Recombinant lactobacillus plantarum for preventing and controlling chicken necrotic enteritis, and preparation method and application thereof

Abstract

The present application belongs to the technical field of genetic engineering, and particularly relates to a recombinant plant lactobacillus for preventing and controlling chicken necrotic enteritis as well as a preparation method and application thereof. The present application provides an oral vaccine carrier capable of co-expressing multiple key virulence factor antigens (FimB, NetB, CnaA, FBA) of Clostridium perfringens, and the efficiency of the vaccine carrier being recognized and taken by professional antigen presenting cells is significantly improved through fusion of dendritic cell (DC) targeting molecules (nanobody Phi74), so as to enhance immunogenicity. Immunization of animals using the recombinant lactobacillus can induce mucosal immunity, cellular immunity and humoral immunity response, and comprehensively enhance the immune ability of the body, thereby establishing a safe, efficient and suitable oral immunization scheme for large-scale breeding for treating chicken necrotic enteritis.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a recombinant Lactobacillus plantarum for the prevention and control of necrotizing enteritis in chickens, its preparation method, and its application. Background Technology

[0002] Necrotic enteritis (NE) in chickens is caused by Clostridium perfringens (Clostridium perfringens). Clostridium perfringens Necrotic enteritis (NE) is a common acute non-contact intestinal infectious disease, primarily affecting chicks and growing flocks. The disease has a rapid onset and high mortality rate; chickens with a longer disease course exhibit severe damage to the intestinal mucosa and digestive and absorptive dysfunction, ultimately leading to a significant reduction in growth performance and feed conversion ratio, causing substantial economic losses to the poultry industry. Currently, NE control mainly relies on antibiotics, but with the increasing prominence of bacterial resistance, the development of a vaccine for necrotizing enteritis in chickens has become a critical issue that urgently needs to be addressed by the poultry industry.

[0003] Lactic acid bacteria, as oral vaccine carriers, have significant advantages such as high safety and effective induction of mucosal immune responses. However, traditional recombinant lactic acid bacteria vaccines are difficult for intestinal-associated antigen-presenting cells (such as dendritic cells, DCs) to actively recognize and capture, resulting in weak immunogenicity and low antigen delivery efficiency. Furthermore, traditional recombinant lactic acid bacteria vaccines cannot completely block the adhesion and intestinal colonization processes of pathogenic bacteria.

[0004] Therefore, there is an urgent need in this field to develop a novel genetically engineered live vector vaccine that can simultaneously express multiple protective antigens, has efficient targeted delivery capabilities, and is safe for oral administration. Summary of the Invention

[0005] To address the shortcomings of the existing technology, the purpose of this invention is to provide a recombinant Lactobacillus plantarum for the prevention and control of necrotizing enteritis in chickens, its preparation method, and its application.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] In a first aspect, the present invention provides a recombinant *Lactobacillus plantarum* for the prevention and control of necrotizing enteritis in chickens, wherein the recombinant *Lactobacillus plantarum* contains an expression vector expressing four antigens and a Phi74 phage nanobody gene; the gene contains sequences encoding a fusion gene for expressing FimB protein, NetB protein, CnaA protein, LysM-FBA protein and Phi74 phage nanobody; the sequence encoding FimB protein is shown in SEQ ID NO:1, the sequence encoding NetB protein is shown in SEQ ID NO:2, the sequence encoding CnaA protein is shown in SEQ ID NO:3, the sequence encoding LysM-FBA protein is shown in SEQ ID NO:4, and the sequence encoding Phi74 phage nanobody is shown in SEQ ID NO:5.

[0008] A second aspect of the present invention provides a method for preparing the above-mentioned recombinant Lactobacillus plantarum, comprising the following steps:

[0009] The expression vector containing the fusion gene was transformed into host cells; the nucleotide sequence of the fusion gene is shown in SEQ ID NO:6.

[0010] A third aspect of the invention provides a vaccine comprising the aforementioned recombinant Lactobacillus plantarum.

[0011] In a fourth aspect, the invention provides a composition comprising the above-described recombinant Lactobacillus plantarum.

[0012] A fifth aspect of the invention provides the use of the above-described recombinant plant lactic acid bacteria, vaccine, or composition in the preparation of products for the prevention and control of necrotizing enteritis in chickens.

[0013] Compared with the prior art, the technical solution of the present invention has the following beneficial effects:

[0014] This invention provides an oral vaccine vector capable of co-expressing multiple key virulence factor antigens (FimB, NetB, CnaA, FBA) of Clostridium perfringens. By fusing a dendritic cell (DC) targeting molecule (nanobody Phi74), the efficiency of the vaccine vector being recognized and taken up by professional antigen-presenting cells is significantly improved, thereby enhancing immunogenicity. Immunizing animals with the recombinant lactobacillus can induce mucosal immunity, cellular immunity, and humoral immunity, comprehensively enhancing the body's immune capacity. This establishes a safe, efficient, and large-scale oral immunization regimen for treating necrotizing enteritis in chickens, replacing or reducing antibiotic use and achieving effective prevention and control of necrotizing enteritis in chickens. Attached Figure Description

[0015] Figure 1This is a Western blot result of recombinant strains NC8 (pYL594) and NC8 (pYL595) expressing four antigens: FimB, NetB, CnaA, and FBA, in an embodiment of the present invention. In this figure, A represents the Western blot result of recombinant CanA polyclonal antibody expression in NC8 cells, M represents the protein molecular weight standard, - represents NC8 blank bacteria, 1 represents NC8 (pYL560), 2 represents NC8 (pYL594), and 3 represents NC8 (pYL595); B represents the Western blot result of recombinant FBA polyclonal antibody expression in NC8 cells, M represents the protein molecular weight standard, - represents NC8 blank bacteria, 1 represents NC8 (pYL594), and 2 represents NC8 (pYL595); C represents the Western blot result of recombinant FimB polyclonal antibody expression in NC8 cells. In the blot results, M represents the protein molecular weight standard, - represents NC8 blank bacteria, 1 represents NC8 (pYL560), 2 represents NC8 (pYL594), and 3 represents NC8 (pYL595); D represents the Western blot results of recombinant protein NetB monoclonal antibody expression in NC8 bacteria, M represents the protein molecular weight standard, - represents NC8 blank bacteria, 1 represents NC8 (pYL560), 2 represents NC8 (pYL594), and 3 represents NC8 (pYL595).

[0016] Figure 2 The image shows the results of Western blotting detection of FBA antigen expression in the cell walls of recombinant strains NC8 (pYL594) and NC8 (pYL595) in this embodiment of the invention. M represents the protein molecular weight standard, - represents the NC8 blank strain, 1 represents NC8 (pYL594), and 2 represents NC8 (pYL595).

[0017] Figure 3 This is a schematic diagram of electron microscopy observation results in an embodiment of the present invention. In the diagram, A is the morphological image of the PBS group under electron microscopy; B is the morphological image of the NC8 (pYL594) non-targeted control group under electron microscopy; and C is the morphological image of the NC8 (pYL595) targeted experimental group under electron microscopy.

[0018] Figure 4 The following is a statistical graph showing the results of flow cytometry analysis of the uptake efficiency of NC8 (pYL594) and NC8 (pYL595) by chicken BMDC in an embodiment of the present invention. A is the FITC fluorescence signal result after 120 min of PBS stimulation of dendritic cells; B is the FITC fluorescence signal result after 120 min of NC8 (pYL594) stimulation of dendritic cells; C is the FITC fluorescence signal result after 120 min of NC8 (pYL595) stimulation of dendritic cells.

[0019] Figure 5 The results are from the flow cytometry analysis of FITC fluorescence signals. This means P < 0.0001.

[0020] Figure 6 The images show the co-localization of CFSE-labeled strains (green), DiI-labeled BMDC cell membranes (red), and DAPI-labeled BMDC nuclei (blue) observed by laser confocal microscopy in this embodiment of the invention. A represents the immunofluorescence results of the PBS blank control group; B represents the immunofluorescence results of the NC8 (pYL594) non-targeted control group; and C represents the immunofluorescence results of the NC8 (pYL595) targeted experimental group.

[0021] Figure 7 The results of quantitative analysis of fluorescence intensity in this embodiment of the invention are as follows. This means P < 0.0001.

[0022] Figure 8 This is a graph showing the quantitative results of adhesion and invasion of non-targeted and targeted bacteria and dendritic cells after co-incubation for 2 hours at MOI=100 in this embodiment of the invention; wherein, A is the quantitative result of adhesion and invasion of non-targeted bacteria and dendritic cells after co-incubation for 2 hours; B is the quantitative result of adhesion and invasion of targeted bacteria and dendritic cells after co-incubation for 2 hours; in the figure, This indicates that P < 0.05. This indicates that P < 0.01.

[0023] Figure 9 The diagram shows the results of qRT-PCR detection of dendritic cell maturation-related gene transcription levels in an embodiment of the present invention. In the diagram, A represents the results of qRT-PCR detection of dendritic cell chemotaxis-related gene CCL5 transcription level; B represents the results of qRT-PCR detection of dendritic cell chemotaxis-related gene CCR7 transcription level; C represents the results of qRT-PCR detection of dendritic cell maturation marker CD83 transcription level; and D represents the results of qRT-PCR detection of dendritic cell maturation marker CD86 transcription level.

[0024] Figure 10 The figures show the ELISA results for detecting FBA antigen-coated intestinal mucosal IgA antibody levels in embodiments of the present invention. In the figures, G1 represents the PBS group, G2 represents the NC8 group, G3 represents the NC8 (pYL560) group, G4 represents the NC8 (pYL594) group, and G5 represents the NC8 (pYL595) group. This indicates that P < 0.05.

[0025] Figure 11 The image shows the results of immunofluorescence analysis of IgA antibody levels in ileal tissue sections in this embodiment of the invention; where A is the PBS group; B is the NC8 group; C is the NC8 (pYL560) group; D is the NC8 (pYL594) group; and E is the NC8 (pYL595) group.

[0026] Figure 12 This study analyzes the expression levels of IgA in ileal tissue in each group in this embodiment of the invention.

[0027] Figure 13 The image shows the results of immunofluorescence analysis of IgA antibody levels in jejunal tissue sections in this embodiment of the invention; where A is the PBS group; B is the NC8 group; C is the NC8 (pYL560) group; D is the NC8 (pYL594) group; and E is the NC8 (pYL595) group.

[0028] Figure 14 This is an analysis of the expression level of IgA in jejunal tissue in each group in this embodiment of the invention.

[0029] Figure 15 This is a comparative chart showing the intestinal lesion scores of chickens in each group during the challenge protection experiment in this embodiment of the invention. This indicates that P < 0.01. This means P < 0.0001.

[0030] Figure 16 This is a graph showing the weight change of chickens in each group during the challenge protection experiment in this embodiment of the invention.

[0031] Figure 17 This is a schematic diagram of intestinal lesions in chickens of each group during the challenge protection experiment in this embodiment of the invention. In the diagram, sample 1, sample 2, and sample 3 represent random samples selected from each group. Detailed Implementation

[0032] It should be noted that the following detailed descriptions are exemplary and intended to provide further illustration of the invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0033] Terminology Explanation:

[0034] Clostridium perfringens ( Clostridium perfringens ): Gram-positive anaerobic spore-forming bacteria that can produce a variety of toxins (such as NetB) and virulence factors (such as FimB, CnaA, FBA), and is the main pathogen causing necrotic enteritis in chickens.

[0035] Necrotic enteritis in chickens: refers to an acute intestinal disease in poultry caused by Clostridium perfringens (especially type G), characterized by intestinal mucosal hemorrhage, necrosis, and ulceration.

[0036] Multiple antigen co-expression: refers to the simultaneous expression of two or more pathogen antigen proteins in the same host cell or vector.

[0037] DC targeting (dendritic cell targeting): refers to a technical strategy that uses specific molecules to deliver vaccines or antigens to dendritic cells in a targeted manner to enhance antigen presentation and immune activation efficiency.

[0038] The term “expression” refers to the cellular processes involved in the production of RNA and proteins, and, where appropriate, the secretion of proteins, including, but not limited to, transcription, transcript processing, translation, and protein folding, modification, and processing, as applicable.

[0039] The term “encoding” includes references to nucleotides and / or amino acids that correspond to other nucleotides or amino acids in the sense of transcription and / or translation.

[0040] As mentioned earlier, traditional recombinant lactic acid bacteria vaccines suffer from low antigen delivery efficiency and weak cellular immune activation. This invention provides an oral vaccine for necrotizing enteritis in chickens that can efficiently induce humoral, cellular, and mucosal immunity. Its active ingredient, *Lactobacillus plantarum* NC8 (pYL595), not only simultaneously displays four key antigens of *Clostridium perfringens* type G (FimB, NetB, CnaA, and Fba) on its surface, but also incorporates Phi74 nanobodies to achieve active targeting of chicken dendritic cells (DCs).

[0041] In a typical embodiment of the present invention, a recombinant *Lactobacillus plantarum* for controlling necrotizing enterocolitis in chickens is provided. The recombinant *Lactobacillus plantarum* contains an expression vector expressing a fusion gene. The fusion gene includes sequences encoding FimB protein, NetB protein, CnaA protein, FBA protein, and Phi74 phage nanobody. The sequence encoding FimB protein is shown in SEQ ID NO:1; the sequence encoding NetB protein is shown in SEQ ID NO:2; the sequence encoding CnaA protein is shown in SEQ ID NO:3; the sequence encoding LysM-FBA protein is shown in SEQ ID NO:4; the sequence encoding Phi74 phage nanobody is shown in SEQ ID NO:5; and the sequence of the fusion gene is shown in SEQ ID NO:6.

[0042] Gaaaacaccgcgaacattccgctgattgtgcgccaagaatttaacgtgtataccaaagatagcaaagcgattgatatgattggcaaatatgaattaaaagccattagcgagaacgcgccgatgccggaagaaagcaaaaacggcagctttatttttaacattgatggcaacgataaacagtttaccattccgctggcgtatacccatggcggcgtgtatatttatcagattcagcagattacgcagagcaaagataactatatttatgataaaaacagctataaaattaccgtgtatgtgaaaaacgcggaaaacaaccatctgattccgcagattattgtgaagaatgaaaacaacgaaaaatgtgaagagatttgcttctataacatttataagcaaaagaacaaaattaacgaaattagcaaaaccccgtataaaccgaacggcattaacgtgccgaaaaccggcgataccaccaactaa(SEQ ID NO:1)。

[0043] Caaggcccgctgggcagcagcgaactgaacgatattaataaaattgaactgaaaaacctgagcggcgaaattattaaagaaaacggcaaagaagcgattaaatatacgagcagcgataccgcgagccataaaggctggaaagcgaccctgagcggcacctttattgaagatccgcatagcgataagaaaaccgcgctgctgaacctggaaggctttattccgagcgataagcagatttttggcagcaaatattatggcaaaatgaaatggccggaaacctatcgcattaacgtgaaaagcgcggacgtgaataataatattaaaattgcgaatagcattccgaaaaataccattgataaaaaagacgtgagcaatagcattggctatagcattggcggcaatattagcgtggaaggcaaaaccgcgggcgcgggcattaacgcgagctataacgtgcagaataccattagctatgagcagccggattttcgcaccattcagcgcaaagatgatgcgaacctggcgagctgggatattaaattcgtggagacgaaagatggctataatattgatagctatcatgcgatttatggcaatcagttatttatgaaaagccgcttatataataacggcgataaaaactttaccgatgatcgcgatctgagcaccctgattagcggcggctttagcccgaatatggcgctggcgctgaccgcgccgaaaaacgcgaaagaaagcgtgattatcgtggaatatcagcgctttgataacgactatattctgaactgggaaaccacgcagtggcgcggcaccaataaactgagcagcacgagcgaatataacgaatttatgtttaaaattaactggcaagatcataaaattgaatattatctggattataaagatgacgatgataaataa(SEQ ID NO:2)。

[0044]

[0045]

[0046] Gagcagaagctgatcagcgaggaggacctgggaggaggaggaagccaagttcagctagtagaatcaggtggagggttggtgcaagaaggtggctccttgcgcctga gctgtgttgtttcgggttctcgtgacagcattaacgctatgggttggtatcgtcaggcaccgggtaagcagagagagctggtcgcgacggtggcgggtgttggctc caccaattacgcggcgagcgttaaaggccgtttcagcatcagcatggataacgccaagaacaccgcgtatttacagatgaatagcctgaaaccggaagacaccgct gtgtattactgcgtggccgatctgcgtggctctgatcgttggctgtgggctcaaggtactcaagttaccgtcagcgcagcgcatcactccgaggacccgtaa (seq ID NO:5).

[0047] This invention provides an oral vaccine carrier capable of co-expressing multiple key virulence factor antigens (FimB, NetB, CnaA, FBA) of Clostridium perfringens. By fusing a dendritic cell (DC) targeting molecule (nanobody Phi74), the efficiency of the vaccine carrier being recognized and taken up by professional antigen-presenting cells is significantly improved, thereby enhancing immunogenicity.

[0048] In some implementations, the nanobody Phi74 can be replaced with other targeting units that can specifically bind to receptors on the surface of chicken dendritic cells, such as specific peptides, single-chain antibody fragments (scFv), or aptamers.

[0049] In one embodiment, the starting strain of the recombinant Lactobacillus plantarum is selected from any one of Lactobacillus plantarum, Lactobacillus casei, Lactobacillus reuteri, and Lactococcus lactis.

[0050] In one embodiment, the starting strain of the recombinant Lactobacillus plantarum is Lactobacillus plantarum (… Lactobacillus plantarum NC8.

[0051] In another typical embodiment of the present invention, a method for constructing the above-mentioned recombinant Lactobacillus plantarum is provided, comprising the following steps:

[0052] The expression vector containing the fusion gene was transformed into host cells; the nucleotide sequence of the fusion gene is shown in SEQ ID NO:6.

[0053] The recombinant *Lactobacillus plantarum* of the present invention can also insert the fusion gene into the chromosome of the starting strain using conventional methods. Any known genetic engineering method can be used to insert the gene into the chromosome of the starting strain. For example, methods using retroviral vectors, adenovirus vectors, adeno-associated virus vectors, herpes simplex virus vectors, poxvirus vectors, lentiviral vectors, and non-viral vectors are available.

[0054] A "vector" is a DNA product containing a DNA sequence that is operatively linked to a suitable regulatory sequence capable of expressing that DNA in a suitable host. Vectors can be plasmids, phage particles, or simple potential genomic inserts. When transformed into a suitable host, vectors can be replicated or perform functions independent of the host genome, or some can integrate with the genome. Plasmids are currently the most commonly used form of vector.

[0055] Typical plasmid vectors include (a) an origin of replication for efficient replication, such that a predetermined number of plasmid vectors are contained in each host cell; (b) an antibiotic resistance gene or auxotrophic marker gene to screen host cells transformed with the plasmid vector; and (c) a restriction enzyme site for inserting a foreign DNA fragment. Even if a suitable restriction enzyme site is not available, the vector and foreign DNA can be easily ligated using synthetic oligonucleotide adaptors or linkers according to conventional methods (Gibson assembly). If necessary, methods that synthesize the entire desired sequence are also typically used.

[0056] Furthermore, when a nucleic acid sequence aligns with another nucleic acid sequence based on their functional relationship, it is said to be "operably linked" to it. This can be a gene and a control sequence linked in such a way that gene expression is possible when a suitable molecule (e.g., a transcription activator protein) is linked to the control sequence. For example, when expressed as a pre-protein involved in polypeptide secretion, the DNA for the pre-sequence or secretion leader sequence is operably linked to the DNA of the polypeptide; when influencing the transcription of the sequence, a promoter or enhancer is operably linked to the coding sequence; when influencing the transcription of the sequence, a ribosome binding site is operably linked to the coding sequence; or when localized to promote translation, a ribosome binding site is operably linked to the coding sequence.

[0057] Typically, the term "operably ligated" means that the linked DNA sequence is in contact with it, or that the secretory leader sequence is in contact with it and present in the reading frame. However, enhancers do not need to be in contact with it. The ligation of these sequences is achieved by binding (ligation) at a convenient restriction enzyme site. When such a site is unavailable, synthetic oligonucleotide adaptors or linkers are used according to conventional methods.

[0058] It should be understood that not all vectors function identically when expressing the DNA sequences of this invention. Similarly, not all hosts function identically for the same expression system. However, those skilled in the art will be able to make appropriate selections from a variety of vectors, expression control sequences, and hosts without incurring excessive experimental burden and without departing from the scope of this invention. For example, the host should be considered when selecting a vector, as the vector should replicate within it. The number of times the vector replicates, the ability to control the number of times the vector replicates, and the expression of other proteins encoded by the corresponding vector, such as the expression of antibiotic markers, should also be considered.

[0059] In this invention, the terms "host," "host cell," "host cell line," and "host cell culture" are used interchangeably and refer to cells in which exogenous nucleic acids have been introduced, including the progeny of such cells. Host cells include "transformations" and "transformed cells," which include primary transformed cells and their derived progeny, regardless of passage number. The nucleic acid content of progeny cells may not be exactly the same as that of parent cells, but may contain mutations. Mutant progeny cells having the same function or biological activity as those screened or selected in the initially transformed cells are included herein. Host cells are any type of cell system that can be used to produce the fusion proteins of this invention. Host cells include cultured cells, such as bacterial cells, such as Escherichia coli (e.g., Escherichia coli), Lactococcus (e.g., Lactococcus lactis), Bacillus, Lactobacillus, Pseudomonas, Streptomyces, Corynebacterium, and halophilic bacteria; mammalian cultured cells, such as CHO cells, BHK cells, NSO cells, SP2 / 0 cells, YO myeloma cells, P3X63 mouse myeloma cells, PER cells, PER.C6 cells or hybridoma cells; yeast cells; insect cells; and plant cells (to name just a few); as well as cells contained in transgenic animals, transgenic plants, or cultured plant or animal tissues.

[0060] This document discloses recombinant host cells containing expressed fusion genes as defined herein. In one embodiment, the host cell is *Escherichia coli* or *Lactobacillus plantarum*. Lactobacillus plantarum ).

[0061] Recombinant *Lactobacillus plantarum* can be prepared using any transformation method. "Transformation" refers to the introduction of DNA into a host, allowing the DNA to replicate as a component of a chromosome or through chromosome integration; it signifies the artificial induction of genetic changes by introducing exogenous DNA into cells. Common transformation methods include electroporation and lithium acetate-polyethylene glycol (PEG).

[0062] In another typical embodiment of the present invention, a composition is provided comprising the above-described recombinant lactobacillus.

[0063] When the intended use is to elicit or enhance an immune response, the composition is referred to as an "immunogenic" or "immunomodulatory" composition. Such compositions include prophylactic compositions and therapeutic compositions.

[0064] In some embodiments, the composition may include a buffer and may also include other substances suitable for the intended use.

[0065] Those skilled in the art can readily select suitable buffers for the intended use, many of which are known in the art. In some cases, the composition may contain pharmaceutically acceptable excipients, many of which are known in the art and need not be discussed in detail herein. Pharmaceutically acceptable excipients have been well described in various publications, including, for example, A. Gennaro (2000) "Remington: The Science and Practice of Pharmacy", 20th edition, Lippincott, Williams, & Wilkins; Pharmaceutical Dosage Forms and Drug Delivery Systems (1999) H. Ansel et al., eds. 7. sup. th ed., Lippincott, Williams, & Wilkins; and Handbook of Pharmaceutical Excipients (2000) A. H. Bibbe et al., eds. 3. sup. rd ed. Amer. Pharmaceutical Association.

[0066] In one embodiment, the recombinant Lactobacillus plantarum is encapsulated. The recombinant Lactobacillus plantarum can be encapsulated, for example, in chitosan-coated alginate beads.

[0067] In one embodiment, the composition is a freeze-dried or hydrated composition. Lactic acid bacteria can be used in hydrated or dried form. The drying process can be any system that maintains the integrity of the bacterial cell wall and bound proteins, including freeze-drying and spray drying.

[0068] In another typical embodiment of the present invention, a vaccine is provided which comprises the above-described recombinant lactobacillus.

[0069] In one implementation, the vaccine is a vector vaccine, particularly a live vector vaccine.

[0070] In another typical embodiment of the present invention, the use of the above-mentioned recombinant lactic acid bacteria or vaccine or composition in the preparation of products for the prevention and control of necrotizing enteritis in chickens is provided.

[0071] In one embodiment, the necrotizing enteritis in chickens is necrotizing enteritis caused by Clostridium perfringens type G.

[0072] In one embodiment, the product is a microbial agent, a pharmaceutical preparation, or feed. The pharmaceutical preparation is a biological product or a live vector vaccine.

[0073] In one embodiment, the present invention discloses a method for preventing or treating necrotizing enteritis in chickens, the method comprising administering to a subject a recombinant lactic acid bacteria or composition or vaccine as defined herein.

[0074] In one implementation, the subject is a chicken.

[0075] In one implementation, recombinant lactic acid bacteria are prepared into a bacterial suspension and administered orally to prevent or treat necrotizing enterocolitis caused by Clostridium perfringens type G.

[0076] As used herein, the term "therapeutic effective amount" includes, within its meaning, a sufficient amount of non-toxic but recombinant lactobacillus or a combination thereof to provide the desired therapeutic effect. The exact amount required will vary from subject to subject, depending on factors such as the species being treated, the subject's age and general condition, the severity of the condition being treated, the specific drug administered, and the method of administration. The effective amount is sufficient to induce an immune response in the subject, thereby preventing and / or treating necrotizing enterocolitis in chickens. Therefore, it is impossible to specify an exact "effective amount." However, for any given situation, a suitable "effective amount" can be determined by a person skilled in the art using only routine experimental methods.

[0077] The terms “treatment,” “curing,” and similar terms are used interchangeably in this document to mean the reduction, decrease, relief, improvement, or otherwise suppression of a condition, including one or more symptoms of the condition. The terms “prevent,” “avoid,” “prevent,” “preventive,” “preventive,” and similar terms are used interchangeably in this document to mean the prevention or delay of the onset of a condition, or the risk of developing a condition.

[0078] The terms “treatment,” “cure,” and similar terms also include the reduction, decrease, relief, improvement, or other suppression of the effects of a condition for at least a period of time. It should also be understood that “treatment,” “cure,” and similar terms do not mean that the condition or its symptoms are permanently reduced, decreased, relieved, improved, or otherwise suppressed, and therefore also include the temporary reduction, decrease, relief, improvement, or other suppression of the condition or its symptoms.

[0079] As used herein, “immune response” refers to a response of a subject’s immune system. For example, an immune response may be directed against an antigen / immunogen that the subject’s immune system recognizes as foreign (e.g., a non-self antigen) or self (e.g., recognized as a foreign self antigen). An immune response may be humoral, involving the production of immunoglobulins or antibodies, or cellular, involving various types of B and T lymphocytes, dendritic cells, macrophages, antigen-presenting cells, etc., or both. An immune response may also involve the production or processing of various effector molecules such as cytokines. “Immune response” includes immunogenic responses that cause, activate, initiate, stimulate, or induce an immune response against a specific antigen (e.g., an antigen of a pathogenic organism) or organism (e.g., a pathogenic microorganism) in a subject, as well as immunosuppressive or tolerance-inducing immune responses that inhibit, prevent, reduce, or eliminate an immune response to an allergen or self antigen or to cells, tissues, or organs expressing such an antigen, or that render the immune system unresponsive to or delay the occurrence or initiation of an immune response to an allergen or self antigen or to cells, tissues, or organs expressing such an antigen.

[0080] References to any prior publications (or information derived therefrom) or any known matters in this specification are not and should not be construed as endorsement or acknowledgment or any form of implication that such prior publications (or information derived therefrom) or known matters constitute part of the general knowledge in the relevant field of this specification.

[0081] Those skilled in the art will understand that variations and modifications can be made to the invention described herein, in addition to the specific description. It should be understood that the invention includes all such variations and modifications falling within its spirit and scope. The invention also includes all steps, features, compositions, and compounds individually or collectively mentioned or pointed to in this specification, as well as any and all combinations of any two or more of the stated steps or features.

[0082] The experimental materials and reagents used in the following examples are from the following sources:

[0083] The bacterial strains and plasmids involved in this study are shown in Table 1, and the primer sequences used are shown in Table 2.

[0084] Table 1 Bacterial strains and plasmids

[0085]

[0086] Table 2 Primers for plasmid construction

[0087]

[0088] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.

[0089] Example 1: Preparation of the vector and recombinant lactobacillus

[0090] (1) Preparation of recombinant plasmids

[0091] The NetB antigen gene was cloned into the pYL455 vector, the nucleotide sequence of which is shown in SEQ ID NO:7. The synthesized... netB Using the gene's DNA (SEQ ID NO:2) as a template, primers were used. netB -PstⅠ-F / netB -R is used for PCR amplification to obtain the amplification product. The PCR amplification product... netB PstI reaction with plasmid pYL455 、 HindIII double digestion was performed, and the digested fragments were recovered and ligated to obtain plasmid pYL535(P23-). SS1-SS2-netB ).

[0092] The target gene SS3 / cnaA was cloned into the pYL535 vector. This was used to synthesize the gene. cnaA Using DNA (SEQ ID NO:3) as a template, SS3- HindⅢ - F / SS3- R and cnaA- F / cnaA- HindⅢ-R was used as primers for PCR amplification. SS3-cnaA Target gene fragment. The PCR amplification product and plasmid pYL535 were digested with HindIII, and the digested fragments were recovered and ligated to obtain plasmid pYL542(P23- SS1-SS2-netB-SS3-cnaA ).

[0093] target gene fimB The gene was cloned into the pYL542 vector. First, the gene was synthesized... fimB (SEQ ID NO:1) as a template, with fimB- SphⅠ-F and fimB- XbaⅠ-R was used as primers for PCR amplification. fimB The target gene fragment will be amplified by PCR. fimBThe gene fragment and plasmid pYL542 were double-digested with SphⅠ and XbaⅠ enzymes, and the digested fragments were recovered and ligated to obtain plasmid pYL560(P23- SS1-fimB-SS2-netB-SS3-cnaA ).

[0094] target gene LysM-fba and LysM-fba-phi74 The genes were cloned into the pYL560 vector. LysM-fba (SEQ ID NO:4) and LysM-fba-phi74 (SEQ ID NO:8) as a template, Lysm-fba -XbaⅠ-F / Lysm-fba- XbaⅠ-R and Lysm-fba-phi74- XbaⅠ-F / Lysm-fba-phi74- XbaⅠ-R was used as primers for PCR amplification. LysM-fba / LysM-fba-phi74 The target gene fragment, the PCR amplification product LysM-fba / LysM-fba-phi74 The plasmid pYL560 was digested with XbaI, and the digested fragments were recovered and ligated to obtain plasmid pYL594 (P23-). SS1- fimB-LysM-fba-SS2-netB-SS3-cnaA ) and pYL595 (P23- SS1-fimB-LysM-fba-phi74-SS2- netB-SS3-cnaA ).

[0095] All constructed plasmids were verified by PCR and DNA sequencing. The nucleotide sequence of recombinant plasmid pYL560 is shown in SEQ ID NO:9, the nucleotide sequence of recombinant plasmid pYL594 is shown in SEQ ID NO:10, and the nucleotide sequence of recombinant plasmid pYL595 is shown in SEQ ID NO:11.

[0096] (2) Construction of recombinant Lactobacillus plantarum

[0097] The verified plasmid was introduced into Lactobacillus plantarum NC8 competent cells via electroporation (parameters: 2.5 kV, 200 Ω, 25 μF). Recombinant strains were obtained by screening on erythromycin-resistant plates, and the successful expression of the target protein was confirmed by Western blotting. Finally, the core experimental strains NC8(pYL560), NC8(pYL594), and NC8(pYL595) were obtained.

[0098] (3) Validation of recombinant Lactobacillus plantarum

[0099] Western blot analysis of recombinant strains NC8(pYL594) and NC8(pYL595) expressing the four antigens FimB, NetB, CnaA, and FBA is shown in the following results. Figure 1 As shown in A, B, C, and D, all three antigens have been successfully expressed, and the target band sizes are all as expected.

[0100] The expression status of recombinant strain cell wall protein FBA polyclonal antibody as follows Figure 2 As shown, the FBA polyclonal antibody was successfully expressed, and the target band sizes were all as expected.

[0101] The DC targeting ability of the key strain NC8(pYL595) was verified: the bacterial cells were labeled with the fluorescent dye CFSE and co-incubated with chicken bone marrow-derived dendritic cells (BMDC). The uptake efficiency of the strain by BMDC was observed and quantitatively analyzed by flow cytometry and laser confocal microscopy.

[0102] Electron microscopy observation results as follows Figure 3 As shown in Figures A, B, and C, both recombinant strains can be internalized by BMDCs. Compared to the NC8 (pYL594) group, more clearly defined bacterial cross-sections were observed within BMDCs treated with the DC-targeted strain NC8 (pYL595). In summary, transmission electron microscopy results confirm at the nanoscale that DC targeting significantly enhances the internalization efficiency of recombinant Lactobacillus plantarum by BMDCs.

[0103] The results of flow cytometry analysis of the uptake efficiency of NC8(pYL594) and NC8(pYL595) by chicken BMDC are as follows: Figure 4 As shown in A, B, C, and D, the FITC fluorescence signal flow cytometry analysis results are as follows: Figure 5 As shown, compared with the NC8(pYL594) group, the percentage of positive cells taken up by BMDCs for the targeted strain NC8(pYL595) (78.4% vs. 46.9%) and the average fluorescence intensity were significantly increased. In conclusion, Lactobacillus plantarum NC8(pYL595) fused with the DC-targeting nanobody Phi74 can be more effectively recognized and internalized by dendritic cells, and its uptake efficiency is significantly better than that of the non-targeted strain NC8(pYL594).

[0104] Laser confocal microscopy was used to observe the co-localization effect of CFSE-labeled bacterial strains (green) with DiI-labeled BMDC cell membranes (red) and DAPI-labeled BMDC nuclei (color). Figure 6 As shown in A, B, and C, the results of quantitative fluorescence intensity analysis are as follows: Figure 7 As shown, compared with the NC8(pYL594) group, BMDCs treated with the targeted strain NC8(pYL595) showed a large amount of green fluorescence signal, indicating that the bacteria were effectively internalized; while the fluorescence signal of the non-targeted strain was mainly limited to the cell surface. In summary, the confocal microscopy results directly confirm that the DC-targeted strain NC8(pYL595) has a stronger BMDC internalization ability.

[0105] At MOI=100, the quantitative results of adhesion and invasion of non-targeted and targeted bacteria after co-incubation with dendritic cells for 2 hours are as follows: Figure 8 As shown in Figures A and B, compared to the NC8(pYL594) group, the targeted strain NC8(pYL595) exhibited significantly higher BMDC adhesion rates (25% vs. 18%) and invasion rates (8% vs. 5%). These results quantitatively demonstrate that the DC-targeting nanobody Phi74 not only enhanced the binding of the recombinant strain to dendritic cells but also significantly promoted its internalization into cells.

[0106] Results of qRT-PCR detection of dendritic cell maturation-related gene transcription levels are as follows: Figure 9 As shown in Figures A, B, C, and D, compared to the empty vector control, both recombinant strains significantly upregulated the mRNA expression levels of DC maturation markers (CD83, CD86) and migration-related molecules (CCL5, CCR7), and the induction effect of the DC-targeting strain NC8 (pYL595) was significantly stronger than that of the non-targeting strain NC8 (pYL594). In summary, the DC-targeting strategy can not only promote bacterial uptake but also more effectively drive the maturation and functional activation of BMDCs.

[0107] Example 2: Animal immune evaluation and challenge protection experiment

[0108] Laboratory animals: AA broiler chickens. AA is short for Arbor Acres, and AA broiler chickens are recognized as a high-quality white-feathered broiler chicken breed.

[0109] Immunization program: One-day-old AA broilers were randomly divided into four groups: PBS control group, NC8 empty vector group, NC8 (pYL560) group, NC8 (pYL594) group, and NC8 (pYL595) group. Immunization was performed orally by gavage on days 0, 1, 2, 14, 15, and 16, with 10 mg of the drug administered each time. 9 CFU / each.

[0110] Immunological efficacy assessment: Serum and intestinal contents were collected 6 and 13 days after the second immunization. The levels of specific antibodies (IgG, IgA, IgM) were detected using ELISA. The proliferation response of splenic lymphocytes and the secretion levels of cytokines (IL-4, IFN-γ) were also detected to assess the intensity of humoral and cellular immune responses.

[0111] The ELISA results for FBA antigen-coated subintestinal mucosal IgA antibody levels are as follows: Figure 10 As shown, the IgA response in the DC-targeted group was significantly stronger than that in the control group. The elevated levels of IgA, a major protective antibody in the mucosa, indicate that this vaccine strategy helps induce a mucosal immune response in the intestinal tract.

[0112] Challenge protection experiment: Seven days after the second immunization, chickens in each group were artificially infected. The infection was administered orally with Eimeria coccidia (1x10⁻⁶). 4 Intestinal damage was induced by feeding animals with a diet high in protein fishmeal (36%) and animals. Fourteen days after the second immunization, animals were administered a pathogenic dose (2 mL / animal) of Clostridium perfringens G (NetB-positive strain) via gavage. The bacterial culture was removed from the anaerobic incubator at 15 h (9:00 AM) and 23 h (5:00 PM) for oral administration to establish a necrotizing enteritis model. Animals were observed for five consecutive days, recording their mental status, mortality rate, and daily weight changes. After the challenge, necropsy was performed to assess the severity of lesions in the small intestine (duodenum, jejunum, and ileum) and evaluate the clinical protective effect of the immunized group, including key indicators such as weight change, mortality rate, and intestinal lesion score.

[0113] Immunofluorescence results of ileal tissue sections are as follows: Figure 11 As shown in A, B, C, D, and E, the immunofluorescence results of jejunal tissue sections are as follows. Figure 13 As shown in Figures A, B, C, D, and E, compared with the PBS and NC8 empty vector control groups, enhanced green fluorescence signals were observed in the ileal mucosa of all immunized groups. Quantitative analysis is as follows: Figure 12 and Figure 14 As shown, the mean fluorescence intensity (MFI) of the tetraantigen group was significantly higher than that of the triantigen group, with the tetraantigen group exhibiting a higher MFI. These results indicate that oral administration of recombinant Lactobacillus plantarum can effectively induce a mucosal immune response and promote IgA secretion in the ileum.

[0114] The intestinal lesion scores, weight change curves, and schematic diagrams of intestinal lesions for each group of chickens in the challenge protection experiment are shown below. Figure 15 , Figure 16 and Figure 17 As shown, compared with the PBS and NC8 empty vector control groups, the IgA fluorescence signal in the jejunum of each immunization group was enhanced. Quantitative analysis of mean fluorescence intensity (MFI) showed that the MFI values ​​of the tetraantigen group and the DC-targeted group were significantly higher than those of the control group, with the G5 group having the highest MFI value. The results indicate that oral administration of recombinant Lactobacillus plantarum can induce local IgA expression in the jejunum.

[0115] Example 3: Preparation of vaccine formulation

[0116] The validated recombinant strain NC8 (pYL595) was subjected to large-scale fermentation culture, and the bacterial cells were collected. The cells were then mixed with pharmaceutically acceptable freeze-drying protectants (such as skim milk and trehalose) and freeze-dried to produce oral freeze-dried powder; or further processed into dosage forms such as microcapsules to improve storage stability and intestinal colonization.

[0117] Finally, it should be noted that the above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of them. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A recombinant *Lactobacillus plantarum* strain for controlling necrotizing enteritis in chickens, characterized in that, The recombinant *Lactobacillus plantarum* contains an expression vector for expressing a fusion gene; the fusion gene includes sequences encoding FimB protein, NetB protein, CnaA protein, LysM-FBA protein, and Phi74 phage nanobody; the nucleotide sequence of the fusion gene is shown in SEQ ID NO:

6.

2. The recombinant Lactobacillus plantarum as described in claim 1, characterized in that, The recombinant Lactobacillus plantarum originated from Lactobacillus plantarum.

3. The method for preparing recombinant Lactobacillus plantarum according to any one of claims 1 to 2, characterized in that, Includes the following steps: The expression vector containing the fusion gene is transformed into the host cell.

4. A vaccine, characterized in that, It includes the recombinant Lactobacillus plantarum as described in any one of claims 1 to 2.

5. The vaccine as described in claim 4, characterized in that, The vaccine in question is a vector vaccine.

6. A composition, characterized in that, It includes the recombinant Lactobacillus plantarum as described in any one of claims 1 to 2.

7. The use of the recombinant plant lactic acid bacteria of claims 1-2, the vaccine of claims 4-5, or the composition of claim 6 in the preparation of products for the prevention and control of necrotizing enteritis in chickens.

8. The application as described in claim 7, characterized in that, The product is a microbial agent, pharmaceutical preparation, or feed.

9. The application as described in claim 8, characterized in that, The pharmaceutical preparation is a biological product.

10. The application as described in claim 8, characterized in that, The drug formulation is a live vector vaccine.

Images