-inducing mutation in mtDNA.
[0065] Example
[0066] The present invention will now be described in more detail with reference to embodiments, but the present invention is not limited to the following embodiments.
[0067] 1. Samples and methods
[0068] (1) Preparation and culture of human iPS cells
[0069] Skin biopsy samples were obtained from diabetic patients with the A3243G mutation in mtDNA. The patients' fibroblasts were proliferated in DMEM medium containing 10% FBS and 1% antibiotic solution (Antibiotic Antimycotic Solution, Sigma). 5 × 10⁶ cells were then used to proliferate the cells. 5Fibroblasts were transformed using free vectors (pCXLE-hOCT3 / 4-shp53-F, Addgene #27077; pCXLE-hSK, #27078; pCXLE-hUL, #27080, provided by Shinya Yamanaka) with six reprogramming factors (SOX2, KLF4, OCT3 / 4, L-MYC, LIN28, and p53-shRNA). During transformation, Nucleofector 2b (manufactured by Lonza, a registered trademark) was used in conjunction with the Amaxa Human Dermal Fibroblast Nucleofector Kit (manufactured by Lonza, "Nucleofector" is a registered trademark). Seven days after introduction, the fibroblasts were seeded onto a mitomycin C-treated SNL feeder layer. The day after inoculation, the culture medium was replaced with primate iPS cell culture medium (Reprocell) supplemented with basic fibroblast growth factor (bFGF) (Fujifilm & Kogyo). Several weeks later, the observed multiple ESC-like colonies (iPS cell colonies) were mechanically dissected and transferred to new culture plates. It should be noted that when collecting iPS cell colonies, they were treated with CTK solution containing 0.1 mg / mL collagenase IV (Gibco), 0.25% trypsin (Gibco), 0.1 mM calcium chloride (Wako), and 20% KSR (Gibco).
[0070] (2) DNA isolation
[0071] Genomic DNA containing mtDNA was isolated from fibroblasts and iPS cells using NucleoSpin Tissue XS (Macherey-Nagel) according to the manufacturer's specifications.
[0072] (3) Analysis of mtDNA heterogeneity based on PCR-RFLP
[0073] DNA was amplified using a primer set consisting of Mt3150-F primers (Sequence No. 5: TACTTCACAAAGCGCCTTCC) and mt3294-R primers (Sequence No. 6: AGGAATTGAACCTCTGACTG). PCR conditions were as follows: 35 cycles of 94℃ for 1 min, 94℃ for 30 s, 57℃ for 30 s, and 72℃ for 30 s. In the presence of the A3243G mutation, the 145 bp PCR product was cleaved into two fragments, 95 bp and 50 bp, by the restriction endonuclease HaeIII (NEB). The PCR products digested with HaeIII were separated using a 3% agarose gel and stained with ethidium bromide. The signal intensity ratio was analyzed using ImageJ software (Windows version).
[0074] (4) Design of TAL effector nuclease pairs
[0075] TALEN pairs were designed for cleaving mutant mtDNA and TALEN pairs for cleaving wild-type mtDNA, respectively.
[0076] Figure 2 This is an illustrative diagram showing the RVD of the TALEN pair used to cleave mutant mtDNA in SSA detections 1 and 5, together with the target sequence. Figure 3 This is an illustrative diagram showing the RVD of the TALEN pair used to cleave wild-type mtDNA in SSA detections 1 and 5, together with the target sequence. Figure 4 This is an illustrative diagram showing the RVD of the TALEN pair used in SSA detections 2-4 together with the target sequence. Figures 2-4 For convenience, the bases at the mutation sites induced by mitochondrial diseases are indicated by arrows.
[0077] In the SSA assay described later, the RVD used to cleave the first TALEN monomer of the mutant mtDNA is as follows: Figure 2 The RVDs shown are labeled NN-NN-HD-NI-NN-LK-NN-HD-HD-HD-HD-NN (hereinafter, this monomer will also be referred to as "PL6LK") and NN-NN-HD-NI-NN-LK-NN-HD-HD-HD (hereinafter, this monomer will also be referred to as "CL6LK") from the N-terminus. The control RVDs are labeled NN-NN-HD-NI-NN-NN-NN-HD-HD-HD-HD-NN (hereinafter, this monomer will also be referred to as "PL") and NN-NN-HD-NI-NN-NN-NN-HD-HD-HD (hereinafter, this monomer will also be referred to as "CL"). The RVDs used to cleave the first TALEN monomer of wild-type mtDNA are as follows. Figure 3The RVD of the second TALEN monomer, starting from the N-terminus, is NN-NN-HD-NI-NN-NM-NN-HD-HD-HD-NN (hereinafter, this monomer will also be referred to as "PLW6NM"). The RVD of the control monomer, starting from the N-terminus, is NN-NN-HD-NI-NN-NI-NN-HD-HD-HD-NN (hereinafter, this monomer will also be referred to as "PLW"). The RVD of the second TALEN monomer is as follows: Figure 2 and Figure 3 The diagram shows the sequence from the N-terminal side as NN-NG-NI-NI-NI-NN-NG-NG-NG-NG-NI-NI-NN (hereinafter, this monomer will also be referred to as "MR").
[0078] In the SSA detection 2 and subsequent experiments described later, the RVD used to cleave the first TALEN monomer of the mutant mtDNA is as follows: Figure 2 and Figure 4 The monomer shown is NN-NN-HD-NI-NN-WK-NN-HD-HD-HD-NN (hereinafter, this monomer will also be referred to as "PL6WK") or PL6LK as described above, starting from the N-terminus. The RVD for the first TALEN monomer used to cleave wild-type mtDNA is as follows... Figure 3 and Figure 4 The image shows the aforementioned PLW6NM. The RVD of the second TALEN monomer is as follows... Figures 2-4 The monomers shown are, from the N-end side, NI-NI-NI-NN-NG-NG-NG-NG-NG-NI-NI-NN-NG (hereinafter, this monomer will also be referred to as "JR"), NI-NI-NI-NN-NG-NG-NG-NG-NI-NI-NN (hereinafter, this monomer will also be referred to as "OR"), NN-NG-NI-NI-NI-NN-NG-NG-NG-NG-NI-NI-NN-NG (hereinafter, this monomer will also be referred to as "QR"), or the aforementioned MR. In the following description, for TALEN pairs, monomers constructed as p["first TALEN monomer" / "second TALEN monomer"] will be used.
[0079] (5) Construction of TALEN expression plasmid
[0080] TALEN expression plasmids were constructed using the Platinum Gate TALEN kit (Platinum Gate TALEN kit, #1000000043, Addgene). The Golden Gate method was applied in both the 4-module assembly and the final TALEN vector assembly using the 4-module conjugation plasmids, as described in the manufacturer's specifications. The restriction endonuclease BsaI-HFv2 (NEB) was used in the first stage of Golden Gate cloning. During 4-module assembly, the p2NI vectors, specifically p2WK, p2LK, and p2NM vectors required for introducing WK, LK, and NM RVDs into the second module, were modified. DNA fragments containing RVD sequences modified to WK, LK, and NM (synthesized by Azenta) were introduced into p2NI vectors digested with HindIII and AgeI using the In-Fusion HD cloning kit (Clontech Laboratories). The target vector for expressing platinum TALEN (pTALEN) monomers has a +136 / +63 scaffold sequence under the control of the CAG promoter. The target vector for expressing mpTALEN monomers is modified with a mitochondrial target sequence (MTS) containing ATP5B and an N-terminal V5-tag. The target vector with the heterodimer FokI (ELD / KKR) scaffold sequence is prepared by modifying the mpTALEN target vector. A DNA fragment containing an ELD mutation, synthesized by Azenta, is inserted into the mpTALEN target vector digested with BamHI and BstXI using the In-Fusion HD cloning kit (ClontecH Laboratories).Three DNA fragments containing the KKR mutation were amplified by PCR using three primer sets: BamHI_Fok1_fwd (serial number 7: ACCACAGAAGGATCCCCGA) and K1-Fok1_rev (serial number 8: ATTTCCTTGACATAACGTTGCATCTC), K1-Fok2_fwd (serial number 9: TATGTCAAGGAAAATCAGACCAGGAAC) and R2K3-Fok2_rev (serial number 10: TTCGTCTTTCTATTCAACCGTGTGAGCTG), R2K3-Fok3_fwd (serial number 11: GAATAGAAAGACGAACTGCAATGGTGCG), and SexAI_Fok3_rev (serial number 12: ACTTTCCACACCTGGTTGCT). These fragments were then used in the In-Fusion HD Cloning Kit (Clontech). (Made by Laboratories) was inserted into the mpTALEN target vector digested by BamHI and SexAI.
[0081] (6) Immunocytochemical analysis
[0082] Immunohistochemical analysis confirmed that the TALEN monomer expressed by the prepared expression vector co-localized with the mitochondrial marker (Tom20) and was not observable in the cell nucleus. Immunohistochemical analysis was performed as follows: Cells were fixed in 4% paraformaldehyde / PBS for 30 min and incubated in PBS containing 0.2% Triton X-100 for 10 min. After blocking with 2% BSA / PBS for 1 hour, cells were incubated with primary antibody diluted in blocking buffer and washed with PBS. Finally, cells were incubated with secondary antibody, washed with PBS, and mounted using a ProLong Diamond Antifade Mountant (Molecular Probes) containing DAPI. Immunoreactive cells were visualized using an LSM710 Laser Scanning Microscope (Carl Zeiss) or a Biorevo BZ-9000 fluorescence microscope (Keyence).
[0083] (7) Detection using single-chain annealing (SSA) of HEK293T cells
[0084] Figure 5This is an illustrative diagram showing the overview of SSA detection. The DNA cleavage activity of TALEN pairs can be evaluated using SSA detection (Sakuma T, et al. (2013) Genes to cells: devoted to molecular & cellular mechanisms 18(4): 315-326.). Using primer sets of XmaI-A3243_F (Sequence No. 13: TTACCCGGGTATTATACCCACACCCACCC) and XmaI-A3243AWT_R3 (Sequence No. 14: TTACCCGGGTGAACCTCTGACTGTAAAGTTTTAAGTTTTATGCGATTACCGGGCT) or XmaI-A3243G_R3 (Sequence No. 15: TTACCCGGGTGAACCTCTGACTGTAAAGTTTTAAGTTTTATGCGATTACCGGGCC), a portion of the mtDNA sequence containing TALEN-targeted m.3243A or m.3243G was amplified by PCR and inserted into the XmaI site between the bisected luciferase elements of the pGL4-SSA reporter gene plasmid. Three plasmids—comprising a TALEN expression plasmid, a reporter gene plasmid, and a reference plasmid (pRL-CMV, Promega)—were introduced into HEK293T cells using Lipofectamine LTX (Invitrogen). Twenty-four hours after introduction, dual-luciferase assays were performed using a Dual-Luciferase assay system (Promega). Luminescence detection was performed using an ARVOX5 luminometer (Perkin-Elmer) or a VICTOR Nivo Multimode Microplate reader (Perkin-Elmer).
[0085] (8) Transfection and sorting
[0086] HEK293T and HeLa cells were transfected using Lipofectamine 3000 reagent (Invitrogen) according to the manufacturer's instructions. Patient-derived iPS cells with the m.3243A>G mutation were cultured without a feeder layer according to the method described in Nakagawa M, et al. (2014) Scientific reports 4:3594 for the introduction of the mpTALEN plasmid. After removing the feeder cells, the cells were cleaved into single cells by incubating 0.5× TrypLE Select (Gibco, TrypLE is a registered trademark) at 37°C for approximately 2 minutes. The resulting single cells were seeded in iMatrix-511 (Matrixome) coated culture dishes and cultured in StemFit AK02N medium (ReproCell). One day later, 1.67 μg each of pCAGGS-EGFP and mpTALEN plasmids were introduced into iPS cells using Lipofectamine 3000 reagent (Invitrogen) according to the manufacturer's specifications. Two days after introduction, cells were harvested and sorted using MofloAstrios (Beckman Coulter) equipped with Summit acquisition software (Beckman Coulter). After removing dead cells and debris stained with iodopropimidium (PI) solution (Dongjin Chemical Research Institute), the sorting gate was set based on forward and side scattering and EGFP expression levels. EGFP-positive and PI-negative cells were directly sorted into StemFit AK02N medium supplemented with 10 μM Y-27632 (Nacalai Tesque).
[0087] 2. Results
[0088] (1) SSA detection 1
[0089] Figure 6 This is an illustrative diagram showing the DNA cleavage activity of the TALEN pair used to cleave mutant mtDNA in SSA assay 1. Figure 7 This is an illustrative diagram showing the cleavage specificity of mutant mtDNA. Figure 6 and the following Figure 8 , Figures 10-13In this study, the cleavage activity of wild-type (WT) mtDNA containing m.3243A (hereinafter referred to as wild-type mtDNA cleavage activity) and the cleavage activity of mutant (MUT) mtDNA containing m.3243G (hereinafter referred to as mutant mtDNA cleavage activity) were shown for each TALEN pair used in the SSA assay. As TALEN pairs, combinations of PL6LK and MR (described as p[PL6LK / MR]), CL6LK and MR (described as p[CL6LK / MR]), PL and MR as controls (described as p[PL / MR]), and CL and MR as controls (described as p[CL / MR]) were used. Figure 6 and the following Figure 8 , Figures 10-13 In this context, "NC" indicates a negative control that does not contain TALEN pairs. Figure 6 The cleavage activity of p[PL6LK / MR] against mutant mtDNA is expressed as a relative value when the cleavage activity is set to 1. Figure 7 In this context, the cleavage specificity of the m.3243G mutant mtDNA is achieved through... Figure 6 The value shown is the result of dividing the cleavage activity of the mutant mtDNA by the cleavage activity of the wild-type mtDNA.
[0090] according to Figure 6 and Figure 7 The results show the following: In the control TALEN pairs (p[PL / MR] and p[CL / MR]), the cleavage activity against mutant mtDNA was not different from that against wild-type mtDNA. In contrast, p[PL6LK / MR] and p[CL6LK / MR] showed higher cleavage activity against mutant mtDNA compared to wild-type mtDNA, indicating high cleavage specificity against mutant mtDNA. Furthermore, the cleavage activity against mutant mtDNA in p[PL6LK / MR] and p[CL6LK / MR] was higher than that in p[PL / MR] and p[CL / MR].
[0091] Figure 8 This is an illustrative diagram showing the DNA cleavage activity of the TALEN pair used to cleave wild-type mtDNA in SSA assay 1. Figure 9 This is an illustrative diagram showing the cleavage specificity of wild-type mtDNA. As TALEN pairs, the combination of PLW6NM and MR (described as p[PLW6NM / MR]) was used, and as a control, the combination of PLW and MR (described as p[PLW / MR]) was used. Figure 8 In this context, the cleavage activity of p[PLW6NM / MR] against wild-type mtDNA is represented by a relative value of 1. Figure 9 In this context, the cleavage specificity of m.3243A wild-type mtDNA is achieved through... Figure 8 The value is represented by dividing the cleavage activity of wild-type mtDNA by the cleavage activity of mutant mtDNA.
[0092] according to Figure 8 and Figure 9 The results show that, compared to the control TALEN pair (p[PLW / MR]), p[PLW6NM / MR] exhibits higher cleavage specificity and activity against wild-type mtDNA.
[0093] Based on the results of SSA assay 1 described above, it is shown that by using a TALEN pair that identifies the site of point mutations inducing mitochondrial diseases using a different RVD than the commonly used RVD, the cleavage specificity for mutant or wild-type mtDNA can be improved. Furthermore, it is shown that the cleavage activity for mutant or wild-type mtDNA can be enhanced.
[0094] (2) SSA detection 2
[0095] Figure 10 This is an explanatory diagram showing the results of SSA detection 2. In Figure 10 The diagram shows the DNA cleavage activity and cleavage specificity of the TALEN pair used to cleave mutant mtDNA. Figure 10 In this context, DNA cleavage activity is represented by the relative value when the cleavage activity of p[PL6LK / MR] against mutant mtDNA is set to 1, and cleavage specificity is represented by the value obtained by dividing the cleavage activity of mutant mtDNA by the cleavage activity of wild-type mtDNA. According to... Figure 10 The results show that using OR and JR as the second TALEN monomers in the TALEN pair for cleaving mutant mtDNA provides the same excellent cleavage specificity for mutant mtDNA as using MR. Furthermore, using OR and JR as the second TALEN monomers further improves the cleavage specificity for mutant mtDNA compared to using MR.
[0096] (3) SSA detection 3
[0097] Figure 11 This is an explanatory diagram showing the results of SSA detection 3. In Figure 11 The diagram shows the DNA cleavage activity and cleavage specificity of the TALEN pair for cleaving wild-type mtDNA. Figure 11In this context, DNA cleavage activity is represented by the relative value when the cleavage activity of p[PLW6NM / MR] against wild-type mtDNA is set to 1, and cleavage specificity is represented by the value obtained by dividing the cleavage activity of wild-type mtDNA by the cleavage activity of mutant mtDNA. According to... Figure 11 The results show that using QR or JR as the second TALEN monomer in the TALEN pair for cleaving wild-type mtDNA provides the same excellent cleavage specificity for wild-type mtDNA as using MR. Furthermore, using QR or JR as the second TALEN monomer further improves the cleavage specificity for wild-type mtDNA compared to using MR, with JR exhibiting particularly excellent cleavage specificity.
[0098] (4) SSA detection 4
[0099] Figure 12 This is an explanatory diagram showing the results of SSA detection 4. In Figure 12 The diagram shows the DNA cleavage activity and cleavage specificity of the TALEN pair for cleaving wild-type mtDNA. Figure 12 In this context, DNA cleavage activity is represented by the relative value when the cleavage activity of p[PLW6NM / MR] against wild-type mtDNA is set to 1, and cleavage specificity is represented by the value obtained by dividing the cleavage activity of wild-type mtDNA by the cleavage activity of mutant mtDNA. According to... Figure 12 The results show that when OR is used as the second TALEN monomer, the cleavage specificity is just as excellent as when JR is used.
[0100] (5) SSA detection 5
[0101] Figure 13 This is an illustrative diagram showing the results of SSA detection 5 for cleavage activity. PL6WK, PL6LK, or PLW6NM are used in combination with JR as TALEN pairs. In the following description, monomers with ELD or KKR mutations in the DNA cleavage domain are marked as "-ELD" or "-KKR" at the end of the monomer. Figure 13 The cleavage activity of p[PL6LK / JR] against mutant mtDNA is expressed as a relative value when the cleavage activity is set to 1.
[0102] Figure 14 This is an illustrative diagram showing the cleavage specificity brought about by TALEN pairs used to cleave mutant mtDNA. Figure 15 This is an illustrative diagram showing the cleavage specificity achieved by TALEN pairs used to cleave wild-type mtDNA. Figure 14 In this study, the cleavage specificity of the m.3243G mutant mtDNA was determined by... Figure 13The value shown is the result of dividing the cleavage activity of the mutant mtDNA by the cleavage activity of the wild-type mtDNA. Figure 15 In this study, the cleavage specificity of m.3243A wild-type mtDNA was determined by... Figure 13 The value is represented by dividing the cleavage activity of wild-type mtDNA by the cleavage activity of mutant mtDNA.
[0103] according to Figures 13-15 The results shown indicate the following: Specifically, the TALEN pairs used for cleaving mutant mtDNA (p[PL6LK / JR], p[PL6LK-ELD / JR-KKR], p[PL6WK / JR], p[PL6WK-ELD / JR-KKR]) exhibit higher cleavage activity against mutant mtDNA compared to their activity against wild-type mtDNA. Similarly, the TALEN pairs used for cleaving wild-type mtDNA (p[PLW6NM / JR], p[PLW6NM-ELD / JR-KKR]) also exhibit higher cleavage activity against wild-type mtDNA compared to their activity against mutant mtDNA. Therefore, it is demonstrated that the TALEN pairs according to this disclosure can more specifically cleave either mutant mtDNA or wild-type mtDNA. Specifically, it was demonstrated that combining monomers with the ELD mutation in the DNA cleavage domain of the FokI endonuclease with monomers with the KKR mutation further enhanced the specificity of TALEN pairs in which the FokI endonuclease forms heterodimers. On the other hand, it was found that TALEN pairs formed by TALEN monomers with the ELD mutation (p[PL6WK-ELD / JR-ELD]) did not form dimers of the enzymatically active FokI endonuclease, exhibiting extremely low cleavage activity.
[0104] (6) Changes in the mutation rate of mpTALEN in MELAS-iPS cells
[0105] Figure 16 This is an illustrative diagram showing the inhibition of non-specific TALEN cleavage through amino acid modification of the FokI region. Figure 16 The diagram schematically illustrates the structures of Lv-mpTALEN without mutation in the DNA cleavage domain of the FokI endonuclease, Lv-mpTALEN-ELD with the ELD mutation, and Lv-mpTALEN-KKR with the KKR mutation as TALEN monomers used in the examples. Figure 16As shown, homodimers formed by monomers without mutations in the FokI region and heterodimers formed by monomers with ELD and KKR mutations in the FokI region both possess enzymatic activity. Conversely, homodimers formed by monomers with ELD and KKR mutations in the FokI region do not possess enzymatic activity. Therefore, by introducing an ELD mutation into one monomer and a KKR mutation into the other of the TALEN pair, it is hoped that non-specific cleavage of mtDNA can be inhibited.
[0106] Figure 17 This is an illustrative diagram showing the effect of using mpTALEN, which is used to cleave mutant mtDNA, on the mutation rate change. Figure 18 This is an illustrative diagram showing the effect of using mpTALEN, which is used to cleave wild-type mtDNA, on the mutation rate change. Figure 17 and Figure 18 The table shows the A3243G mutation rate (%) in MELAS-iPS cells on day 2 (day 2) and day 10 (day 10) after mpTALEN plasmid insertion for each TALEN pair used in the study. It should be noted that... Figure 17 and Figure 18 In the figure, MELAS-iPS cells on day 2 without the mpTALEN plasmid were considered as untreated cells, and the A3243G mutation rate (%) in the untreated cells was represented by the dashed line.
[0107] according to Figure 17 and Figure 18 The results shown indicate the following: Specifically, by introducing the mpTALEN plasmid, which expresses the TALEN pair for cleaving mutant mtDNA, to specifically cleave mutant mtDNA, a decrease in the A3243G mutation rate was observed compared to untreated cells. Similarly, by introducing the mpTALEN plasmid, which expresses the TALEN pair for cleaving wild-type mtDNA, to specifically cleave wild-type mtDNA, an increase in the A3243G mutation rate was observed compared to untreated cells. Therefore, according to the TALEN pairs, nucleic acid compositions, and vectors of this disclosure, one of mutant mtDNA and wild-type mtDNA can be cleaved more specifically, resulting in an ability to alter the mutation rate in mtDNA. It should be noted that, similar to the results of SSA assay 5, no mtDNA cleavage occurred in the TALEN pairs formed by the TALEN monomers with the ELD mutation, as no dimer of the enzymatically active FokI endonuclease was formed, and the A3243G mutation rate was the same as in untreated cells.
[0108] This invention is not limited to the embodiments described above, and can be implemented with various configurations without departing from its spirit. For example, the technical features in the embodiments and examples corresponding to the technical features described in the summary section of the invention can be appropriately replaced or combined to solve part or all of the above-described problems, or to achieve part or all of the above-described effects. Furthermore, any technical feature that is not required to be described in this specification can be appropriately omitted.
Claims
1. A TAL effector nuclease pair, comprising a first TAL effector nuclease monomer and a second TAL effector nuclease monomer, The target sequence of the first TAL effector nuclease monomer is 12 to 20 bases away from the target sequence of the second TAL effector nuclease monomer; The first TAL effector nuclease monomer and the second TAL effector nuclease monomer each have: DNA-binding domains containing RVD that bind to DNA of 8–15 bases, and The DNA cleavage domain of FokI endonuclease; The RVD includes: The first RVD that identifies the bases at mitochondrial disease-induced mutation sites, and The second RVD identifies bases other than the mitochondrial disease-induced mutation site; The first RVD is at least one of NM (adenine-recognizing), WK (guanine-recognizing), and LK (guanine-recognizing). The second RVD recognizes adenine by NI and guanine by NN.
2. The TAL effector nuclease pair according to claim 1, wherein, The first TAL effector nuclease monomer and the second TAL effector nuclease monomer each have a DNA cleavage domain of the FokI endonuclease with different amino acid sequences, forming a heterodimer.
3. The TAL effector nuclease pair according to claim 1, which binds to mutant mitochondrial DNA.
4. The TAL effector nuclease pair according to claim 1, which binds to wild-type mitochondrial DNA.
5. The TAL effector nuclease pair according to claim 1, wherein, The mitochondrial disease-induced mutation is the A3243G mutation.
6. The TAL effector nuclease pair according to claim 5, wherein, The RVD in the first TAL effector nuclease monomer is any one of NN-NN-HD-NI-NN-WK-NN-HD―HD-HD-NN, NN-NN-HD-NI-NN-LK-NN-HD―HD-HD-NN, and NN-NN-HD-NI-NN-NM-NN-HD―HD-HD-NN.
7. The TAL effector nuclease pair according to claim 5, wherein, The RVD in the second TAL effector nuclease monomer is any one of NI-NI-NI-NN-NG-NG-NG-NG―NI-NI-NN-NG, NI-NI-NI-NN-NG-NG-NG―NI-NI-NN, and NN-NG-NI-NI-NI-NN-NG-NG-NG―NI-NI-NN-NG.
8. The TAL effector nuclease pair according to claim 5, wherein, The first TAL effector nuclease monomer is any one of the following amino acid sequences: The amino acid sequence shown in any one of sequence numbers 1 to 3, Amino acid sequences that have more than 90% homology with the amino acid sequences shown in any one of sequence numbers 1 to 3, and An amino acid sequence in which one or more amino acid residues are missing, substituted, or added in any one of the amino acid sequences shown in sequence numbers 1 to 3. The second TAL effector nuclease monomer is any one of the following amino acid sequences: The amino acid sequence represented by any one of sequence numbers 4, 19, and 20 Amino acid sequences that share more than 90% homology with any one of the amino acid sequences shown in sequence number 4, sequence number 19, and sequence number 20, and An amino acid sequence in which one or more amino acids are missing, substituted, or added in any of the amino acid sequences shown in sequence number 4, sequence number 19, or sequence number 20.
9. A nucleic acid composition comprising a first nucleic acid encoding a first TAL effector nuclease monomer and a second nucleic acid encoding a second TAL effector nuclease monomer. The target sequence of the first TAL effector nuclease monomer is 12 to 20 bases away from the target sequence of the second TAL effector nuclease monomer; The first TAL effector nuclease monomer and the second TAL effector nuclease monomer each have: DNA-binding domains containing RVD that bind to DNA of 8–15 bases, and The DNA cleavage domain of FokI endonuclease; The RVD includes: The first RVD that identifies the bases at mitochondrial disease-induced mutation sites, and Second RVD that recognizes bases other than mutation sites induced by mitochondrial diseases; The first RVD is at least one of NM (adenine-recognizing), WK (guanine-recognizing), and LK (guanine-recognizing). The second RVD recognizes adenine by NI and guanine by NN.
10. A carrier comprising the nucleic acid composition of claim 9.
11. A pharmaceutical composition comprising any one of the TAL effector nuclease pairs of claims 1 to 8, the nucleic acid composition of claim 9, or the carrier of claim 10.
Citation Information
Patent Citations
iPS CELL GROUP HAVING DIFFERENT MITOCHONDRIAL DISEASE INDUCED VARIANT mtDNA RATIO
JP2018139580A