Monoamine oxidase mutant and recombinant yarrowia lipolytica and applications thereof
By mutating monoamine oxidase to Phe208Ala, a recombinant Yersinia lipolytica strain, Po1gΔKU70-MAO-P208A, was constructed. This solved the problems of low efficiency and high cost of Yersinia lipolytica strains in the production of bovine heart alkaloids, achieving a significant increase in yield and a reduction in cost, making it suitable for industrial application.
Patent Information
- Application Number
- CN202610232842.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-27
- Publication Date
- 2026-06-30
- Estimated Expiration
- 2046-02-27
Smart Images

Figure CN121737070B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of biotechnology and fermentation engineering technology, and in particular to a monoamine oxidase mutant and recombinant Yersinia lipolyticis and their applications. Background Technology
[0002] Bovine heart alkaloids ( S )-Reticuline), molecular formula (C 19 H 23 NO4, widely found in plants of the Papaveraceae and Ranunculaceae families, is a candidate molecule for early research on anti-inflammatory and cardiovascular effects (such as vasodilation). Its activity spectrum is similar to that of antihypertensive drugs and Alzheimer's drugs, suggesting potential therapeutic potential for neurodegenerative diseases. It has also been studied for the discovery of antimalarial and anticancer drugs. At the same time, borax is also a key intermediate in the synthesis of benzylisoquinoline alkaloids, which can be converted into a variety of high-value alkaloid drugs, such as analgesics like morphine and codeine, and antibacterial and anticancer drugs like sanguinarine. Borax is transforming from an important natural product intermediate into a key node in biomanufacturing and new drug development.
[0003] Currently, there are three main methods for producing bovine heart alkaloids: plant extraction, chemical synthesis, and bio-fermentation. For plant extraction, the scarcity of natural sources, lack of cultivation, seasonal fluctuations, and over-harvesting further limit the extraction of alkaloids. While chemical synthesis provides an alternative route for the production of bioactive substances, the complexity of its molecular structure often weakens the effectiveness of the synthesis method. Furthermore, high production costs and the potential environmental impact of chemical waste also limit the feasibility of large-scale production. Fermentation, with its advantages of low cost and simple control, holds a significant advantage in the production of bovine heart alkaloids and is the most promising method for achieving large-scale production of bovine heart alkaloids in the future.
[0004] Currently, the microbial fermentation production of caustic solanine has been achieved using *Escherichia coli* and *Saccharomyces cerevisiae*. However, *Yersinia lipolytica* is more suitable for producing plant natural products compared to traditional model strains. Furthermore, *Yersinia lipolytica* possesses advantages such as high chassis safety, a wide substrate utilization range, and strong protein secretion capacity, making it more advantageous for producing plant natural products using heterologous genes. Therefore, designing a highly efficient, convenient, and stable caustic solanine production strain using *Yersinia lipolytica* as the chassis cell is a pressing technical problem that needs to be solved at this stage. Summary of the Invention
[0005] The technical problem to be solved by the present invention is to provide a monoamine oxidase mutant.
[0006] Another technical problem to be solved by the present invention is to provide a recombinant Yersinia lipophila strain constructed from the above-mentioned monoamine oxidase mutant.
[0007] Another technical problem to be solved by the present invention is to provide the application of the above-mentioned recombinant Yersinia lipophila.
[0008] To solve the above-mentioned technical problems, the technical solution of the present invention is as follows:
[0009] A monoamine oxidase mutant, named Phe208Ala mutant, has the amino acid sequence shown in SEQ ID NO.3.
[0010] Preferably, the nucleotide sequence of the above-mentioned monoamine oxidase mutant is shown in SEQ ID NO.4 of the sequence listing.
[0011] The above-mentioned monoamine oxidase mutant was obtained by a P208A mutation on the basis of wild-type monoamine oxidase: the Phe at position 208 is mutated to Ala, and the amino acid sequence of the wild-type monoamine oxidase is shown in SEQ ID NO.1 of the sequence listing.
[0012] The mutation methods are well known to those skilled in the art, such as PCR-mediated site-directed mutagenesis, oligonucleotide primer-mediated site-directed mutagenesis, cassette mutagenesis, gene editing technology, or homologous recombination technology.
[0013] The application of the above-mentioned monoamine oxidase mutant in the construction of recombinant Yersinia lipophila.
[0014] Preferably, in the above application, the recombinant lipophilic yeast is a producer of bovine heart alkaloids (( S Genetically engineered bacteria (-Reticuline).
[0015] A biomaterial, said biomaterial comprising any of the following:
[0016] A1) The nucleic acid molecule encoding the monoamine oxidase mutant;
[0017] A2) An expression cassette containing the nucleic acid molecules described in A1);
[0018] A3) A recombinant vector containing the nucleic acid molecules described in A1);
[0019] A4) Recombinant microorganisms containing the nucleic acid molecules described in A1);
[0020] A5) Recombinant host cells containing the nucleic acid molecules described in A1).
[0021] Furthermore, all of the biological materials can express the nucleic acid molecules described in A1).
[0022] In the above-mentioned biological materials, the nucleic acid molecule described in A1) includes a DNA molecule whose coding sequence is as shown in SEQ ID NO. 4.
[0023] Furthermore, the nucleic acid molecules described herein may also include nucleic acid molecules obtained by codon preference modification based on the nucleotide sequence shown in SEQ ID NO. 4.
[0024] The nucleic acid molecules mentioned in this article can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecules can also be RNA, such as mRNA or hnRNA.
[0025] The recombinant vectors described herein can be constructed using expression vectors. The structure of expression vectors is well known to those skilled in the art. Expression vectors typically contain elements required for target gene expression, such as promoters, multiple cloning sites, terminators, and ribosome binding sites. They may also contain selection marker genes (such as kanamycin resistance gene kanr, neomycin resistance gene neo, hygromycin resistance gene hyg, chloramphenicol resistance gene cat, streptomycin resistance gene str, bleomycin resistance gene ble, etc.). Expression vectors can be constructed using any method known in the art (such as recombination technology, synthetic technology, etc.) or can be commercially available. For example, in one or more embodiments of the present invention, the expression vector is pYLEX1.
[0026] The recombinant vector can be a recombinant expression vector obtained by cloning a nucleic acid molecule encoding the monoamine oxidase mutant (P208A) into an expression vector (such as a prokaryotic expression vector or a eukaryotic expression vector). Although the expression vector used in the embodiments provided in this invention is the pYLEX1 vector, this invention is not limited to this specific vector. Those skilled in the art can use other suitable vectors (such as yeast expression vectors pYES2, pPICZaA, pUG6, etc.), as long as the vector can express the monoamine oxidase mutant.
[0027] The microorganisms described in this application may include Yersinia lipolytica, Saccharomyces cerevisiae, Kluyveromyces lactis, and Escherichia coli.
[0028] A recombinant Yersinia lipophila strain was constructed using the aforementioned monoamine oxidase mutant Phe208Ala.
[0029] Preferably, the above-mentioned recombinant Yersinia lipolytica, named Po1gΔKU70-MAO-P208A, is obtained by transforming the expression plasmid pYLMAO-P208A of the monoamine oxidase mutant Phe208Ala into competent cells of Yersinia lipolytica Po1gΔKU70 strain, plating it on a leucine-deficient plate, and after visible colonies have grown on the plate, randomly picking a single colony, culturing it overnight, extracting the genome, and verifying it by PCR.
[0030] The above-mentioned recombinant Yersinia lipolyticis strain is used in the production of vesicatoria or products containing vesicatoria. These products include, but are not limited to, food, cosmetics, pharmaceuticals, animal feed, and daily chemical products.
[0031] Preferably, in the above application, the recombinant Yersinia lipophila is cultured in a culture medium, and vesicerine is collected from the culture.
[0032] The culture can be carried out according to conventional methods in the art, including but not limited to plate culture, shake flask culture, batch culture, continuous culture and fed-batch culture, etc., and various culture conditions such as temperature, time and pH of the culture medium can be appropriately adjusted according to the actual situation. The culture medium can be prepared by standard methods.
[0033] Preferably, in the above application, bovine heart alkaloids are prepared by fermentation. The specific steps are as follows: recombinant Yersinia lipolyticis strain Po1gΔKU70-MAO-P208A is activated in test tubes, and then activated by streak plating on YPD solid medium. After two activations, 1% of the strain is inoculated into the fermentation medium and fermented in shake flasks at 30°C and 220 r / min for 5 days to prepare bovine heart alkaloids by fermentation.
[0034] Beneficial effects:
[0035] The aforementioned monoamine oxidase mutant was obtained by mutating Phe at position 208 of the wild-type monoamine oxidase to Ala. The recombinant Yersinia lipolyticis strain constructed from the mutant showed a significantly enhanced ability to synthesize calciferine, with a 40.05% increase in yield compared to strains expressing unmutated monoamine oxidase. This demonstrates superior performance and can significantly increase the yield of biosynthesized calciferine, showing great potential for industrial development and utilization. It can also significantly reduce production costs and improve production efficiency.
[0036] This invention improves the catalytic efficiency of monoamine oxidase MAO-A by identifying key catalytic pockets and performing site-directed mutagenesis, thereby increasing the biosynthesis of borax. The resulting Phe208Ala mutant (P208A) significantly enhances the borax synthesis capacity of genetically engineered strains constructed using this mutant. By expressing both wild-type and designed MAO-A mutants in the engineered strains, the ability of these mutants to catalyze the conversion of dopamine to borax in *Yarrowia lipolytica* was compared. The results showed that the monoamine oxidase mutant significantly increased the yield of borax in *Yarrowia lipolytica*, with a 40.05% increase compared to the starting strain. This superior performance significantly improves the biosynthetic yield of borax, making it more suitable for industrial applications in the future, and can significantly reduce production costs and increase production efficiency. Attached Figure Description
[0037] Figure 1 A visualization analysis of the three-dimensional structure of MAO-A after molecular docking with dopamine small molecules and flavin adenine dinucleotide.
[0038] Figure 2 The image shows the agarose gel electrophoresis verification image of the recombinant plasmid pYLMAO-P208A. Lanes 1 and 2 represent the recombinant plasmid pYLMAO-P208A from two randomly selected E. coli single colonies for verification. Primers were designed to verify the MAO-P208A gene portion in the recombinant plasmid. All verification bands were correct, with a band length of 2150 bp.
[0039] Figure 3 The images show agarose gel electrophoresis verification images of yeast strain Po1gΔKU70-MAO and the mutant strain Po1gΔKU70-MAO-P208A. Lane 0 shows the genome of the original yeast strain Po1gΔKU70 as a control; lane 1 shows the genome of the yeast strain Po1gΔKU70-MAO obtained by integrating the original plasmid pYLEX1-MAO; and lane 2 shows the genome of the mutant strain Po1gΔKU70-MAO-P208A that integrates the mutant plasmid pYLMAO-P208A. Primers were designed to verify the MAO and MAO-P208A genes in the genomes, and all verification bands were correct, with a band length of 2900 bp. Detailed Implementation
[0040] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be further described in detail below with reference to specific embodiments.
[0041] In this invention, unless otherwise stated, the scientific and technical terms used have the meanings commonly understood by those skilled in the art. Furthermore, to better understand this invention, definitions and explanations of relevant terms are provided below.
[0042] The term "expression cassette" generally refers to a nucleic acid construct containing sufficient nucleic acid elements to express a target gene. A typical expression cassette includes a promoter, a multiple cloning site (MCS), and a terminator. Expression cassettes may also include the target gene, marker genes (such as TK, DHFR, CAT, and NEO genes), ribosome recognition and binding sites (SDs), transcription factor binding sites (TFBSs), enhancers, silencers, repressors, introns, poly(A) signal sequences, and / or mRNA splicing signal sequences. Elements within an expression cassette can be directly linked or indirectly linked through adapters.
[0043] The term "vector" generally refers to a vector capable of delivering exogenous DNA or a target gene into host cells for amplification and / or expression. This vector can be a cloning vector or an expression vector. Vectors can be introduced into host cells through transformation, transduction, or transfection, allowing the genetic material they carry to be amplified and / or expressed within the host cells. Those skilled in the art can select appropriate vectors based on the purpose of genetic engineering and the properties of the recipient cells. The vectors include, but are not limited to: plasmids, phages (such as λ phage or M13 phage), cosmids (i.e., Cosmids), phagemids, shuttle vectors (such as yeast expression vectors), Ti plasmids, artificial chromosomes (such as yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC), P1 artificial chromosomes (PAC), or Ti plasmid artificial chromosomes (TAC)), and viral vectors (such as baculovirus vectors, retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, poxviruses, papillomaviruses, papillomaviruses (such as SV40), and herpesviruses (such as herpes simplex virus)). A vector may contain multiple elements controlling expression, including but not limited to promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. Additionally, the vector may contain a replication origin site.
[0044] The term "microorganism" generally includes bacteria, viruses, fungi, actinomycetes, rickettsiae, mycoplasmas, chlamydiae, spirochetes, algae, etc. For example, the bacteria mentioned may originate from the genus *Corynebacterium* (…). Corynebacterium sp. (such as Corynebacterium glutamicum, Corynebacterium pekinensis, Corynebacterium obtusifolium, etc.), bryophytes ( Brevibacterium sp. (such as short bacilli of lactic acid fermentation, short bacilli of yellow, short bacilli of ammonia-eating bacteria, etc.), Escherichia coli spp. ( Escherichia sp. (such as Escherichia coli), Erwinia spp. Erwinia sp. ), Agrobacterium ( Agrobacterium sp. (such as Agrobacterium tumefaciens), Flavobacterium spp. ( Flavobacterium sp. Alcaligenes ( ) Alcaligenes sp. ), Pseudomonas spp. Pseudomonas sp. ) and Bacillus spp. ( Bacillus sp. (e.g., Bacillus subtilis). The viruses may include rotavirus, baculovirus, retrovirus (e.g., lentivirus), adenovirus, adeno-associated virus, poxvirus, papillomavirus, influenza virus, papillomavirus (e.g., SV40), and herpesvirus (e.g., herpes simplex virus). The fungi may be derived from yeasts (e.g., Bacillus subtilis). Saccharomyces sp. (such as Saccharomyces cerevisiae, Candida albicans, Methylospermum oryzae, Pichia pastoris), Fusarium genus ( Fusarium sp. ), Rhizoctonia spp. (Rhizoctonia sp. Verticillium ( Verticillium sp. ), Penicillium ( Penicillium sp. Aspergillus ( ) Aspergillus sp. ) and Cephalosporin ( Cephalosporium sp. The actinomycetes may originate from the genus Streptomyces (…). Streptomyces sp. (e.g., Streptomyces). The algae may originate from the phylum Cyanophyta (e.g., cyanobacteria), genus Fucus (e.g., fucus vesiculosus). Fucus sp. ), genus *Cyclocarya* ( Achnanthes sp. ), genus *Codonopsis* ( Amphiprora sp. ), genus Dipterocarpa ( Amphora sp. ), Fiber Algae ( Ankistrodesmus sp. ), genus Styracula ( Asteromonas sp. ) and the genus *Golden Color Algae* ( Boekelovia sp. )wait.
[0045] The term "host cell," also known as recipient cell, generally refers to any type of cell that can be used to introduce a vector, such as microbial cells, plant cells, and animal cells. The term "host cell" can be understood not only to the specific recipient cell but also to its offspring, which, due to natural, accidental, or intentional mutations and / or alterations, need not be completely identical to the original parent cell but are still included within the scope of host cells. Suitable host cells are those known in the art, such as *Yarrowia lipolytica*, *Saccharomyces cerevisiae*, *Kluyveromyces lactis*, or recombinant *Escherichia coli*.
[0046] The term "recombinant vector" generally refers to a recombinant DNA molecule constructed by linking a foreign target gene to a vector in vitro. It can be constructed in any suitable way, as long as the constructed recombinant vector can carry the foreign target gene into the recipient cell and provide the foreign target gene with the ability to replicate, integrate, amplify and / or express in the recipient cell.
[0047] The term "recombinant microorganism" generally refers to a recombinant microorganism whose genes have been manipulated and modified to obtain a functionally altered microorganism. This can be achieved by introducing a foreign target gene or recombinant vector into the target microorganism, or by directly editing the endogenous genes of the target microorganism.
[0048] The term "recombinant host cell" generally refers to a recombinant host cell whose genes have been manipulated and modified to obtain a recombinant host cell with altered function. This can include introducing a foreign target gene or recombinant vector into the host cell, or directly editing the host cell's endogenous genes.
[0049] The term "mutation" generally refers to a change in the amino acid sequence or nucleotide sequence. It can include changes in the composition or arrangement of base pairs in the structure of a gene, such as point mutations caused by a single base change, or deletions, duplications, and insertions of multiple bases. It can also include substitutions, deletions, and insertions (additions) of one or more amino acid residues in a protein.
[0050] The term "site-directed mutagenesis" generally refers to altering one or more bases in a gene through site-directed mutagenesis methods, including base addition, deletion, and point mutation, resulting in a change in the amino acid composition of the corresponding protein. Site-directed mutagenesis methods include oligonucleotide primer-mediated site-directed mutagenesis, PCR-mediated site-directed mutagenesis, and cassette mutagenesis.
[0051] The term "gene editing" generally refers to the ability to alter specific gene sequences within any cell, causing base deletions, duplications, insertions, frameshift mutations, and replacements or knockouts of target genes. This allows for the substitution, deletion, splicing, and single-base alterations of the genome sequence—essentially, the technology to arbitrarily "edit" the genome or the sequence of a specific gene. Gene editing includes zinc finger ribozyme gene knockout technology, TALEN gene editing technology, and CRISPR gene editing technology.
[0052] The term "homologous recombination" generally refers to a genetic recombination in which nucleotide sequences are exchanged between two similar or identical DNA molecules. Exemplarily, a site-directed mutagenesis strategy based on homologous recombination can be achieved by: attaching homologous arms of the wild-type monoamine oxidase gene to both ends of a nucleic acid molecule encoding the monoamine oxidase mutant described in this invention (e.g., the DNA molecule shown in SEQ ID NO.4), and then introducing it into a recipient bacterium to replace the wild-type monoamine oxidase gene, thereby achieving the purpose of site-directed mutagenesis.
[0053] The term "culture" generally refers to a liquid or solid product (all substances within the culture container) that has grown a microbial community after artificial inoculation and cultivation. It is a product obtained by growing and / or amplifying microorganisms; it can be a biologically pure culture of microorganisms, or it can contain a certain amount of culture medium, metabolites, or other components produced during the cultivation process.
[0054] The term "fermentation" generally refers to the biological reaction process through the growth, reproduction, and metabolic activities of an organism to produce and accumulate desired products, including microbial fermentation.
[0055] The term "comprising" is not intended to be restrictive, but rather inclusive and implies the presence of other elements besides those listed, and can be interpreted as "including but not limited to". The term "comprising" also encompasses the terms "consisting of" and "substantially consisting of". In this document, the terms "comprising" and "including" are used interchangeably.
[0056] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0057] In this invention, the pYLEX1 plasmid was purchased from Yeeastern Biotech Co., Ltd., and the pYLEX1 plasmid carries a leucine expression cassette for auxotrophic selection genes, a marker gene Amp, a promoter hp4d, and a terminator XPR2.
[0058] In this invention, the Yeastern lipophilic yeast Po1g strain was purchased from Yeastern Biotech Co., Ltd. in Taiwan, China.
[0059] In this invention, *Yersinia lipolytica* Po1gΔKU70 is constructed by knocking out the KU70 gene responsible for non-homologous recombination in *Yersinia lipolytica* Po1g. The knockout method is known to those skilled in the art and can be found in the following literature: YuAQ, Pratomo N, Ng TK, Ling H, Cho HS, Leong SS, Chang MW. Genetic engineering of an unconventional yeast for renewable biofuel and biochemical production. Journal of Visualized Experiments, 2016, 115, e54371.
[0060] The sequence of the KU70 gene knockout part (△KU70, SEQ ID NO.5) is: GGCGGTTCATGTCGAAAAACACGTCCATCAGGTGAGGCTCTTCCTGCACCTTGAACCTCTCACCCAGATCAGGGTCCTCTGCCAGTCGTTTGAGTCGTTTGATCTGAGCAGCGGTAGGAAGGCCCAGCTTGAGAATGAAATGTGTATCTGACTCATCGAACTCGTCACCGTCGTCCTCAGACTGCATGGAGGCACCGAACAGCATAACGCCGGTGTAATCT.
[0061] The following examples used Graphpad Pism 9.5 statistical software to process the data. The experimental results are expressed as mean ± standard deviation. One-way ANOVA was used for testing, and P < 0.05 was considered acceptable. ) indicates a statistically significant difference, P < 0.01 ( ) indicates a statistically significant difference, P < 0.001 ( () indicates a highly significant statistical difference. Unless otherwise specified, all quantitative experiments in the following examples were performed in triplicate, and the results were averaged.
[0062] In the following embodiments, when referring to monoamine oxidase mutants, their amino acid sequences are determined by referring to the amino acid sequence of wild-type monoamine oxidase MAO-A. When referring to mutations, the mutations are described as follows: "pre-mutation amino acid abbreviation, mutation position, post-mutation amino acid abbreviation". For example, "P208A" indicates that at position 208 of the amino acid sequence shown in SEQ ID NO.1, the amino acid is mutated from phenylalanine to alanine. The first methionine (Met) in the amino acid sequence shown in SEQ ID NO.1 is position 1.
[0063] The amino acid sequence of wild-type monoamine oxidase MAO-A is shown in SEQ ID NO.1;
[0064] The nucleotide sequence of the gene encoding wild-type monoamine oxidase MAO-A is shown in SEQ ID NO.2;
[0065] The amino acid sequence of the monoamine oxidase mutant Phe208Ala is shown in SEQ ID NO.3;
[0066] The nucleotide sequence of the gene encoding the monoamine oxidase mutant Phe208Ala is shown in SEQ ID NO.4.
[0067] Example 1
[0068] human body( Homo sapiens The source is derived from the structural simulation of monoamine oxidase MAO-A and the simulation of dopamine binding molecules.
[0069] Random mutation screening lacks precise design. In this embodiment, a three-dimensional structural model of monoamine oxidase MAO-A was obtained through structural prediction. Molecular docking was then used to obtain structural models of the complexes of MAO-A with its substrates dopamine and flavin adenine dinucleotide, as shown below. Figure 1 As shown. Specifically:
[0070] Using monoamine oxidase MAO-A (GenBank accession number: BC008064.2, SEQ ID NO.1) as a template, the predicted MAO-A protein model was imported into Autodock Tools software and converted into a .pdbqt file. Dopamine and flavin adenine dinucleotide were also imported and converted into .pdbqt files respectively. Possible binding pockets were analyzed, and based on this model, site-directed mutagenesis was performed on amino acids near the selected binding pocket.
[0071] The study found that the key amino acid residue (P208) has the ability to affect the binding of small substrate molecules to the MAO-A protein, thereby affecting its catalytic activity. Based on the properties of its amino acid, a site-directed mutant of alanine, P208A, was designed.
[0072] Example 2
[0073] Obtaining monoamine oxidase strains and site-directed mutant strains
[0074] This embodiment constructed a strain containing the encoding gene of the following monoamine oxidase mutant:
[0075] Monoamine oxidase mutant P208A: Its amino acid sequence is obtained by mutating Phe at position 208 of SEQ ID NO.1 to Ala, and the nucleotide sequence of its encoding gene is shown in SEQ ID NO.4.
[0076] The specific construction steps are as follows:
[0077] (1) Based on the known monoamine oxidase MAO-A gene (nucleotide sequence shown in SEQ ID NO.2 of the sequence listing), it was introduced into the pYLEX1 plasmid to construct the recombinant plasmid pYLEX1-MAO containing the monoamine oxidase MAO-A gene. The monoamine oxidase MAO-A gene was obtained by polymerase chain reaction (PCR), and the construction of the recombinant plasmid can be carried out using common methods in the art.
[0078] (2) Primer design: The mutation site was introduced by reverse PCR to construct the monoamine oxidase mutant expression plasmid. Using pYLEX1-MAO plasmid as a template, primers were designed using Primer Premier 5.0. The primer sequences are shown in Table 1.
[0079] Table 1 Primers used to construct mutants
[0080]
[0081] (3) Reverse PCR: The reaction system and reaction procedure for reverse PCR are shown in Table 2 and Table 3, respectively.
[0082] Table 2 Reaction system for reverse PCR
[0083]
[0084] Table 3 Reverse PCR reaction procedure
[0085]
[0086] The PCR product was digested with 0.25 μL of DpnI to remove methylation, and then transformed. E.coli DH5α strain was cultured for 12 to 14 hours, and single colonies were picked. After overnight culture, plasmids were extracted and DNA sequencing was performed to verify whether the phenylalanine at position 208 of monoamine oxidase MAO-A (SEQ ID NO.1) was successfully replaced with alanine. The verification diagram is shown below. Figure 2 As shown, lanes 1 and 2 represent recombinant plasmid pYLMAO-P208A from two randomly selected E. coli colonies for verification. Primers were designed to verify the MAO-P208A gene portion in the recombinant plasmid, and the mutant plasmid pYLMAO-P208A was successfully obtained after PCR and sequencing verification.
[0087] Among them, the mutant plasmid pYLMAO-P208A contains the gene encoding the P208A mutant (SEQ ID NO.4).
[0088] (4) Transform the original plasmid pYLMAO and the correctly sequenced mutant plasmid pYLMAO-P208A into competent cells of *Yersinia lipolytica* strain Po1gΔKU70. After visible colonies grow on leucine-deficient plates, randomly select single colonies, incubate overnight, and extract the genome for PCR verification. Verification showed that... Figure 3 As shown, lane 0 represents the genome control of the original yeast strain Po1gΔKU70, lane 1 represents the Po1gΔKU70-MAO strain obtained by integrating the original plasmid pYLEX1-MAO, and lane 2 represents the mutant strain Po1gΔKU70-MAO-P208A that integrates the mutant plasmid pYLMAO-P208A. Primers were designed to verify the MAO and MAO-P208A genes in the yeast genome, and the Po1gΔKU70-MAO strain containing the original plasmid pYLEX1-MAO and the mutant strain Po1gΔKU70-MAO-P208A containing the mutant plasmid pYLMAO-P208A were successfully obtained.
[0089] Example 3
[0090] Monoamine oxidase mutants have an effect on bovine heart fruit alkaloids (( S Impact of Reticuline on production
[0091] 1) The strains constructed in Example 2: Po1gΔKU70-MAO strain, mutant strain Po1gΔKU70-MAO-P208A and original strain Po1gΔKU70 were activated twice and then inoculated into the fermentation medium at an inoculation amount of 1%. The fermentation was carried out at 30°C and 220 r / min for 5 days.
[0092] 2) The activation steps of the genetically engineered bacteria are as follows: pick a single colony from the YPD solid plate, inoculate it into a test tube containing 5 mL of seed culture medium, and culture it at 30℃ and 220 r / min for 24 h with shaking (to complete the first activation). Then, inoculate it with 1% of the seed culture medium into 25 mL of seed culture medium and culture it at 30℃ and 220 r / min for 16 h with shaking (to complete the second activation).
[0093] The seed culture medium was YPD medium, with the following composition: 20 g / L peptone, 10 g / L yeast extract, 20 g / L glucose, sterilized at 115℃ for 20 min.
[0094] The fermentation medium consisted of: 20 g / L peptone, 10 g / L yeast extract, 20 g / L glucose, and 5 g / L ascorbic acid solution.
[0095] 3) After fermentation, place the fermentation broth into a 50 ml centrifuge tube and vortex for 30 minutes. Take 70 μL of the vortexed fermentation broth and mix it with 270 μL of 100% acetonitrile (ACN). After vortexing for another 5 minutes at room temperature, add 1460 μL of 0.123% formic acid to make the final concentrations of ACN and formic acid in the fermentation broth 15% ACN and 0.1% formic acid, respectively. Centrifuge at 12000 rpm for 10 minutes, take the supernatant, filter it through a 0.22 μm microporous membrane into a brown liquid chromatography vial, and determine the content of oxcarpine in the sample by LC-MS.
[0096] The LC-MS detection conditions mentioned above are as follows:
[0097] Column: Agilent Technologies (Zorbax Rapid Resolution HT C18, 100 × 2.1 mm, 1.8 μm). Mobile phase: A: 0.1% formic acid in water; B: 0.1% formic acid in acetonitrile. Flow rate: 0.3 mL / min, column temperature: 40℃, detection wavelength: 280 nm, injection volume: 5 μL. The system was operated in positive electrospray ionization (ESI+) mode with a fragmenter voltage of 150 V.
[0098] 4) The yield changes of the three recombinant bacteria catalyzing the synthesis of oxamyl alkaloids are shown in Table 4 after LC-MS analysis.
[0099] Table 4. Yield of caustic solanine synthesized by recombinant bacteria
[0100]
[0101] Measurements showed that the yield of botrytis cinerea synthesized by the mutated monoamine oxidase was increased, indicating that the enzyme activity and substrate binding ability were improved to a certain extent after mutation. Using Po1gΔKU70 as the starting strain, the Po1gΔKU70-MAO-P208A strain containing the mutant plasmid pYLMAO-P208A showed a more significant increase in botrytis cinerea yield, with a 40.05% increase compared to Po1gΔKU70-MAO. The modified genetically engineered strain is more suitable for industrial applications in the future, and can significantly reduce production costs and improve production efficiency.
[0102] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention. Improvements and modifications such as strain modification based on the method of the present invention or based on the method are all considered to be within the scope of protection of the present invention.
Claims
1. A monoamine oxidase mutant, characterized in that: Its amino acid sequence is shown in SEQ ID NO.
3.
2. The monoamine oxidase mutant according to claim 1, characterized in that: Its nucleotide sequence is shown in the sequence listing SEQ ID NO.
4.
3. The use of the monoamine oxidase mutant of claim 1 or 2 in the construction of recombinant Yersinia lipophila.
4. The application according to claim 3, characterized in that: The recombinant Yersinia lipophila is a genetically engineered bacillus that produces calciferine. It uses glucose as a carbon source and is catalyzed by a recombinant monoamine oxidase mutant to increase the yield of calciferine synthesis.
5. A biomaterial, characterized in that: The biomaterial includes any of the following: A1) Encoding the nucleic acid molecule of the monoamine oxidase mutant of claim 1; A2) An expression cassette containing the nucleic acid molecules described in A1); A3) A recombinant vector containing the nucleic acid molecules described in A1); A4) Recombinant microorganisms containing the nucleic acid molecules described in A1); A5) Recombinant host cells containing the nucleic acid molecules described in A1).
6. A recombinant Yersinia lipolyticis strain, characterized in that: It is constructed using the monoamine oxidase mutant described in claim 1 or 2.
7. The recombinant Yersinia lipolyticis according to claim 6, characterized in that: The expression plasmid of the monoamine oxidase mutant was transformed into competent cells of Yersinia lipophila strain Po1gΔKU70, plated on a leucine-deficient plate, and after visible colonies grew on the plate, a single colony was randomly picked and cultured overnight.
8. The use of the recombinant Yersinia lipolyticis strain according to claim 6 or 7 in the production of vesicatoria or products containing vesicatoria.
9. The application according to claim 8, characterized in that: The recombinant Yersinia lipophila was cultured in a culture medium, and vesicerine was collected from the culture.
10. The application according to claim 8 or 9, characterized in that: The following steps were taken to prepare bovine heart alkaloids by fermentation: recombinant Yersinia lipolyticis was activated in test tubes and then activated by streak plating on YPD solid medium. After two activations, 1% of the bacteria was inoculated into the fermentation medium and fermented in shake flasks at 30°C and 220 r / min to obtain bovine heart alkaloids.
Citation Information
Patent Citations
Method for producing alkaloids
US20100184166A1