Mouse model for PRPF31 gene treatment efficacy and safety evaluation
By introducing PRPF31 gene mutations into a mouse model and constructing an RP11 mouse model using the Cre-loxP system and gene editing technology, the problem of lacking an effective mimicry of the RP11 disease phenotype in existing technologies was solved, and the efficacy evaluation of gene replacement therapy was realized.
Patent Information
- Application Number
- CN202411215563.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-02
- Publication Date
- 2026-03-17
AI Technical Summary
Currently, there are no effective animal models that can simulate the phenotype of autosomal dominant retinitis pigmentosa (RP11) caused by PRPF31 mutation, making it difficult to effectively evaluate the efficacy and pharmacology of gene therapy drugs.
A mouse model of RP11 was constructed by introducing a mutation in the PRPF31 gene into the animal genome, using the Cre-loxP system and gene editing technologies (such as CRISPR/Cas technology) to simulate the RP11 disease phenotype in mice, and restoring normal function through gene replacement therapy such as AAV-PRPF31.
This mouse model can mimic the retinal function impairment caused by PRPF31 mutations, significantly improve retinal function and structure through gene replacement therapy, and provide an effective platform for drug efficacy testing.
Smart Images

Figure CN121674478A_ABST
Abstract
Description
Technical Field
[0001] This application relates to the field of biomedicine, specifically to a mouse model for evaluating the in vivo efficacy and safety of gene therapy for autosomal dominant retinitis pigmentosa caused by PRPF31 mutation. Background Technology
[0002] Retinitis pigmentosa (RP) encompasses a large class of inherited vision disorders that cause progressive degeneration of the retina (the light-sensitive membrane covering the inside of the eye). RP typically begins with visual disturbances in low light or dim light (i.e., difficulty seeing in dim environments or at dusk, or the ability to adapt or regain function in dim light after a period of exposure to bright light). Affected individuals usually become aware of the loss of peripheral vision gradually. Symptoms are common between the ages of 10 and 40, but RP has early and late-onset forms, with typical symptoms developing gradually over time (References [1-3]).
[0003] Retinitis pigmentosa (RP) is caused by mutations in any of at least 50 genes (https: / / rarediseases.info.nih.gov / diseases / 5694 / retinitis-pigmentosa). Inheritance can be autosomal dominant (ad), autosomal recessive (ar), X-linked (xl), or of unknown origin. Studies on the incidence of non-syndrome RP in different populations indicate an incidence of 1 in 4000, with 30% to 40% of cases reported as autosomal dominant (Hartong, Berson et al. 2006). The causative genes for autosomal dominant retinitis pigmentosa (adRP) include Rhodopsin (RHO), PRRF31, PRPH2, RP1, IMPDH1, and PRPF8. PRRF31 mutations have been reported as a common cause of secondary adRP following RHO, accounting for 2.5% to 6.7% of all cases (References [4,5]).
[0004] As is well known, PRPF31 is a messenger RNA precursor (pre-mRNA) splicing factor and a component of the U4 / U6 / U5 trimer. Although PRPF31 is widely expressed in human tissues, its mutations only cause pathological effects in rod photoreceptors and retinal pigment epithelium (RPE) cells (RP11 type). Most pathogenic PRPF31 mutations are single-base alterations or small deletions, resulting in premature stop codons and nonsense mRNA decay (NMD) (see Table 1), suggesting that RP11 is caused by haploid insufficiency. Interestingly, about 5%–10% of individuals carrying PRPF31 mutations are asymptomatic (Reference [6]). The incomplete penetrance of RP11 supports that its molecular pathological cause is the loss of function of a single allele and haploid insufficiency. Since PRPF31 mutations lead to retinitis pigmentosa through haploid insufficiency, AAV-based gene replacement therapy is the most desirable treatment strategy.
[0005] Table 1. Pathogenic mutation sites of PRPF31 in RP11 patients (Data source: https: / / rddc.tsinghua-gd.org / disease / RTN041)
[0006]
[0007] The PRPF31 mRNA levels in the retina, nucleated blood cells, and lymphoblasts of normal individuals and non-carriers are similar, approximately 1.21 × 10⁻⁶. 8 ±1.39×10 7 Copy number / µg total RNA. Therefore, the PRPF31 mRNA level in lymphoblasts can represent the expression of PRPF31 in the retina (reference [7]). The mean expression levels of PRPF31 mRNA in symptomatic (S, carrying PRPF31 with 1115-1125 deletion), asymptomatic (AS, carrying PRPF31 with 1115-1125 deletion), and normal / non-carrier (N) lymphoblasts were 2.58 × 10⁻⁶ mRNAs, respectively. 7 ±3.09×10 6 4.26×10 7 ±9.02×10 6 and 1.09×10 8 ±6.71×10 6Copy number / µg total RNA (Reference [7]). In a large cohort of 200 healthy individuals, 3 asymptomatic individuals, and 7 symptomatic individuals, PRPF31 mRNA expression in lymphoblasts showed similar levels. PRPF31 mRNA expression was normalized to the median expression level, which was arbitrarily set to 1.0. The normalized PRPF31 mRNA levels in symptomatic patients were 0.29–0.50, in asymptomatic patients 0.53–0.67, and in healthy individuals 0.53–2.48 (Reference [8]). Therefore, restoring PRPF31 mRNA levels in the retinas of symptomatic patients to normal levels may salvage retinal cell function.
[0008] This hypothesis has been confirmed in several in vitro and in vivo models. Mutant PRPF31-induced pluripotent cell-derived RPE (iPSC-RPE) cells reproduced the cell phenotypes associated with PRPF31 pathology, including structural defects, impaired phagocytosis, defective ciliation, and impaired barrier function. Treatment of PRPF31 mutant iPSC-RPE cells with AAV-PRPF31 restored normal phagocytosis and ciliation, and partially restored structural and barrier function (Reference [9]). Gene knockout (such as treatment with prpf31 morphants or prpf31 knockout) resulted in severe impairment of zebrafish retinal progenitor cells (RPCs) and / or embryonic development, while injection of PRPF31 mRNA rescued these defects (References 10-12).
[0009] Animal models (naturally occurring or genetically engineered) are crucial tools for studying the function of target genes, disease pathogenesis, and the effectiveness of treatments. A good animal model should exhibit sufficiently rapid disease progression, allowing researchers to assess treatment outcomes within a reasonable timeframe; however, the progression should not be "too rapid or unstoppable," as rapid progression makes efficacy assessment difficult, and the disease bears no resemblance to human diseases. Currently, there are no effective animal models that can mimic the RP11 disease phenotype. Therefore, the construction and study of suitable animal models are essential for effectively exploring the efficacy and pharmacology of RP11 treatments. Summary of the Invention
[0010] This application provides for the first time an RP11 mouse model for in vivo efficacy testing of gene replacement therapy for autosomal dominant retinitis pigmentosa caused by PRPF31 mutation, and a method for constructing the model.
[0011] Therefore, according to one aspect of the invention, a method for constructing an animal model of retinitis pigmentosa (RP) is provided, the method comprising introducing a mutation in the PRPF31 gene into the animal genome, the mutation affecting PRPF31 gene expression in the animal, causing PRPF31 dysfunction and / or producing the RP11 disease phenotype. Preferably, the mutation results in autosomal dominant retinitis pigmentosa (adRP).
[0012] In one embodiment, the mutation is selected from point mutations, deletion mutations, insertion mutations, and inversion or duplication mutations, preferably deletion mutations, and more preferably the mutation can be repaired by gene therapy. In a preferred embodiment, the mutation is the pathogenic mutation of PRPF31 in RP11 patients listed in Table 1.
[0013] In one embodiment, the animal is a non-human mammal, preferably a ruminant, canine, rabbit, feline, or rodent, more preferably a mouse, pig, monkey, bear, sheep, goat, horse, donkey, rabbit, cat, cow, fox, or dog, even more preferably a mouse or rat, even more preferably a C57BL / 6 mouse or BALB / c mouse, even more preferably a C57BL / 6J or C57BL / 6N mouse, and most preferably a C57BL / 6J mouse.
[0014] In one embodiment, the RP11 disease phenotype is selected from the group consisting of: cellular structural defects, impaired phagocytic function, ciliary formation defects, impaired barrier function, impaired retinal function, thinning of the photoreceptor layer, photoreceptor apoptosis, and combinations thereof.
[0015] In one embodiment, the mutation is a deletion mutation, comprising the deletion of one, two, or more exons of the PRPF31 gene, the exons being selected from exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, and exon 7, preferably exon 4, exon 5, or combinations thereof. In a preferred embodiment, the mutation is the deletion of exon 4 and optionally one or more other exons. In a preferred embodiment, the mutation is the deletion of exon 5 and optionally one or more other exons. In a preferred embodiment, the mutation is the deletion of exons 4 and 5 and optionally one or more other exons.
[0016] In one embodiment, the deletion is achieved by gene knockout technology, gene editing technology, or a combination thereof, preferably by conditional gene knockout technology or systemic gene knockout technology, wherein the conditional gene knockout technology is preferably Cre-loxP gene knockout technology, and the gene editing technology is selected from CRISPR / Cas technology, zinc finger nuclease technology (ZFN) and transcription activator-like effector nuclease technology (TALEN), preferably CRISPR / Cas technology.
[0017] In one embodiment, the Cre-loxP gene knockout technology includes estrogen-inducible Cre-loxP gene knockout technology, preferably including the step of inducing Cre activity using tamoxifen or an analogue thereof.
[0018] In one implementation, the method includes the following steps:
[0019] 1) Two loxP sites are inserted into the PRPF31 gene of the animal using conditional Cre-loxP gene knockout technology. Preferably, the two loxP sites are inserted into intron 3 and intron 5 of the PRPF31 gene, respectively; and
[0020] 2) The Cre enzyme is induced to enter the cell nucleus by tamoxifen or its analogues, resulting in the knockout of a segment of the PRPF31 gene between the two loxP sites.
[0021] In one implementation, in the method:
[0022] 1) The animal is a mouse, preferably a C57BL / 6J mouse;
[0023] 2) The mice obtained in step 1) were C57BL / 6JCya-Prpf31 em1flox / Cya mice, and compared them with C57BL / 6JCAGGCre-ER TM Mice were hybridized, passaged, and bred to obtain C57BL / 6JCya-Prpf31. em1flox / em1flox Mice (loxP mice) and C57BL / 6JCya-Prpf31 em1flox / em1flox CAGGCre-ER TM In step 2), Cre mice (Cre mice) were induced to knock out the PRPF31 gene by tamoxifen.
[0024] 3) The method further includes a step of genotyping the obtained mouse model to determine whether the PRPF31 gene has been knocked out. In some embodiments, this identification is performed by PCR, Southern blot, or Sanger sequencing; and / or
[0025] 4) The method further includes the step of performing phenotypic detection on the obtained mouse model to determine whether it has the RP11 disease phenotype.
[0026] In one embodiment, the RP11 disease phenotype is detected by examining photoreceptor degeneration using fundus photography (FP), optical coherence tomography (OCT), and hematoxylin and eosin (HE) staining, and by assessing visual function using ERG. The RP11 disease phenotype includes, but is not limited to, impaired retinal function, thinning of the photoreceptor layer, and / or photoreceptor apoptosis.
[0027] In one implementation, tamoxifen or its analogues are induced by intraperitoneal injection.
[0028] In one implementation, each mouse was intraperitoneally injected with 25-75 mg tamoxifen / kg mouse body weight daily for 3 to 5 consecutive days.
[0029] In one embodiment, tamoxifen or its analogues are induced by intravitreal injection of higher concentrations (e.g., 1 to 50 mg / ml, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50 mg / ml) of tamoxifen (with corn oil as a solvent) (e.g., 1-10 μl, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10 μl) to induce a disease model of RP11 (tamoxifen dosage, such as 1-500 μg, such as 5, 10, 20, 50, 60, 80, 100, 200, 300, 400, and WIB24003-105e500 μg).
[0030] According to another aspect of the invention, an RP animal model, preferably a mouse model, prepared by the method according to the invention is provided.
[0031] According to another aspect of the present invention, a method is provided for identifying and / or testing gene therapy drugs for treating RP11, comprising:
[0032] 1) Administering the gene therapy drug to an RP animal model prepared by the method according to the present invention; and
[0033] 2) Detect whether the RP11 disease phenotype in the animal model has improved;
[0034] If the RP11 disease phenotype in the animal model is improved, it indicates that the gene therapy drug can be effectively used to treat RP11.
[0035] In one implementation, the animal in step 1) is a mouse; the administration in step 1) is an intraocular administration (e.g., subretinal injection, intravitreal injection); and the detection of the disease phenotype of the RP in the animal model in step 2) includes one or more of the following steps: a) detecting fundus changes in the model animal by fundus photography abnormalities (FP) and optical coherence tomography (OCT); and b) measuring changes in visual function in the model animal by electroretinography (ERG).
[0036] In one embodiment, the gene therapy drug includes an AAV-based gene replacement drug or gene editing drug, preferably in the form of a recombinant AAV (rAAV) viral vector, more preferably in the form of AAV8 serotype and AAV2.7m8 serotype rAAV, and most preferably in the form of AAV8 serotype rAAV.
[0037] According to another aspect of the present invention, the use of the RP animal model described in the present invention for in vivo evaluation of the efficacy and / or safety of gene therapy drugs for treating RP is provided.
[0038] In a preferred embodiment, the RP11 mouse model obtained by this invention is a tamoxifen-induced conditional gene knockout (CKO) Cre-loxP mouse model. The CKO mouse model is designed to mimic PRPF31 deficiency. Identification results of this mouse model indicate that tamoxifen-induced retinal function is impaired, the photoreceptor cell layer is thinned, and photoreceptor cells undergo apoptosis, exhibiting a disease phenotype similar to that of RP11 patients caused by PRPF31 mutations. Furthermore, by administering gene replacement drugs subretinally, the fundus abnormalities and retinal function in the tamoxifen-induced mouse model were restored to some extent. These results demonstrate that this mouse model can be used as an in vivo pharmacodynamic study model for gene therapy (replacement) drugs. Attached Figure Description
[0039] The above features and advantages of the present invention will become more apparent from the following detailed description taken in conjunction with the accompanying drawings, wherein:
[0040] Figure 1 .Schematic diagram of the PRPF31 CKO mouse model construction;
[0041] Figure 2 Genotyping strategies;
[0042] Figure 3 PCR detection of mouse genotypes;
[0043] Figure 4Fundus photography and OCT scans of mice three weeks after intravitreal injection of tamoxifen-corn oil. Fundus photography showed incomplete diffusion of oil droplets; OCT results showed abnormal retinal structure in the right eye of Cre mice, while no significant changes were observed in the retinal structure of the left eye of Cre mice and both eyes of loxP mice.
[0044] Figure 5 Fundus photography and OCT of mice 6 weeks after intravitreal injection of tamoxifen-DMSO. A. Lox mice injected intravitreally with 100 ng / 3 μl tamoxifen; B. Cre mice injected intravitreally with 100 ng / 3 μl tamoxifen; C. Lox mice injected intravitreally with 300 ng / 3 μl tamoxifen; D. Cre mice injected intravitreally with 300 ng / 3 μl tamoxifen.
[0045] Figure 6 Fundus photography and OCT scans of mice 6 weeks after intravitreal injection of tamoxifen-ethanol. A. Lox mice injected intravitreally with 100 ng / 3 μl tamoxifen; B. Cre mice injected intravitreally with 100 ng / 3 μl tamoxifen; C. Lox mice injected intravitreally with 600 ng / 3 μl tamoxifen; D. Cre mice injected intravitreally with 600 ng / 3 μl tamoxifen.
[0046] Figure 7 Survival curves of Cre and loxP mice induced by intraperitoneal injection of tamoxifen;
[0047] Figure 8 FP and OCT in Cre and loxP mice before and after intraperitoneal tamoxifen induction;
[0048] Figure 9 HE staining of the retinas of Cre and loxP mice induced by intraperitoneal injection of tamoxifen;
[0049] Figure 10 TUNNEL staining of the retinas of Cre and loxP mice induced by intraperitoneal injection of tamoxifen;
[0050] Figure 11 ERG amplitude in Cre and loxP mice induced by intraperitoneal injection of tamoxifen;
[0051] Figure 12 Changes in ERG amplitude before and after intraperitoneal injection of tamoxifen in Cre mice;
[0052] Figure 13 Genomic cleavage after intraperitoneal injection of tamoxifen in Cre mice;
[0053] Figure 14PRPF31 gene replacement drug design;
[0054] Figure 15 The effect of genomic loxP deletion in the retina of Cre mice;
[0055] Figure 16 Expression of transgenic mRNA in the retina of Cre mice;
[0056] Figure 17 Expression of transgenic protein in the retina of Cre mice;
[0057] Figure 18 Flowchart of AAV-PRPF31 treatment in a PRPF31 CKO mouse model;
[0058] WIB24003-105e
[0059] Figure 19 FP and OCT in Cre mice 6 weeks after AAV injection;
[0060] Figure 20 Retinal function testing in Cre mouse model;
[0061] Figure 21 ERG results of mice in each group after tamoxifen induction;
[0062] Figure 22 Fundus photography and OCT results of mice in each group after tamoxifen induction;
[0063] Figure 23 CRE cutting details of mouse eye tissue (retina and RPE) and brain tissue;
[0064] Figure 24 The mRNA expression of transgenic PRPF31 in the retina and RPE of mice after intravitreal injection of AAV2.7m8-PRPF31;
[0065] Figure 25 Expression of GFP and hPRPR31 proteins in the retina and RPE of mice after intravitreal injection of AAV2.7m8-GFP (OS, left eye) or AAV2.7m8-PRPF31 (OD, right eye);
[0066] Figure 26 ERG results of mice in each group after tamoxifen induction;
[0067] Figure 27Fundus photography and OCT results of mice in each group after tamoxifen induction. A. Fundus photography and OCT results of mice in groups G1-G4 after tamoxifen induction. B. Fundus photography and OCT results of mice in group G4 after tamoxifen induction;
[0068] Figure 28 . Tunnel staining results of the retina of mice in each group after tamoxifen induction;
[0069] Figure 29 CRE cutting details of mouse eye tissue (retina and RPE) and brain tissue;
[0070] Figure 30 The mRNA expression of transgenic PRPF31 in the mouse retina and RPE after subretinal injection of AAV2.7m8-BIP-PRPF31 or AAV8-BIP-PRPF31;
[0071] Figure 31 The expression of GFP protein in the mouse retina and RPE after subretinal injection of AAV2.7m8-GFP or AAV8-GFP; and
[0072] Figure 32 Protein expression of PRPF31 in mouse retina and RPE after subretinal injection of AAV2.7m8-BIP-PRPF31 or AAV8-BIP-PRPF31. Detailed Implementation
[0073] Unless otherwise stated, the terms used herein have their general technical meanings as understood by those skilled in the art. For definitions and terms in this field, those skilled in the art are particularly recommended to refer to Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor, Plainsview, New York (1989); and Ausubel et al., Current Protocols in Molecular Biology (Supplement 47), John Wiley & Sons, New York (1999).
[0074] In this application, the term "retinitis pigmentosa (RP)" generally refers to a hereditary blinding eye disease characterized by the progressive, selective loss of retinal photoreceptor cells (cones and rods) and retinal pigment epithelial cells. RP can be inherited in autosomal recessive (arRP), autosomal dominant (adRP), and X-linked (xlRP), with xlRP having an early onset and causing the most severe damage. Clinical manifestations of RP may include night blindness, progressive visual field defects, and central vision loss after macular involvement, ultimately leading to blindness. The main fundus changes in RP are equatorial retinal pigment disturbances, with osteocyte-like pigment deposition gradually progressing towards the posterior pole and ora serrata. Retinal pigment epithelial cells (RPE), photoreceptor cells, and the choroidal capillary layer gradually atrophy, revealing the large choroidal vessels. The retina appears bluish-gray, the retinal arteries become thinner, and the optic disc becomes waxy yellow and atrophied. Methods for assessing retinal function and morphology may include best-corrected visual acuity (BCVA), fundus autofluorescence, visual field testing, electroretinography (ERG), fundus color photography, optical coherence tomography (OCT), and fluorescein angiography (FFA).
[0075] In this application, the term "PRPF31" refers to a proribonucleic acid splicing factor whose mutations cause pathological effects (RP11 type) in rod photoreceptor and retinal pigment epithelium (RPE) cells. The human PRPF31 gene is located on the positive strand of chromosome 19, NC_000019.10 (54115754..54131713); the mouse PRPF31 gene is located on the positive strand of chromosome 7, NC_000073.7 (3632984..3645484). The PRPF31 protein mainly contains three major functional domains: the NOSIC domain (92-144 aa), the NOP domain (186-334 aa), and the C-terminal domain (336-465 aa), with the NOP domain, which is the RNA-binding domain, being the most conserved.
[0076] In this application, the term "RP11 type" refers to retinitis pigmentosa 11, also known as RP11. The gene associated with retinitis pigmentosa 11 is PRPF31 (pre-mRNA processing factor 31). Affected tissues include the retina and eye, and associated phenotypes include macular degeneration and macular atrophy.
[0077] In this application, the term "gene mutation" refers to a change that occurs in a DNA sequence, which may be a single base substitution, insertion, or deletion in the gene sequence, or a larger gene deletion, duplication, or inversion.
[0078] In this application, the term "point mutation" refers to the substitution of a single base in a gene sequence, and in this invention, it can include missense mutations and nonsense mutations. A missense mutation is the substitution of one amino acid for another, which may lead to changes in protein structure and function. A nonsense mutation is the substitution of one codon for another stop codon, which leads to the termination of protein synthesis.
[0079] In this application, the terms "deletion mutation" and "insertion mutation" refer to the insertion or deletion of one or more bases in a gene sequence. This may alter the amino acid sequence of a protein and lead to changes in protein structure and function.
[0080] In this application, the term "inversion mutation" refers to the inversion of two adjacent regions in a gene sequence, which may result in a change in gene function.
[0081] In this application, the term "duplication mutation" refers to the repeated insertion of one or more bases in a gene sequence, which may result in a change in gene function.
[0082] In this application, the term "gene knockout (KO)" refers to the removal of certain important exons or functional domains, or even all exons, of a target gene, resulting in the loss of expression of the target gene.
[0083] In this application, the term "systemic gene knockout technology" is also called complete gene knockout, which refers to gene knockout in all tissue cells.
[0084] In this application, the term "conditional knockout (CKO)" refers to restricting the modification of a gene to certain specific cell types or a specific stage of development, thereby achieving spatiotemporally specific modification of the genome.
[0085] In this application, the term "Cre-loxP gene knockout" refers to gene knockout achieved through site-specific recombination of the Cre-loxP system. Cre-loxP gene knockout can be divided into constitutive and inducible Cre-loxP gene knockout. Preferably, Cre-loxP gene knockout technology includes estrogen-induced Cre-loxP gene knockout technology, and more preferably includes the step of inducing Cre activity using tamoxifen or its analogues.
[0086] In this application, the term "gene editing" refers to a method of creating single-stranded or double-stranded DNA breaks at specific locations within the genome by using a site-directed nuclease to cut DNA at precise target sites within the genome. Such breaks can be periodically repaired by endogenous cellular processes, such as HDR and non-homologous end joining (NHEJ). These two main DNA repair processes consist of a series of alternative pathways. NHEJ directly joins the DNA ends resulting from double-strand breaks, sometimes resulting in the loss or addition of nucleotide sequences, which may disrupt or enhance gene expression. HDR uses homologous or donor sequences as templates to insert specific DNA sequences at the break point. Homologous sequences can be in the endogenous genome, such as sister chromatids. Alternatively, the donor can be a foreign nucleic acid, such as a plasmid, single-stranded oligonucleotide, double-stranded oligonucleotide, or virus. These foreign nucleic acids can contain regions highly homologous to the loci cleaved by the nuclease, and may also contain additional sequences or sequence variations (including deletions of target loci that can be incorporated into the cleavage). The third repair mechanism can be microhomology-mediated end joining (MMEJ), also known as "alternative NHEJ (ANHEJ)," which involves small deletions and insertions at the cleavage site, with genetic outcomes similar to NHEJ. MMEJ can utilize homologous sequences of a few base pairs flanking the DNA break site to drive more favorable DNA end joining repair outcomes. In some cases, it is possible to predict potential repair outcomes based on analysis of the potential microhomology of the DNA break site.
[0087] These gene editing mechanisms can all be used to remove the gene mutation sites required in this application. The method described in this application may include creating one or two DNA breaks at a location near the expected mutation site in the target locus; the two DNA breaks may be double-strand breaks or two single-strand breaks. In some cases, the removal may include inducing a double-strand break in the PRPF31 allele containing the mutation. The break can be achieved using a site-directed peptide. Site-directed peptides (e.g., DNA endonucleases) can introduce double-strand breaks or single-strand breaks into nucleic acids (e.g., genomic DNA). Double-strand breaks can stimulate endogenous DNA repair pathways in cells, such as HDR, NHEJ, or MMEJ. NHEJ can repair cleaved target nucleic acids without a homologous template.
[0088] In some cases, homologous recombination can be used to insert exogenous polynucleotide sequences into target nucleic acid cleavage sites. The exogenous polynucleotide sequence can be referred to as a donor polynucleotide (or donor, donor sequence, or polynucleotide donor template). A donor polynucleotide, a portion of a donor polynucleotide, a copy of a donor polynucleotide, or a portion of a copy of a donor polynucleotide can be inserted into the target nucleic acid cleavage site. The donor polynucleotide can be an exogenous polynucleotide sequence, i.e., a sequence that is not naturally present at the target nucleic acid cleavage site.
[0089] HDR occurs when a homologous repair template or donor is available. The homologous donor template may contain at least a portion of the wild-type PRPF31 gene or cDNA. At least a portion of the wild-type PRPF31 gene or cDNA may be fragments or combinations of exon 1, exon 2, exon 3, exon 4, exon 5, intron regions, or the complete PRPF31 gene or cDNA. The donor template may be a single-stranded or double-stranded polynucleotide. The donor template may be delivered by AAV. The homologous donor template may contain sequences homologous to sequences flanking the target nucleic acid cleavage site. For example, the donor template may have an arm homologous to the 3q22.1 region. The donor template may also have an arm homologous to the pathological variant c.C403T. Sister chromatids may be used by the cell as a repair template. However, for gene editing purposes, the repair template may be provided as a foreign nucleic acid, such as a plasmid, double-stranded oligonucleotide, single-stranded oligonucleotide, or viral nucleic acid. Using exogenous donor templates, additional nucleic acid sequences (e.g., transgenes) or modifications (e.g., single or multiple base alterations or deletions) can be introduced between homologous flanking regions, thereby incorporating additional or altered nucleic acid sequences into the target locus. MMEJ can utilize homologous sequences located a few base pairs flanking the cleavage site to drive favorable end-joining DNA repair outcomes. In some cases, the likely repair outcome can be predicted based on analysis of potential microhomology in the nuclease target region.
[0090] In this application, the term "gene-editing drug" refers to the reagents, kits, systems, or combinations thereof used in gene editing processes using gene editing technologies. The gene editing technologies include CRISPR / Cas technology; zinc finger nuclease technology (ZFN); or transcription activator-like effector nuclease technology (TALEN); preferably CRISPR / Cas9.
[0091] In this application, the term "gene replacement" refers to the replacement of a missing or abnormal gene in a patient's body by introducing a foreign gene. Common gene replacement techniques include gene repair, gene insertion, and gene splicing. For example, a normal foreign gene can be introduced into a patient's cells to replace an abnormal gene, which can be done using a vector (such as a viral vector like AAV or a plasmid vector).
[0092] The term "AAV" is generally an abbreviation for adeno-associated virus and can be used to refer to the virus itself or its derivatives. AAVs can include AAV 1 (AAV-1 or AAV1), AAV 2 (AAV-2 or AAV2), AAV 3 (AAV-3 or AAV3), AAV 4 (AAV-4 or AAV4), AAV 5 (AAV-5 or AAV5), AAV 6 (AAV-6 or AAV6), AAV 7 (AAV-7 or AAV7), AAV 8 (AAV-8 or AAV8), AAV 9 (AAV-9 or AAV9), avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV, sheep AAV, and combinations thereof.
[0093] C57BL / 6 mice are among the most widely used laboratory animals. Compared to BALB / c mice, their fundus contains pigment, making them more suitable as animal models for retinal disease research. There are two main substrains of C57BL / 6 mice: C57BL / 6J and C57BL / 6N. C57BL / 6N mice contain the Crb1rd8 mutation, leading to mild retinal degeneration, and are not recommended as controls for retinal pathology studies. Therefore, this invention preferably uses C57BL / 6J mice as the basis for model construction.
[0094] This invention involves co-injecting gRNA of the mouse Prpf31 gene, a donor vector containing the loxP site, and Cas9 mRNA into mouse zygotes to obtain the RP11 mouse model, a tamoxifen-induced conditional gene knockout (CKO) Cre-loxP mouse model. The F0 originator mice were identified by PCR and sequence analysis, and then crossed with wild-type mice to generate F1 mice through germline propagation. The F1 targeted mice were then crossbred with tissue-specific CAGGCre-ER... TM Gene knockout mice are crossed to produce FNs. Homozygous, Cre+ mice are bred with heterozygous mice to produce homozygous mice.
[0095] After obtaining homozygous loxP mice containing the Cre-ertm allele (Cre mice) and homozygous loxP mice without the Cre-ertm allele (loxP mice), tamoxifen induction was performed, and changes in ocular function and structure were examined. The results showed that the induced mice exhibited impaired retinal function, thinning of the photoreceptor cell layer, and photoreceptor cell apoptosis. In this model, we further validated the efficacy of potential therapeutic drugs. Experimental results showed that the gene replacement drug effectively expressed the target protein in mouse photoreceptor cells and improved retinal function and structure.
[0096] The above results indicate that the mouse model has a significant disease phenotype and can effectively detect the efficacy of gene replacement drugs, suggesting that the model can be used for pharmacological and efficacy studies in the development of drugs for RP11 caused by PRPF31 mutation.
[0097] The invention is further illustrated in the following examples. These examples are for illustrative purposes only and are not intended to limit the scope of the invention. All chemicals used in the following reactions are commercially available products unless otherwise specified.
[0098] Example 1
[0099] Mouse model construction strategy
[0100] Mouse model construction strategies such as Figure 1 As shown.
[0101] First, two loxP sites were inserted into introns 3 and 5 of the mouse PRPF31 gene (NCBI reference sequence: NC_000073.7). Therefore, when the Cre enzyme enters the nucleus, the sequence between the two loxP sites in the mouse PRPF31 genome is deleted, resulting in a 182bp deletion of mouse PRPF31 mRNA and downregulation of mouse PRPF31 protein expression. This step yielded C57BL / 6JCya-Prpf31. em1flox / Cya mice (commissioned by Cyagen Biotech Ltd.)
[0102] Secondly, C57BL / 6JCAGGCre-ER was purchased from Cyagen Biotech Ltd. TM In mice, without the action of the estrogen analogue tamoxifen, the CreER recombinase remains in the cytoplasm and cannot function; only when bound to estrogen can CreER enter the nucleus and drive recombination at the LoxP site. After induction with tamoxifen, the Cre protein enters the nucleus and cleaves and recombines the loxP site on the genome, resulting in the knockout of the target gene.
[0103] Then, we will use the above C57BL / 6JCya-Prpf31 em1flox / Cya mice and C57BL / 6JCAGGCre-ER TM Mice were hybridized to obtain C57BL / 6JCya-Prpf31 em1flox / em1flox Mice (hereinafter referred to as loxP mice) and C57BL / 6JCya-Prpf31 em1flox / em1flox CAGGCre-ER TMMice (hereinafter referred to as Cre mice). LoxP mice—which do not express Cre protein and do not have PRPF31 gene knockout after tamoxifen induction—serve as a control model of mouse phenotype; after tamoxifen induction, Cre protein enters the cell nucleus in Cre mice and cleaves and recombines the loxP site on the PRPF31 genome, resulting in PRPF31 gene knockout and downregulation of protein expression.
[0104] Specifically, based on the above construction strategy, targeting vectors for the mouse PRPF31 gene were designed, namely gRNA-1, gRNA-2, gRNA-3, and gRNA-4, with gRNA sequences shown in Table 2. The gRNAs, the donor vector containing the loxP site, and Cas9 mRNA were co-injected into mouse zygotes to generate targeted conditional gene knockout progeny, obtaining F0 generation mice. These F0 mice were then crossed with wild-type mice for germline propagation to generate F1 mice. The F1 targeted mice were then crossbred with C57BL / 6JCAGGCre-ER mice. TM Gene knockout mice were crossed to produce F2 generation mice.
[0105] Table 2. gRNA Sequences
[0106] gRNA sequence gRNA1 TGTCAGGTGTCTTAACTAGTGGG(SEQ ID NO:1) gRNA2 ACATTAGATGTGGAAGGTGTTGG(SEQ ID NO:2) gRNA3 GTCAGGTGTCTTAACTAGTGGGG(SEQ ID NO:3) gRNA4 CAGAGAACATTAGATGTGGAAGG(SEQ ID NO:4)
[0107] Example 2
[0108] Genotyping of model mice
[0109] (1) Genotype identification strategy
[0110] Genotyping strategies such as Figure 2 As shown in Table 3, the primer sequences are as follows.
[0111] Table 3. Primer sequences for genotype identification
[0112] Primers sequence F1 5'-GTCTGCTCATGTCAGGTGTCTTA-3'(SEQ ID NO:5) R1 5'-AACTCTGAGGGCATTAAACAACCC-3'(SEQ ID NO:6) CAGGCre-ERTM-F 5'-GCTAACCATGTTCATGCCTTC-3'(SEQ ID NO:7) CAGGCre-ERTM-R 5'-AGGCAAATTTTGGTGTACGG-3'(SEQ ID NO:8) R3 5'-AATCCCTTGTAGAGAAGCCAACAC-3'(SEQ ID NO:9)
[0113] (2) Genotyping of model mice
[0114] Table 4
[0115]
[0116]
[0117] DNA was extracted from the tails of the obtained F2 generation mice, and genotyping was performed by PCR using F1 / R1 and CAGGCre-ERTM-F / CAGGCre-ERTM-R primer pairs. Amplification with F1 / R1 primers showed a single 201 bp band for homozygotes, two bands (201 bp and 132 bp) for heterozygotes, and a single 132 bp band for the wild-type allele. Amplification with CAGGCre-ERTM-F / CAGGCre-ERTM-R primers showed a single 180 bp band. PCR identification results are as follows: Figure 3 As shown.
[0118] The identified F2 generation homozygous mice (Cre mice) were intraperitoneally injected with 75 mg / kg body weight of tamoxifen (dissolved in corn oil, Sigma, C8267) for 5 consecutive days. After 4 weeks, the tails were cut off for DNA extraction. PCR amplification was performed using F1 / R3 primers, and PRPF31 knockout was successful, resulting in a 157 bp band.
[0119] Example 3
[0120] Intraocular induction conditions in PRPF31 CKO mouse model
[0121] Since the RP11 disease phenotype is primarily ocular, and systemic induction with tamoxifen is expected to lead to systemic knockout of the PRPF31 gene and systemic toxicity, the inventors initially investigated possible intraocular induction conditions for tamoxifen. Tamoxifen is soluble in corn oil, chloroform, methanol, ethanol, DMSO, etc., but almost insoluble in water (solubility <0.01%, 20°C). Considering the significant in vivo toxicity of chloroform and methanol, we used corn oil, ethanol, and DMSO as solvents to dissolve tamoxifen, respectively, and induced Cre and loxP mice by intravitreal injection of tamoxifen.
[0122] (1) Tamoxifen 20 mg / ml was dissolved in corn oil. 3 μl of corn oil was injected into the vitreous cavity of the left eye, and 3 μl of tamoxifen was injected into the vitreous cavity of the right eye (tamoxifen dosage 60 μg). Observations were made after 3 weeks. Figure 4 The oil droplets in the vitreous cavity did not dissolve, indicating that tamoxifen could not diffuse. OCT results showed abnormal retinal structure in the right eye of Cre mice, while no significant changes were observed in the retinal structure of the left eye of Cre mice and both eyes of loxP mice.
[0123] (2) Tamoxifen 3.3 mg / ml was dissolved in DMSO, diluted 100-fold / 33-fold in PBS, and 3 μl was injected intravitreally (tamoxifen dosage 100 ng / 300 ng). Fundus photography and OCT were performed 6 weeks after induction. Results are as follows. Figure 5The results showed that after induction with 100 ng / 300 ng tamoxifen, both lox and Cre mice had highly reflective punctate distributions in their fundus, with no significant difference. This was caused by the drug or injection and was not related to Cre expression or PRPF31 knockout.
[0124] (3) Tamoxifen 20 mg / ml was dissolved in ethanol, diluted 600-fold / 100-fold in PBS, and 3 μl was injected intravitreally (tamoxifen dosage 100 ng / 600 ng). Results were as follows. Figure 6 The results showed that after induction with 100 ng tamoxifen, there were no significant changes in the fundus of both lox and Cre mice; after induction with 600 ng tamoxifen, there were highly reflective punctate distributions in the fundus of both lox and Cre mice, with no significant difference, which was caused by the drug or injection and was not related to Cre expression or PRPF31 knockout.
[0125] The results above indicate that intravitreal injection of higher concentrations of tamoxifen (with corn oil as a solvent) can successfully induce the RP11 disease model, while injection of lower concentrations of tamoxifen (with ethanol or DMSO as a solvent) cannot successfully induce the RP11 disease model.
[0126] Example 4
[0127] Peritoneal induction and phenotypic study of PRPF31 CKO mouse model
[0128] Although systemic induction of tamoxifen may lead to systemic knockout of the PRPF31 gene and systemic toxicity, the inventors unexpectedly discovered through research that intraperitoneal injection of tamoxifen into Cre mice can successfully induce a disease model of RP11.
[0129] Cre mice were intraperitoneally injected with 75 mg / kg tamoxifen for 5 consecutive days. After 4 weeks of systemic induction, the mice experienced significant weight loss. Animals were euthanized if the weight loss exceeded 20%. Survival curves for Cre and loxP mice induced by intraperitoneal tamoxifen are shown below. Figure 7 As shown.
[0130] For patients with retinopathy of prematurity (RP), abnormal fundus photography (FP) and progressive photoreceptor degeneration are the main characteristic phenomena, leading to retinal structural abnormalities and visual function loss. To determine whether the PRPF31 CKO mouse model has a similar pathogenesis and disease phenotype to RP patients, we detected photoreceptor degeneration using fundus photography (FP), optical coherence tomography (OCT), and HE staining, and assessed visual function using ERG. Whitening of the fundus indicates photoreceptor apoptosis. After 3 weeks of tamoxifen induction, dense white spots appeared in the fundus of Cre mice, suggesting retinal degeneration. Figure 8 As shown.
[0131] Four weeks after tamoxifen induction, mice were euthanized and their eyeballs were harvested. Retinal sections were stained with hematoxylin and eosin (HE) and tunnel staining. HE staining showed that, compared with loxP control mice, Cre mice had a significantly reduced density of photoreceptor cells in the outer nuclear layer (ONL) after tamoxifen induction, indicating that photoreceptor cell degeneration had occurred. Figure 9 As shown.
[0132] TUNNEL (TdT-mediated dUTP nick-end labeling) staining (staining technology provided by Beijing Yanyou Technology Co., Ltd.) is a widely used technique for monitoring apoptotic cells. It is based on in situ labeling of DNA breakage sites within intact, fixed cell nuclei. Intranuclear TUNNEL signals characterize DNA breakage and apoptosis, while extranuclear TUNNEL signals are false positives. In Cre mice, numerous strong positive signals co-localized with ONL cell nuclei, indicating widespread apoptosis in tamoxifen-induced ONL cells of Cre mice. Figure 10 As shown.
[0133] To examine retinal function in the PRPF31 CKO mouse model, ERG analysis was performed 3 weeks after systemic induction with tamoxifen via intraperitoneal injection, before significant weight loss. The amplitudes of both dark-adapted a and b waves in Cre mice were significantly decreased, indicating impaired visual function following systemic tamoxifen induction. Figure 11 As shown above, the results demonstrate that intraperitoneal injection of tamoxifen can successfully induce the RP11 disease model in Cre mice.
[0134] Example 5
[0135] Study on the induction method of PRPF31 CKO mouse model (selection of intraperitoneal induction drug dosage)
[0136] Tamoxifen was administered intraperitoneally to loxP and Cre mice at doses of 75 mg / kg, 225 mg / kg, and 675 mg / kg body weight, respectively, for five consecutive days. The survival status of the mice is shown in the table below.
[0137] Table 5. Survival status of mice after induction with tamoxifen intraperitoneal administration
[0138]
[0139] Therefore, the highest tolerated dose of tamoxifen for intraperitoneal injection in mice is 75 mg / kg mouse body weight, administered for 5 consecutive days.
[0140] Example 6
[0141] Optimization of peritoneal induction conditions in PRPF31 CKO mouse model
[0142] We investigated the drug concentration induced by intraperitoneal injection of tamoxifen. Thirty Cre mice were selected and divided into 5 groups of 6 mice each. Group G1 received no induction; Group G2 received tamoxifen at a dose of 25 mg / kg body weight for 5 consecutive days; Group G3 received tamoxifen at a dose of 50 mg / kg body weight for 5 consecutive days; Group G4 received tamoxifen at a dose of 75 mg / kg body weight for 5 consecutive days; and Group G5 received tamoxifen at a dose of 75 mg / kg body weight for 3 consecutive days. ERG (e.g., EEG) was measured before induction and 3 weeks after induction. Figure 12 ), and observe the survival of mice. Three weeks after induction, genomic DNA was extracted from the mouse tails, and Cre cleavage was detected (e.g., Figure 13 ).
[0143] The results showed that, except for group G1, all groups G2-G5 experienced weight loss after induction and died 3-4 weeks after induction, with no significant differences among the groups. ERG levels before and after intraperitoneal induction were as follows: Figure 12 As shown, except for group G1, the ERG levels in groups G2-G5 decreased significantly after induction, indicating that intraperitoneal injection of tamoxifen at doses of 25 mg / kg-75 mg / kg body weight for 3-5 consecutive days can successfully induce the RP11 disease model.
[0144] Example 7
[0145] Mouse models can effectively detect the distribution and expression of gene replacement drugs, as well as their impact on disease phenotypes (1)
[0146] To confirm that the tamoxicillin-induced RP11 mouse model constructed above can be used to test the in vivo efficacy of gene replacement therapy, we designed a gene replacement drug based on the mRNA splicing defect caused by insufficient PRPF31 in RP11 patients (see [link to relevant documentation]). Figure 14The CDS sequence of the human PRPF31 gene was inserted after the promoter of the pAV-CAG-CYP4V2 expression vector (Chinese Patent Application No. 202010520246.7, CN 113106124A, AAV vector expressing CYP4V2 and its uses), replacing the CDS region of the CYP4V2 gene, resulting in pAV-CAG-hPRPF31-BGH (the sequences of CAG, hPRPF31, and BGH elements are shown in SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12, respectively). Following the steps described in CN113106124A, the virus was packaged as AAV8, with the drug code AAV8-PRPF31, and a single subretinal injection efficacy verification experiment was conducted in PRPF31 CKO model mice. The experiment consisted of four groups: Group G1: without tamoxifen induction, subretinal injection of 1e9vg / μl / eye AAV8-EGFP (AAV8-CAG-EGFP, purchased from Paizhen Biotechnology); Group G2: induced with 75mg / kg mice using tamoxifen, subretinal injection of 1e9vg / μl / eye AAV8-EGFP; Group G3-LD / HD: induced with 75mg / kg mice using tamoxifen, subretinal injection of 1e8vg / μl / eye (AAV-PRPF31-LD) or 1e9vg / μl / eye (AAV-PRPF31-HD) AAV8-PRPF31.
[0147] All mice were euthanized as planned after in vivo data analysis. Genomic DNA, mRNA, and protein were extracted after retinal separation. Genomic DNA was used for PCR with specific primers (SEQ ID NO: 5-9), and the results further confirmed the Cre mouse genotype, indicating that mPrpf31 was effectively deleted. Figure 15 As shown.
[0148] After reverse transcription of mRNA, specific primers (SEQ ID NO: 13-18) were used for qPCR to detect the level of transgenic hPRPF31 mRNA. Proteins extracted from the primer sequences were used for Western blotting with specific antibodies (anti-PRPF31, Atlas, HPA041939; anti-GFP, Abclonal, AE012; anti-actin, Abclonal, AC026). The results showed that the effective expression of transgenic hPRPF31 was dose-dependent. Figure 16 and Figure 17 As shown above, the results indicate that this model can effectively detect the distribution and expression of gene replacement drugs.
[0149] Furthermore, the effective DNA repair indicates that the gene replacement drug can effectively exert its pharmacological activity in this mouse model. Based on the guidelines for preclinical drug research, the safety evaluation protocol should include the use in relevant species to fully assess drug safety. Relevant species refer to animals in which the test substance produces pharmacological activity, indicating that this model can be used for the safety evaluation of PRPF31 gene therapy.
[0150] While detecting the distribution and expression of gene therapy drugs, we evaluated the retinal structure and function of mice before animal sampling. FP, OCT, and ERG were performed 6 weeks after AAV injection (i.e., 3 weeks after tamoxifen induction). Figure 18 As shown.
[0151] like Figure 19 As shown, OCT and FP results indicated that 6 weeks after AAV injection, G2 mice (induced with tamoxifen and injected subretinally with AAV-EGFP) had more dense leukoplakia in their fundus than G1 mice (not induced with tamoxifen and injected subretinally with AAV-EGFP). However, the dense leukoplakia in the fundus of G3 mice (induced with tamoxifen and injected subretinally with AAV-PRPF31) was reduced, consistent with OCT results. Furthermore, changes in mouse retinal function were further examined using ERG, performed before and after systemic tamoxifen induction. The b-wave amplitude (i.e., the ratio of dark-adapted b-wave amplitude at week 6 to that at week 3) in the ERG was calculated to reflect retinal function in the Cre mouse model. The results showed that the dark-adapted b-wave amplitude of G1 (without tamoxifen induction, subretinal injection of AAV-EGFP) remained almost unchanged; while the dark-adapted b-wave amplitude of G2 (with tamoxifen induction, subretinal injection of AAV-EGFP) was only 53% preserved; however, the dark-adapted b-wave amplitude of G3 (with tamoxifen induction, subretinal injection of AAV-PRPF31) was 78% preserved. Figure 20 As shown in the figure. This indicates that the AAV-PRPF31 injection group retained more visual function after tamoxifen induction.
[0152] The above results indicate that after treatment with gene replacement drugs, the fundus abnormalities and retinal function of the model mice were restored to a certain extent, suggesting that the model mice can be effectively used for in vivo evaluation of gene replacement drugs.
[0153] Example 8
[0154] Mouse models can effectively detect the distribution and expression of gene replacement drugs, as well as their impact on disease phenotypes (2).
[0155] We packaged pAV-CAG-hPRPF31-BGH into an AAV2.7m8 virus, with the drug code AAV2.7m8-PRPF31 (AAV2.7m8-CAG-PRPF31). A PRPF31-CKO mouse model was established via intravitreal injection, with an injection dose of 1 μl. The left eye was injected with AAV2.7m8-EFS-GFP virus (purchased from Paizhen Biotechnology), and the right eye was injected with AAV2.7m8-CAG-PRPF31 (virus packaging completed by Paizhen Biotechnology). The experimental groups are as follows:
[0156] Table 6
[0157]
[0158] Twelve weeks after intravitreal injection of gene replacement drug, mice were induced with tamoxifen intraperitoneally at a dose of 75 mg / kg for three consecutive days. Three weeks post-induction (W15), ERG was used to assess visual function; fundus photography and OCT were performed before induction (W10) and four weeks post-induction (W16) to examine retinal structure. After all tests were completed, tissue samples were collected to analyze drug distribution and expression.
[0159] ERG results ( Figure 21 The results showed that, compared with group G1, the overall ERG levels in groups G2-G4 were decreased, indicating that the RP11 animal model was successfully induced. In groups G2-G4, compared with the control eyes injected with AAV2.7m8 virus, intravitreal injection of AAV2.7m8-PRPF31 increased the ERG amplitude in mice in a dose-dependent manner. When the dose was 1e9vg / eye, the increase in ERG amplitude was statistically different from that in the control eyes (paired t-test, *p<0.05; **p<0.01; ***p<0.001), indicating that intravitreal injection of AAV2.7m8-PRPF31 significantly improved the visual function of RP11 model mice.
[0160] Fundus color images and OCT results ( Figure 22 The results showed that there were no significant changes in fundus photography before and after induction in Lox mice in group G1; fundus photography of Cre mice in groups G2-G5 after induction showed large areas of retinal degeneration. There was no significant difference between the right eye (AAV2.7m8-PRPF31) and the left eye (AAV2.7m8-GFP).
[0161] We performed CRE dissection analysis on mouse eye tissue (retina and RPE) and brain tissue, such as... Figure 23 As shown in the figure. The results showed that the mouse mPRPF31 genome was effectively cleaved in groups G2-G4.
[0162] We examined the expression of the drug, and the mRNA expression was as follows: Figure 24As shown, the mRNA expression level of endogenous mPRPF31 in mice was higher than that in RPE cells. After intraperitoneal induction in Cre mice, the mRNA expression level of mPRPF31 decreased by approximately half. The mRNA level of transgenic hPRPF31 in retinal cells was higher than that in RPE cells. At an injection dose of 1e6, the mRNA expression level was below the detection limit; at injection doses of 1e7-1e9, the transgenic mRNA was expressed at high levels in a dose-dependent manner. At an injection dose of 1e8, the transgenic mRNA level in both retinal cells and RPE cells was closest to the mRNA expression level of endogenous mPRPF31 in mice.
[0163] Protein expression status as follows Figure 25 As shown, the expression levels of GFP protein and transgenic hPRPF31 protein in retinal cells were high, both in a dose-dependent manner. Protein expression levels in RPE cells were weak.
[0164] Example 9
[0165] Model mice can effectively detect the distribution and expression of gene replacement drugs, as well as their impact on disease phenotypes (3).
[0166] We modified the vector based on pAV-CAG-hPRPF31-BGH to obtain pAV-BIP-hPRPF31-BGH, where the BIP promoter sequence was obtained from the literature (Rose, AM, AZShah, NHWaseem, CFChakarova, G.Alfano, RGCoussa, R.Ajlan, RKKoenekoop and SSBhattacharya (2012). "Expression of PRPF31 and TFPT: regulation in health and retinal disease." HumMol Genet 21(18):4126-4137). The pAV-BIP-hPRPF31-BGH vector was packaged into AAV2.7m8 virus (AAV2.7m8-BIP-PRPF31) and AAV8 virus (AAV8-BIP-PRPF31) (virus packaging was completed by Paizhen Biotechnology). A subretinal PRPF31-CKO mouse model was established using a PRPF31-CKO mouse model. The injection dose was 1 μl. The left eye was injected with either AAV2.7m8-EFS-GFP or AAV8-EFS-GFP virus (purchased from Paizhen Biotechnology), and the right eye was injected with either AAV2.7m8-BIP-PRPF31 or AAV8-BIP-PRPF31. The experimental groups are shown in the table below:
[0167] Table 7
[0168]
[0169] Twelve weeks after subretinal injection of gene replacement drug, mice were induced with tamoxifen intraperitoneally at a dose of 75 mg / kg for three consecutive days. Three weeks post-induction (W15), ERG was used to assess visual function. Fundus photography and OCT were performed before induction (W10) and four weeks post-induction (W16) to examine retinal structure. After all tests were completed, tissue samples were collected to analyze drug distribution and expression.
[0170] ERG results ( Figure 26 The results showed that after tamoxifen induction, there was no statistically significant difference in ERG amplitude between the two eyes of Lox mice (G1-G2 groups) compared to the control eyes. However, the treated eyes in the G3-G4 groups showed increased ERG amplitude levels, with statistically significant differences at certain stimulation intensities (paired t-test, *p<0.05; **p<0.01; ***p<0.001). These ERG results indicate that subretinal injection of AAV2.7m8-BIP-PRPF31 or AAV8-BIP-PRPF31 can improve visual function in RP11 model mice.
[0171] Fundus photography and OCT results showed that in the G1-G2 group of Lox mice, there were no significant changes in fundus photography and OCT results before and after induction. In the G3-G4 group of Cre mice, after induction, fundus photography of the left control eye showed a large number of white spots, and OCT showed blurred retinal structures and disappearance of the outer nuclear layer and RPE junction, indicating large-area retinal degeneration. Conversely, fundus photography and OCT results of the right treatment eye did not show significant changes. Figure 27 (A) No significant difference was found between the right and left eyes. The above differences were observed in all mice in group G4 (WIB24003-105e).
[0172] It is evident in both eyes. Figure 27 B).
[0173] Tunnel staining of mouse retinal sections showed, as Figure 28 As shown, no obvious TUNNEL signal was observed in the retina of loxP mice (G1-2) after tamoxifen induction; strong TUNNEL signal was observed in the left eye (injected with GFP) of Cre mice (G3-4) after tamoxifen induction, and it was co-localized with some cell nuclei in the outer nuclear layer, indicating that a large number of photoreceptor cells underwent apoptosis; no TUNNEL signal or very few TUNNEL signals were observed in the right eye (injected with PRPF31), indicating that PRPF31 replacement therapy can effectively reduce tamoxifen-induced retinal photoreceptor cell apoptosis.
[0174] We performed CRE dissection analysis on mouse eye tissue (retina and RPE) and brain tissue, such as... Figure 29As shown in the figure. The results showed that the mouse mPRPF31 genome was effectively cleaved in groups G2-G4.
[0175] We examined the expression of the drug, and the mRNA expression was as follows: Figure 30 As shown, the mRNA expression level of endogenous mPRPF31 in mice was higher than that in RPE cells. After intraperitoneal induction in Cre mice, the mRNA expression level of mPRPF31 decreased by approximately half. Following subretinal administration, the transgenic mRNA levels of AAV8 serotype and AAV2.7m8 serotype virus in retinal cells were comparable, ranging from 3.6 to 4.7 x 10⁻⁶. 5 Copy / ng RNA; however, in RPE, the expression level of the AAV8 serotype was significantly higher than that of the AAV2.7m8 serotype, at 3.9–5.7 x 10^6 copies / ng RNA, respectively. 4 Copy / ng RNA, and 2.9–3.3 x 10 5 The difference between the copies / ng RNA was approximately 6-8 times.
[0176] Protein expression status as follows Figure 31 and Figure 32 As shown in the figure, the protein expression level of the transgenic hPRPF31 in retinal cells and RPE cells was higher in the AAV8 serotype than in the AAV2.7m8 serotype, which is consistent with the RNA level. These results indicate that subretinal administration is more effective in infecting RPE cells than intravitreal administration; and the AAV8 serotype has a stronger infectivity for RPE cells than the AAV2.7m8 serotype.
[0177] Those skilled in the art should understand that although the present invention has been specifically described with reference to the above embodiments, the present invention is not limited to these specific embodiments. Based on the methods and technical solutions taught in this invention, those skilled in the art can make appropriate modifications or improvements without departing from the spirit of the present invention, and the equivalent embodiments obtained therefrom are all within the scope of the present invention.
[0178] References
[0179] 1.O'Neal, TB and EELuther, Retinitis Pigmentosa, in Stat Pearls. 2021: Treasure Island (FL).
[0180] 2. Verbakel, SK, et al., Non-syndromic retinitis pigmentosa. Prog RetinEye Res, 2018.66: p.157-186.
[0181] 3. Hartong, D. T., E. L. Berson, and T. P. Dryja, Retinitis pigmentosa. Lancet, 2006. 368(9549): p. 1795 - 809.
[0182] 4. Audo, I., et al., Prevalence and novelty of PRPF31 mutations in French autosomal dominant rod - cone dystrophy patients and a review of published reports. BMC Med Genet, 2010. 11: p. 145.
[0183] 5. Hafler, B. P., et al., Course of Ocular Function in PRPF31 Retinitis Pigmentosa. Semin Ophthalmol, 2016. 31(1 - 2): p. 49 - 52.
[0184] 6. Rose, A. M., et al., Dominant PRPF31 mutations are hypostatic to a recessive CNOT3 polymorphism in retinitis pigmentosa: a novel phenomenon of "linked trans - acting epistasis". Ann Hum Genet, 2014. 78(1): p. 62 - 71.
[0185] 7. Vithana, E. N., et al., Expression of PRPF31 mRNA in patients with autosomal dominant retinitis pigmentosa: a molecular clue for incomplete penetrance? Invest Ophthalmol Vis Sci, 2003. 44(10): p. 4204 - 9.
[0186] 8.Rio Frio,T.,et al.,Two trans-acting eQTLs modulate the penetranceof PRPF31 mutations.Hum Mol Genet,2008.17(20):p.3154-65.
[0187] 9.Brydon,E.M.,et al.,AAV-Mediated Gene Augmentation Therapy RestoresCritical Functions in Mutant PRPF31(+ / -)iPSC-Derived RPE Cells.Mol TherMethods Clin Dev,2019.15:p.392-402.
[0188] 10.Li,J.,et al.,Prpf31 is essential for the survival anddifferentiation of retinal progenitor cells by modulating alternativesplicing.Nucleic Acids Res,2021.
[0189] 11.Linder,B.,et al.,Systemic splicing factor deficiency causestissue-specific defects:a zebrafish model for retinitis pigmentosa.Hum MolGenet,2011.20(2):p.368-77.
[0190] 12.Yin,J.,et al.,Mutant Prpf31 causes pre-mRNA splicing defects androd photoreceptor cell degeneration in a zebrafish model for Retinitispigmentosa.Mol Neurodegener,2011.6:p.56.
[0191]
[0192]
[0193]
Claims
1. A method of constructing a retinitis pigmentosa (RP) animal model, said method comprising introducing a PRPF31 gene mutation in the genome of an animal, said mutation affecting PRPF31 gene expression in said animal, leading to PRPF31 insufficiency and / or generating a RP11 disease phenotype.
2. The method of claim 1, wherein said mutation is selected from the group consisting of a point mutation, a deletion mutation, an insertion mutation, and an inversion or duplication mutation, preferably a deletion mutation or a pathogenic mutation of PRPF31 as shown in Table 1, more preferably said mutation is repairable by gene therapy.
3. The method of claim 1 or 2, wherein said animal is a non-human mammal, preferably a ruminant, a canine, a Leporid, a Felid or a Rodent, more preferably a mouse, a pig, a monkey, a bear, a sheep, a goat, a horse, an ass, a rabbit, a cat, a cow, a fox or a dog, still more preferably a mouse or a rat, still more preferably a C57BL / 6 mouse or a BALB / c mouse, still more preferably a C57BL / 6J and a C57BL / 6N mouse, most preferably a C57BL / 6J mouse.
4. The method of any one of claims 1 to 3, wherein said RP11 disease phenotype is selected from the group consisting of a cell structure defect, a phagocytosis impairment, a ciliogenesis defect, a barrier function impairment, a retinal function impairment, a photoreceptor cell layer thinning, a photoreceptor cell apoptosis and a combination thereof.
5. The method of any one of claims 1 to 4, wherein said mutation is a deletion mutation comprising a deletion of one, two or more exons of the PRPF31 gene, said exons being selected from the group consisting of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6 and exon 7, preferably exon 4, exon 5 or a combination thereof.
6. The method of claim 5, wherein said deletion is achieved by a gene knockout technique, a gene editing technique or a combination thereof, preferably said gene knockout technique is a conditional gene knockout technique or a systemic gene knockout technique, wherein preferably said conditional gene knockout technique is a Cre-loxP gene knockout technique, said gene editing technique is selected from the group consisting of a CRISPR / Cas technique, a zinc finger nuclease technique (ZFN) and a transcription-activator-like effector nuclease technique (TALEN), preferably a CRISPR / Cas technique.
7. The method of claim 6, wherein said Cre-loxP gene knockout technique comprises an estrogen-inducible Cre-loxP gene knockout technique, preferably comprising a step of inducing Cre activity using tamoxifen or an analogue thereof.
8. The method of any one of claims 1 to 7, comprising the following steps: 1) inserting two loxP sites in the PRPF31 gene of said animal by a conditional Cre-loxP gene knockout technique; and 2) inducing Cre enzyme into the nucleus by tamoxifen or an analogue thereof, leading to the knockout of the fragment of the PRPF31 gene between said two loxP sites.
9. The method of any one of claims 6 to 8, wherein: 1) the animal is a mouse, preferably a C57BL / 6J mouse; 2) The mice obtained in step 1) are C57BL / 6J Cya-Prpf31 em1flox mice, and are crossed with C57BL / 6J CAGGCre-ER TM mice, and are crossed with C57BL / 6J CAGGCre-ER em1flox / em1flox mice, and are crossed with C57BL / 6J CAGGCre-ER em1flox / em1flox mice, and are crossed with C57BL / 6J CAGGCre-ER TM mice, and are crossed with C57BL / 6J CAGGCre-ER 3) the method further comprises a step of genotyping the obtained mouse model to determine that the PRPF31 gene has been knocked out; and / or 4) the method further comprises a step of phenotyping the obtained mouse model to determine that it has the RP11 disease phenotype.
10. The method according to any one of claims 7 to 9, wherein the tamoxifen or analog thereof induction is induced by intraperitoneal injection.
11. The method according to claim 10, wherein each mouse is intraperitoneally injected with 25 mg - 75 mg tamoxifen per kg mouse weight per day for 3 to 5 consecutive days.
12. The method according to any one of claims 7 to 9, wherein the tamoxifen or analog thereof induction is induced by intravitreal injection of 1 to 50 mg / ml tamoxifen solution (in corn oil as solvent) in 1-10 pl.
13. An RP animal model, preferably a mouse model, prepared by the method according to any one of claims 1 to 12.
14. A method of identifying and / or testing a gene therapy drug for treating retinitis pigmentosa (RP) of type RP11, comprising: 1) administering the gene therapy drug to a retinitis pigmentosa (RP) animal model prepared by the method according to any one of claims 1 to 12; and 2) detecting whether the RP11 disease phenotype of the animal model is improved; if the RP11 disease phenotype of the animal model is improved, it indicates that the gene therapy drug is effective for treating RP11.
15. The method according to claim 14, wherein: the animal in step 1) is a mouse; the administration in step 1) is intraocular administration, such as subretinal space injection or intravitreal injection; the detecting the RP disease phenotype of the animal model in step 2) comprises one or more of the following steps: a) detecting fundus changes of the model animal by fundus photography (FP) and optical coherence tomography (OCT); and b) detecting visual function changes of the model animal by electroretinogram (ERG).
16. The method according to claim 14 or 15, wherein the gene therapy drug comprises an AAV-based gene replacement drug or a gene editing drug, preferably it is in the form of a recombinant AAV (rAAV) viral vector, more preferably it is an AAV8 serotype and an AAV2.7m8 serotype rAAV, most preferably an AAV8 serotype rAAV.
17. Use of the RP animal model according to claim 13 for in vivo evaluation of the efficacy and / or safety of a gene therapy drug for treating retinitis pigmentosa (RP).
18. A method of treating retinitis pigmentosa (RP) of type RP11 in a subject, comprising: 1) administering a gene therapy drug to the subject; 2) detecting whether the RP11 disease phenotype of the subject is improved; if the RP11 disease phenotype of the subject is improved, it indicates that the gene therapy drug is effective for treating RP11.
19. The method according to claim 18, wherein: the subject is a mouse; the administration in step 1) is intraocular administration, such as subretinal space injection or intravitreal injection; the detecting the RP disease phenotype of the subject in step 2) comprises one or more of the following steps: a) detecting fundus changes of the subject by fundus photography (FP) and optical coherence tomography (OCT); and b) detecting visual function changes of the subject by electroretinogram (ERG).
20. The method according to claim 18 or 19, wherein the gene therapy drug comprises an AAV-based gene replacement drug or a gene editing drug, preferably it is in the form of a recombinant AAV (rAAV) viral vector, more preferably it is an AAV8 serotype and an AAV2.7m8 serotype rAAV, most preferably an AAV8 serotype rAAV.
Citation Information
Patent Citations
AAV vector expressing CYP4V2 and application thereof
CN113106124A